Modified fusion proteins for controlling insect pests

Abstract

The present disclosure relates to recombinant and modified Cry proteins for use in methods and compositions for controlling insect pests, particularly coleopteran pests, particularly Spheophylus levis pests, more particularly Spheophylus levis pests of the crop plant sugarcane. More specifically, the present disclosure relates to a novel chimeric protein named SCW108, variants and fragments thereof. The present disclosure also relates to the production of pesticidal compositions using these proteins. In addition, the present disclosure relates to a method for controlling coleopteran pests, more particularly the coleopteran pest sugarcane weevil.

Description

[0001] Cross-reference to related applications

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 493,452, filed March 31, 2023, the entire contents of which are incorporated herein by reference.

[0003] Reference to electronic sequence listing

[0004] The full contents of the electronic sequence list (207422000740seqlist.xml; size: 14,598 bytes; creation date: March 26, 2024) are incorporated here by reference. Technical Field

[0005] This disclosure relates to methods for controlling insect pests, especially coleopteran pests (particularly sugarcane weevils). Sphenophorus levis) Pests, more specifically the sugarcane weevil, a pest of the crop sugarcane. S. levis This disclosure relates to methods and compositions for controlling Coleoptera pests (more specifically, Coleoptera pests) involving chimeric, recombinant, and / or modified Cry proteins. More specifically, this disclosure relates to a novel chimeric protein named SCW108, its variants, and fragments. This disclosure also relates to the production of insecticidal compositions using these proteins. Furthermore, this disclosure relates to methods for controlling Coleoptera pests (more specifically, Coleoptera pests) involving chimeric, recombinant, and / or modified Cry proteins. Sugarcane weevil The method. Background Technology

[0006] Invertebrate pests cost the global economy hundreds of billions of dollars annually, consuming and destroying cultivated crops vital to human health and survival. In addition to these economic losses, the damage caused by invertebrate pests also wastes a significant portion of potential agricultural food.

[0007] Sugarcane (Saccharum genus) is an important crop used to produce a variety of foods and ethanol. A clonal crop, sugarcane belongs to the same family as maize, rice, and wheat, and is cultivated as the world's largest source of sugar. In addition to its importance as food, sugarcane is also a source of biofuel, ethanol, with a global market size of approximately $50 billion. Sugarcane pests include borers (such as the sugarcane borer), suckers (such as whiteflies), and soil pests (such as termites). The most important sugarcane pests belong to the orders Lepidoptera, Coleoptera, Hemiptera, Hymenoptera, and Isoptera; examples of pests from each order are the sugarcane borer, bollweevil, red-leafhopper, leaf-cutting ant, and termite. One particularly harmful insect pest is the sugarcane weevil or sugarcane billbug. Sphenophorus levis It is a type of Coleoptera pest belonging to the family Cercopithecidae. Sugarcane weevil The damage to sugarcane plants is twofold: first, the insect burrows into the plant's stem tissue and lays eggs; second, the larvae hatching from the eggs feed voraciously on the plant. This damage can result in the loss of 60% of the young stems and 30% of the total crop loss.

[0008] To combat insects affecting sugarcane, the most common solution is the use of chemical mixtures or biopesticides containing at least one insecticidal and / or nematicidal ingredient. These chemical mixtures work by inhibiting multiple stages of the insect's life cycle, affecting behaviors essential for its survival, or directly causing its death. However, these chemicals often affect a wide range of pest groups beyond the target pest, which can harm beneficial symbiotic organisms in the crop, leading to yield reduction. Other problems with these chemical mixtures include the potential environmental accumulation of toxic compounds in the mixture within the crop's surrounding environment. Furthermore, chemical pesticides may not be effective against pests on sugarcane because the feeding behavior of larvae in the stalks prevents effective contact between the pesticide and the insect pests. Some insect pests, such as... Sugarcane weevil, They feed at the base of the stem. This feeding behavior increases the difficulty of large-scale application of chemical agents because effective application is done on the ground, not in the air. For biological pesticides, several options are available, including parasitoid wasps (e.g., Cotesia flavipes , Trichogramma galloi and Tetrastichus howardii ), insect pathogenic fungi (e.g., Metarhizium anisopliae) Metarhizium anisopliae ) and Beauveria bassiana ( Beauveria bassianaBiological pesticides (Bacillus thuringiensis) and bacteria (e.g., Bacillus thuringiensis). Compared to chemical mixtures, biological pesticides are more expensive. Furthermore, biological pesticides have strict requirements for application methods and are only effective under limited conditions. To achieve a certain level of treatment efficacy, multiple approaches are usually required to control insect pests.

[0009] The use of heterologous Bacillus thuringiensis (Bt) proteins, such as delta-endotoxin proteins, can replace chemical mixtures and biopesticides because these proteins can target pests more precisely, degrade more rapidly in the surrounding soil, and have lower levels of bioaccumulation compared to many chemical pesticide mixtures. Furthermore, these proteins allow for the use of other delivery methods, including through compositions and / or transgenic plants. These active delta-endotoxin proteins exert toxicity on target insect pests by inducing selective stomach poisoning in the insect gut. These proteins attach to the interior of the insect gut and cause deterioration of the intestinal cell membrane, ultimately creating holes in the gut that kill the insect. Unlike the insect gut, the human gut is capable of rapidly and harmlessly breaking down any Bt proteins it comes into contact with.

[0010] Many Bt proteins are species-selective, thus limiting their applicability to specific pest species. While this species selectivity makes Bt proteins more suitable for human consumption than some chemical pesticides, it also means that targeted Bt proteins are needed to address specific pests. Therefore, extensive research is required to identify specific Bt proteins effective against specific target pests. Furthermore, there have been numerous cases of insects developing resistance to specific Bt proteins. This is particularly evident for Bt proteins that have been used in crops for multiple generations.

[0011] Clearly, we need to find new and effective proteins that are toxic to plant pests, especially sugarcane pests, more specifically the sugarcane weevil or sugarcane beetle. Sphenophorus levis) Bt proteins have not yet been successfully targeted at this harmful pest, but their advantages over chemical mixtures make them an ideal tool for controlling it. Summary of the Invention

[0012] To meet these needs, this disclosure provides Cry10 / Cry1 chimeric proteins, variants, and fragments thereof for the control of insect pests, particularly Coleoptera, insecticidal compositions including these proteins, expression cassettes encoding these proteins, and organisms containing them. The protein disclosed herein, designated SCW108 (SEQ ID NO: 1), is a chimeric protein containing domains I and II from SCW18 (SEQ ID NO: 2) and domain III from SCW400 (SEQ ID NO: 3). Its N-terminal and C-terminal tail regions are truncated. This disclosure also provides methods for using such chimeric proteins and their recombinant, modified, truncated, and / or mutant forms for the control of insect pests, particularly Coleoptera, including insecticidal compositions of these proteins, expression cassettes encoding these proteins, and plants and microorganisms containing them. Specifically, this disclosure relates to the control of Coleoptera pests, particularly Coleoptera. Sugarcane weevil Use of toxic chimeric Cry proteins (e.g., SCW108).

[0013] In some aspects, this disclosure relates to a chimeric polypeptide having: a) a sequence having at least two domains selected from domain I, domain II, and domain III of a Cry10Aa protein; and b) a domain III sequence from a Cry1A protein. In some embodiments of this aspect, the domain III sequence from the Cry1A protein is derived from a Cry1Ab protein. In some embodiments of this aspect, the domain III sequence from the Cry1Ab protein is derived from a Cry1Ab11 protein. In some embodiments of this aspect, the polypeptide comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with SEQ ID NO: 1, and / or variants or fragments thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the sequence having at least two domains selected from domain I, domain II, and domain III of the Cry10Aa protein includes a sequence having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, or at least 97% sequence identity with SEQ ID NO: 2, and the Cry1A protein domain III sequence includes a sequence having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, or at least 97% sequence identity with SEQ ID NO: 3. In some embodiments of this aspect, the polypeptide includes a sequence having at least 80% sequence identity with SEQ ID NO: 2 and a sequence having at least 90% sequence identity with SEQ ID NO: 3. In some embodiments of this aspect, the polypeptide includes the sequence of SEQ ID NO: 1. In another embodiment of this aspect, the polypeptide comprises a sequence having at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 1 and / or a sequence having at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 2; a sequence having at least one N-terminal or C-terminal addition compared to SEQ ID NO: 1 and / or a sequence having at least one N-terminal or C-terminal addition compared to SEQ ID NO: 2; a sequence having at least one domain exchange compared to SEQ ID NO: 1 and / or a sequence having at least one domain exchange compared to SEQ ID NO: 2; a sequence having at least one truncated section compared to SEQ ID NO: 1 and / or a truncated section compared to SEQ ID NO: 2, and / or a sequence having at least one other alteration compared to SEQ ID NO: 1 and / or a sequence having at least one other alteration compared to SEQ ID NO: 2.

[0014] In another aspect, this disclosure relates to a chimeric polypeptide comprising: at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 1; at least one addition at the N-terminus or C-terminus compared to SEQ ID NO: 1; at least one domain exchange compared to SEQ ID NO: 1; at least one truncation compared to SEQ ID NO: 1; and / or at least one other modification compared to SEQ ID NO: 1. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polypeptide has insecticidal activity against at least one agricultural insect pest. In some embodiments of this aspect, the at least one insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil

[0015] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica) Species, Trechus subsignatus、 Migdolus fryanus、Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata) Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .

[0016] Certain aspects of this disclosure relate to polynucleotides encoding polypeptides of any of the foregoing embodiments. In some embodiments of this aspect, the polynucleotide comprises the sequence of SEQ ID NO: 4. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide has codons optimized for expression in agriculturally important crops. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide is a non-genomic polynucleotide. In some embodiments of this aspect, the polynucleotide is a synthetic polynucleotide, and / or said polynucleotide is cDNA.

[0017] Certain aspects of this disclosure relate to an isolated construct or expression cassette comprising a nucleotide or polynucleotide encoding a polypeptide of any of the foregoing embodiments, wherein the nucleotide or polynucleotide is operatively linked to a promoter and optionally operatively linked to a heterologous regulatory element. In some embodiments of this aspect, the polypeptide comprises SEQ ID NO: 1. In some embodiments of this aspect, the polynucleotide comprises SEQ ID NO: 4. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the promoter is selected from constitutive promoters, inducible promoters, and tissue-specific promoters.

[0018] In some aspects, this disclosure relates to a transgenic plant, plant part, propagule, seed, tissue, organ, embryo, or plant cell comprising a polypeptide, a polynucleotide, or an isolated construct or expression cassette of any of the foregoing embodiments. In some embodiments of this aspect, the polypeptide comprises SEQ ID NO:1. In some embodiments of this aspect, the polynucleotide comprises SEQ ID NO:4.

[0019] Another aspect of this disclosure relates to an insecticidal composition comprising: (i) one or more polypeptides of any of the foregoing embodiments, wherein the concentration of the one or more polypeptides is sufficient to control at least one agricultural insect pest; (ii) one or more polynucleotides of any of the foregoing embodiments, wherein the polynucleotides optionally have codons optimized for expression in agriculturally important crops; and / or (iii) one or more isolated constructs or expression cassettes of any of the foregoing embodiments. In some embodiments of this aspect, the one or more polypeptides comprise SEQ ID NO: 1. In some embodiments of this aspect, the one or more polynucleotides comprise SEQ ID NO: 4. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the at least one insect pest is a coleopteran pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), when the composition is applied to a plant or plantation, the concentration of the one or more polypeptides is sufficient to control at least one agricultural insect pest in or on the plant. In some embodiments of this aspect, the plant and plantation are sugarcane. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition further comprises one or more inert components and / or an acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste, colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as an orally acceptable, orally applicable, or orally ingestible feed for insect pests. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated for direct soil application and / or direct potting substrate application. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a controlled-release formulation. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), control of coleopteran pests includes: a) reducing pest infestation by 40%, 50%, 60%, 70%, 80%, 90%, or 100%; or b) increasing pest mortality by 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the coleopteran pests are selected from:Sugarcane weevil , Sphenophorus maidis Cotton boll weevil

[0020] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica) Species, Trechus subsignatus、 Migdolus fryanus、Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata) Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus Red-brown weevil ( hampei) ) and Scarabaeidae ( Rhynchophorus ferrugineus Species. In some embodiments of this aspect, the Coleoptera pest is Scarabaeidae) .

[0021] Another aspect of this disclosure relates to a method for controlling insect pest populations, comprising: a) providing a composition comprising at least one polypeptide from any of the foregoing embodiments, or providing a composition from any of the foregoing embodiments; and b) contacting an insect pest population with an effective amount of the composition. In some embodiments of this aspect, the at least one polypeptide comprises SEQ ID NO: 1. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the contact in step (b) comprises one or more of the following: providing the pest with a composition formulated as an insect bait; feeding the pest with the composition; applying the composition to the outer surface of the pest; applying the composition to a plant; applying the composition to a plant part fed by the pest; applying the composition to a soil area where the pest may be present; applying the composition to an area where the pest population may be present; applying the composition formulated as a controlled-release formulation to an area where the pest is expected to appear; applying the composition to an insect pest trap; injecting the composition into a plant; or injecting the composition into the pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the contact in step (b) comprises applying the composition to a plant or an area to be planted. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to plants by at least one of foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste, colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the pests are brought into contact with an effective amount of the composition by feeding, spraying, spreading, coating, or wetting the composition, or any combination thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest population is reduced by 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to an insect pest population that has not been exposed to the composition. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pests or insect pest populations are resistant to at least one Bt toxin.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the method further includes providing a chemical mixture, an insecticidal protein, and / or a biocontrol agent, and contacting an insect pest population with an effective amount of the chemical mixture, the insecticidal protein, and / or the biocontrol agent before, during, or after step (b). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sugarcane weevil Cotton boll weevil

[0022] ( Sphenophorus maidis ), genus *Fireflybea* ( Anthonomus grandis Species, Diabrotica) Trechus subsignatus、 Potato beetle ( Migdolus fryanus、Cerotoma arcuata tingomariana Leptinotarsa Banana bulb weevil ( decemlineata) Coffee berry borer ( Cosmopolites sordidus) Hypothenemus Red-brown weevil ( hampei) ) and Scarabidae ( Rhynchophorus ferrugineus Species. In some embodiments of this aspect, the Coleoptera pest is Scarabaeidae) .

[0023] Another aspect of this disclosure relates to a method for controlling insect pest populations, comprising: a) providing an insecticidal composition comprising SEQ ID NO:1; b) introducing the insecticidal composition into an insect pest population, wherein the introduction is achieved by providing the composition in or on a food source of the insect pest; and wherein the insect pest population is reduced. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the introduction of step (b) comprises one or more of the following: providing the pest with a composition formulated as insect bait; feeding the pest the composition; applying the composition to a plant; applying the composition to plant parts fed by the pest; applying the composition to an insect pest trap; or injecting the composition into a plant. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste, colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to plants by at least one of foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest population is reduced by 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to an insect pest population not exposed to the composition, or the pest mortality rate is increased by 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the method further includes providing a chemical mixture, an insecticidal protein, and / or a biocontrol agent, and contacting the insect pest population with an effective amount of the chemical mixture, the insecticidal protein, and / or the biocontrol agent before, during, or after step (b). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest or insect pest population is resistant to at least one Bt toxin. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil ,Sugarcane weevil Cotton boll weevil

[0024] ( Sphenophorus maidis ), genus *Fireflybea* ( Anthonomus grandis Species, Diabrotica) Trechus subsignatus、 Potato beetle ( Migdolus fryanus、Cerotoma arcuata tingomariana Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .

[0025] Other aspects of this disclosure relate to the use of the polypeptides in any of the foregoing embodiments for the purpose of inhibiting insect growth, controlling or killing insects, and / or controlling or killing insect populations. Brief description of the attached diagram

[0027] Figure 1 The results of a protein toxicity bioassay screening of sugarcane weevil (or sugarcane beetle, SCW) larvae are shown. The vertical axis shows the relative corrected mortality percentage for each tested protein, and the horizontal axis lists these proteins. The dark gray bars represent the mortality percentage of the proteins (“P” prefix) in this disclosure; from left to right: SCW108 (SEQ ID NO: 1), SCW6 (SEQ ID NO: 5), and SCW18 (SEQ ID NO: 2). Other experimental data related to these results are shown in Table 1. Detailed Implementation

[0028] The following description illustrates exemplary methods, parameters, etc. However, it should be understood that these descriptions are not intended to limit the scope of this disclosure, but rather to describe exemplary embodiments.

[0029] Methods for controlling insect pests

[0030] One aspect of this disclosure relates to a method for controlling insect pest populations, comprising: (a) providing a composition comprising at least one polypeptide from any of the foregoing embodiments, or providing a composition from any of the foregoing embodiments; and (b) contacting an insect pest population with an effective amount of the composition. In some embodiments of this aspect, the at least one polypeptide is SEQ ID NO: 1 and / or a variant or fragment thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the contact in step (b) comprises one or more of the following: providing the pest with a composition formulated as an insect bait; feeding the pest with the composition; applying the composition to the outer surface of the pest; applying the composition to a plant; applying the composition to a plant part (e.g., a sugarcane stalk) fed by the pest; applying the composition to a soil area where the pest may be present; applying the composition to an area where the pest population may be present; applying the composition formulated as a controlled-release formulation to an area where the pest is expected to appear; applying the composition to an insect pest trap; injecting the composition into a plant; or injecting the composition into the pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste (e.g. for coating or smearing), colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the pest is brought into contact with an effective amount of the composition by feeding, spraying, spreading, coating, or wetting the composition or any combination thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the contact in step (b) includes applying the composition to the plant or the area to be planted. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to the plant in at least one of the following ways: foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. The method of plant treatment can vary depending on factors known in the art, such as planting timing, the resilience of individual plant parts or organs, the timing of insect pest appearance, the extent and location of insect pest infestation, and / or the effective amount of the composition included in the treatment. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest population is reduced by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to an insect pest population not exposed to the composition. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest or insect pest population is resistant to at least one Bt toxin. Some embodiments of this aspect (which may be combined with any of the foregoing embodiments) further include providing a chemical mixture, an insecticidal protein (e.g., Bt protein), and / or a biocontrol agent, and contacting the insect pest population with an effective amount of the chemical mixture, insecticidal protein, and / or biocontrol agent before, during, or after step (b). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: sugarcane weevil, etc. Sphenophorus maidis Cotton boll weevil

[0031] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is the sugarcane weevil.

[0032] Another aspect of this disclosure relates to a method for controlling insect pest populations, comprising: (a) providing an insecticidal composition comprising SEQ ID NO: 1 or a variant or fragment thereof; (b) introducing the insecticidal composition into an insect pest population, wherein the introduction is achieved by providing the composition in or on a food source of the insect pest; and wherein the insect pest population is reduced. In some embodiments of this aspect, the introduction in step (b) comprises one or more of the following: providing the pest with a composition formulated as insect bait; feeding the pest the composition; applying the composition to a plant; applying the composition to plant parts fed by the pest; applying the composition to an insect pest trap; or injecting the composition into a plant. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste (e.g. for coating or smearing), colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to plants in at least one of the following manner: foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. The method of plant treatment may vary depending on factors known in the art, such as planting timing, the resilience of individual plant parts or organs, the timing of insect pest appearance, the extent and location of insect pest infestation, and / or the effective amount of the composition included in the treatment. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest population is reduced by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to an insect pest population not exposed to the composition. Some embodiments of this aspect (which may be combined with any of the foregoing embodiments) further include providing a chemical mixture, an insecticidal protein (e.g., Bt protein), and / or a biocontrol agent, and contacting the insect pest population with an effective amount of the chemical mixture, insecticidal protein, and / or biocontrol agent before, during, or after step (b). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest or insect pest population is resistant to at least one Bt toxin.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the beetle pests are selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil

[0033] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .

[0034] Other aspects of this disclosure relate to the use of the peptides in any of the foregoing embodiments for inhibiting insect growth, controlling or killing insects, and / or controlling or killing insect populations. In some embodiments, contact with one or more peptides from the foregoing embodiments results in insect stunting, cessation of plant damage, or insect death.

[0035] The active ingredient (i.e., the recombinant polypeptide) in this embodiment is typically present in the composition and can be applied to the crop area, plant, or seed to be treated. The composition of this embodiment can be applied simultaneously or sequentially with other compounds. The number of applications and the application rate depend on the severity of insect pest infestation.

[0036] "Controlling insect pest populations" aims to limit or eliminate associated damage to plants caused by insect pests by, for example, inhibiting their ability to grow, feed, and / or reproduce, or by killing them. The method includes preparing a compound or mixture containing an insecticidal recombinant polypeptide, and then contacting the compound or mixture with the insect pest. In some embodiments, this contact may include delivering the insecticidal polypeptide from insect bait to the insect pest. Another embodiment includes coating the insecticidal polypeptide onto plant seeds, whereby an insect interacts with the seeds or the resulting plant, thereby triggering the insecticidal activity of the polypeptide. In some embodiments, contacting the pest with the insecticidal composition of this disclosure includes exposing the insect pest to the insecticidal polypeptide at the site of insect attack. "Contact" also includes applying the composition to the outer surface of the pest, applying the composition to the plant on which the pest feeds, applying the composition to the soil where the pest may be present, applying the composition to a general area of ​​the pest population, applying the composition to an insect pest trap, injecting the composition into the plant or the pest, and any combination thereof.

[0037] The presence of the insecticidal polypeptides protects plants from insect pests, thereby controlling insect pests. On one hand, the use of expression cassettes to produce active insecticidal polypeptides can be used to prepare the compositions disclosed herein. In another embodiment, the invention provides recombinant microorganisms, transgenic plants, and / or any other animal organisms expressing active insecticidal polypeptides. These methods include transforming the organism with a nucleic acid sequence encoding the insecticidal polypeptide. Specifically, the nucleic acid sequences disclosed herein can be used to prepare plants and microorganisms with insecticidal activity. Thus, the invention provides transformed bacteria, yeast, plants, plant cells, plant tissues, plant parts, propagules, organs, tissues, embryos, and seeds. The compositions are insecticidal nucleic acids and proteins of bacterial species. The embodiments described herein can be used in agriculture as methods for protecting plants from insect pests and methods for influencing insect pests.

[0038] Compositions and formulations containing insecticidal polypeptides or variants or fragments thereof can be used in methods of controlling or influencing insect pests. "Influencing insect pests" is intended to mean, for example, preventing insect pests from further feeding on plants, harming insect pests, or killing insect pests. In this use, "influencing insect pests" is a form of insect pest control. Certain aspects and embodiments of this disclosure further provide methods for influencing plant insect pests, including, for example, applying a composition or formulation containing an insecticidal polypeptide to the environment of the insect pest. In one embodiment, the insecticidal polypeptide is combined with a carrier and subsequently applied to the environment of the insect pest. While these embodiments are not bound by any operational theory, in one embodiment, the insect pest ingests the insecticidal polypeptide, thereby influencing the insect pest. Insect pests can be contacted with an effective amount of the insecticidal composition by feeding, spraying, spreading, coating, wetting, and / or combinations thereof. The insecticidal composition can be applied to plants that insect pests are feeding on and / or will feed on by foliar treatment, seed coating, injection treatment, pre-emergence treatment, post-emergence treatment, and / or any combination thereof.

[0039] The compositions of this embodiment can be used to protect plants, plant parts, propagules, embryos, tissues, organs, seeds, and plant products in a variety of ways. For example, these compositions can be used in methods involving placing an effective amount of the insecticidal composition into the environment of pests by spraying, spreading, or seed coating. In one specific embodiment, such plants are sugarcane plants. In plant propagation materials (fruits, tubers, etc.) Bulbs, stems, tissue-cultured seedlings, corms, grains, seeds, and artificial seeds are typically treated with a protective coating before being sold commercially. This coating contains a herbicide, insecticide, fungicide, bactericide, nematicide, molluscicide, or a mixture of several of these formulations. If desired, it may also be used with other carriers, surfactants, or adjuvants commonly used in the formulation field to provide protection against damage caused by bacteria, fungi, or animal pests. The protective coating can be applied by impregnating the plant material with a liquid formulation or by coating it with a combination of wet or dry formulations. Furthermore, in special cases, other methods applied to plants may be used, such as treatments targeting buds or fruits. Plant material in embodiments coated with the insecticidal polypeptides of this disclosure can be treated with a protective coating containing a treatment compound, such as captan, carboxin, thiram, methaxamethyl, pyrimiphos-methyl, and other substances commonly used in seed treatments. Alternatively, the materials in the embodiments include a protective coating, which includes an insecticidal composition used alone or in combination with one of the protective coatings commonly used for seed treatment.

[0040] In other embodiments, the insecticidal composition of this disclosure can be applied to areas where plants are grown or will be grown, for example, directly to the soil or to the substrate of plant pots used to prepare planting material. This treatment method may be particularly suitable for sugarcane, as sugarcane is typically propagated using tissue-cultured seedlings or stem segments (rather than seeds). Furthermore, Sugarcane weevil The larvae lay their eggs near the sugarcane roots and feed on the sugarcane stalks, meaning that treatment of the soil or planting substrate may be effective.

[0041] Those skilled in the art will understand that the compositions and methods of this embodiment can be used alone or in combination with other compositions and methods for controlling insect pests affecting plants. For example, this embodiment can be used in combination with other insecticidal proteins, chemical mixtures, and / or biocontrol agents (e.g., biological insecticides). In another embodiment, the insecticidal polypeptides, variants of insecticidal peptides, and / or fragments thereof disclosed herein can be used in integrated pest management practices.

[0042] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. These terms apply to amino acid polymers, where one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, and also to naturally occurring amino acid polymers.

[0043] The methods described herein can provide control by reducing pest populations by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to pest populations that have not been exposed to the composition or preparation.

[0044] Coleoptera pests and other insect pests

[0045] The recombinant protein disclosed herein is effective in killing a variety of insect pests. Specifically, the recombinant protein disclosed herein is effective in killing a variety of Coleoptera insect pests. Examples of non-restricted Coleoptera insect pests in this disclosure include species of the genus *Leptinotarsa*, such as the potato leaf beetle (*Leptinotarsa ​​spp.*). L. decemlineata(Colorado potato beetle); Chrysomela spp., such as C. scripta (cottonwood leaf beetle); Hypothenemus spp., such as H. hampei (coffee berry borer); Rhynchophorus ferrugineus (red palm weevil); Sitophilus spp., such as S. zeamais (maize weevil); Epitrix spp., such as E. hirtipennis (tobacco flea beetle) and E. cucumeris (potato flea beetle). Flea beetle species (Phyllotreta spp.), such as *P. cruciferae* (crucifer flea beetle) and *P. pusilla* (western black flea beetle); flower weevil species (Anthonomus spp.), such as *A. eugenii* (pepper weevil); *Hemicrepidus spp.), such as *H. memnonius* (wireworms); click beetle species (Melanotus spp.), such as *M. communis* (wireworm); *Ceutorhychus spp.*, such as *C. assimilis* (cabbage seedpod weevil); flea beetle species (Phyllotreta spp.), such as *P. cruciferae* (crucifer flea beetle). *Cruciferae* (flea beetles of the Brassicaceae family); *Aeolus* spp., e.g., *A. mellillus* (wireworm); *Aeolus* spp., e.g., *A. mancus* (wheat wireworm); *Horistonotus* spp., e.g., *H. uhlerii* (sand wireworm); species of the genus *Phyllophaga* (white grub); species of the genus *Chaetocnema*, e.g., *C.**Pulicaria* (corn flea beetle); *Popillia* spp., such as *P. japonica* (Japanese beetle); *Epilachnas* spp., such as *E. varivestis* (Mexican bean beetle); *Cerotoma* spp., such as *C. trifurcate* (bean leaf beetle); *Epicauta* spp., such as *E. pestifera* and *E. lemniscata* (blister beetles); *Sphenophorus* spp., such as the sugarcane weevil and *S. maidis*; *Diabrotica* spp., such as *Diabrotica speciosa*, *Trechus subsignatus*, *Migdolus fryanus*, and *Cerotoma*. *Arcuatatingomariana*, *Cosmopolites* spp., for example, the banana bulb weevil (*C. sordidus*) (banana borer); and the scarab beetle family (*Scarabaeidae*).

[0046] In some embodiments, the insecticidal protein of this disclosure is effective against species of the genus *Cryptocephalus* (*Cryptocephalus*). Sphenophorus spp. It is active. The genus *Billbug* is a genus of beetles belonging to the family Cicadae in the order Coleoptera. This genus contains over 60 species, but exemplary *Billbug* species include, but are not limited to, species of the genus *Billbug*, such as... S. Levis (Sugarcane weevil or sugarcane beetle) S. maidis (Corn elephant armor) S. zeae (Timothy billbug) S. parvulus (Bluegrass billbug) and S. callosus (Southern corn weevil).

[0047] Of particular note is Sugarcane weevil ( Sphenophorus levis ), sugarcane weevil or sugarcane beetle ( S. LevisThe adult of this insect drills holes in the internodes of the sugarcane plant near the ground and lays its eggs near the roots or inside the sugarcane stalks. Sugarcane weevil The larvae hatch after 7-12 days and feed directly on sugarcane stalks. Although the burrowing behavior of the female adults causes some initial damage, the main damage comes from the larvae's feeding. The larvae's activity is limited to the first and second internodes of the sugarcane plant. The larval feeding period is 26 to 50 days, followed by a pupal stage of 5 to 13 days. According to research by Degaspari et al., Sugarcane weevil Adults can survive in the soil for up to 250 days (Degaspari, N., et al. Biologia de Sphenopherus levis Vaurie, 1978 (Col.: Curculionidade),em dieta artificial e no campo. Pesquisa Agropecuária Brasileira, Brasília, DF, v. 22, n. 3, p. 553-558, 1987).

[0048] For every 1% of root and stem biomass destroyed by the sugarcane weevil, 1% of sugarcane is lost (Casteliani, A). et al. Crop Protection 137, 105262, 2020). Sugarcane weevil The impact on sugarcane plants can lead to the death of up to 60% of sugarcane tillers, resulting in a yield loss of up to 30% and significantly shortening the lifespan of sugarcane fields (Precetti and Arrigoni). Vaurie, 1978 (Coleoptera: Curculionidae). Copersucar, (São Paulo, Brazil. 1990). Since sugarcane weevils cannot fly long distances, it is believed that infection spreads in the field through the transport of infected seedlings (Vinha, F). people, Sci. Agrar. Parana., 280-288 (2020).

[0049] breeding Sugarcane weevilThe larvae presented a challenge to the experimental design because their larval stage lasted 26 to 50 days, with a larval survival rate of only 35.8%. Among larvae entering the pupal stage, the survival rate was as high as 93%, with the pupal stage lasting 5 to 13 days (Degaspari, N., et al., Biologia de Sphenopherus levis Vaurie, 1978 (Col.:Curculionidade), em dieta artificial e no campo. Pesquisa Agropecuária Brasileira, Brasília, DF, v. 22, n. 3, p. 553-558, 1987). These survival challenges and the long duration of metamorphosis resulted in the insect population growing slowly to a suitable, sustainable sample size.

[0050] The potential insecticidal activity of the proposed proteins against Hemiptera, Diptera, *Miscanthus* species, and / or other piercing-sucking insects (e.g., Orthoptera or Thysanoptera) was considered. Diptera include, but are not limited to, *Leymus* species, such as *Leymus trifoliata*. L. trifolii (leafminer) and American serpentine leafminer ( L. sativae (Vegetable leafminer) Scrobipalpula spp., for example S. absoluta (Tomato leafminer) Delia spp., for example, the gray ground fly ( D. platura (seedcorn maggot) D. brassicae (cabbage maggot) and D. radicum (cabbage rootfly) Psilia spp .,For example P. rosae (Carrot rust fly); and the genus *Spotted leaf fly* (…). Tetanops spp .),For example T. myopaeformis (Beetroot maggot).

[0051] The potential activity of the insecticidal proteins disclosed herein against Lepidoptera insects has been further considered. Lepidoptera insects include, but are not limited to, any Lepidoptera insects currently known or later identified, including insect species in the suborders Zeugloptera, Glossata, and Heterobathmiina, and any combination thereof. Typical Lepidoptera insects include, but are not limited to: species of the genus *Ostrinia*, such as *O. nubilalis* (European corn borer); species of the genus *Plutella*, such as *P. xylostella* (diamondbackmoth); species of the genus *Spodoptera*, such as *S. frugiperda* (fall armyworm), *S. ornithogalli* (yellow-striped armyworm), *S. praefica* (western yellow-striped armyworm), *S. eridania* (southern armyworm), and *S. exigua* (beet armyworm); and species of the genus *Agrotis*, such as *A. ipsilon* (black cutworm), *A. segetum* (common cutworm), and *A.*. Gladiaria (claybacked cutworm) and A. orthogonia (pale western cutworm); Striacosta spp., e.g. S. albicosta (western bean cutworm); Helicoverpa spp., e.g. H. zea (corn earworm), H. punctigera (native cotton bollworm), S. littoralis (Egyptian cotton leafworm), and H. armigera (cottonbollworm); Heliothis spp., e.g. H. virescens (tobacco budworm); Diatraeaspp., e.g. D.*Graniosella* (southwestern corn borer) and *D. saccharalis* (sugarcane borer); species of *Trichoplusia*, such as *T. ni* (cabbage looper); *Sesamia* spp., such as *S. nonagroides* (Mediterranean corn borer); *Pectinophora* spp., such as *P. gossypiella* (pinkbollworm); *Cochylis* spp., such as *C. hospes* (banded sunflowermoth); *Manduca* spp., such as *M. sexta* (tobacco hornworm) and *M. quinquemaculata* (tomato hornworm); *Elasmopalpus* spp., e.g., *E. lignosellus* (lesser cornstalk borer); *Pseudoplusia* spp., e.g., *P. includens* (soybean looper); *Anticarsia* spp., e.g., *A. gemmatalis* (velvetbean caterpillar); *Plathypena* spp., e.g., *P. scabra* (green cloverworm); *Pieris* spp., e.g., *P. brassicae* (cabbage butterfly); *Papaipema* spp., e.g., *P. nebris* (stalk borer); *Pseudaletia* spp., e.g., *P. unipuncta* (common armyworm); *Peridroma* spp., e.g., *P. saucia* (Peridroma moth). saucia); Keiferia spp., for example K. lycopersicella (tomato).

[0052] Tomato pinworm; Artogeia spp., e.g., *A. rapae* (imported cabbage worm); Phthorimaea spp., e.g., *P. operculella* (potato tuber worm); Crymodes spp., e.g., *C. devastator* (glassy cutworm); Feltia spp., e.g. F. ducens (Dingy cutworm); and Telchin spp., such as the giant stem borer ( T. licus In one aspect of this embodiment, the insecticidal protein disclosed herein is active against blackcutworm, sugarcane borer, and / or southwestern corn borer.

[0053] The preferred developmental stage for testing insecticidal activity is the larvae or immature forms of the aforementioned insect pests. The insects can be reared in complete darkness at approximately 20°C to approximately 25°C and a relative humidity of approximately 30% to approximately 70%. Bioassays can be performed as described by Czapla and Lang (1990) J. Econ. Entomol. 83(6):2480-2485. Methods for rearing insect larvae and performing bioassays are well known to those skilled in the art.

[0054] Those skilled in the art are familiar with various bioassay techniques for assessing insecticidal activity and efficacy. Common protocols involve adding an experimental compound to a pest's food source in a sealed container. Common measures of insecticidal activity and efficacy include changes in mortality or other behaviors. Insectic activity can be measured by (but is not limited to) mortality, weight loss, attraction, repellency, and other behavioral and physiological changes following feeding and adequate exposure.

[0055] Cry protein from Bacillus thuringiensis

[0056] Bacillus thuringiensis (Bt) strains expressing insecticidal toxins have been used as biopesticides. This is because they produce delta-endotoxins, also known as crystalline toxins or cry proteins. Bt toxins are a class of insecticidal proteins that are synthesized as protoxins and crystallized as parasporal inclusions. When ingested by insect pests, their microcrystalline structure is dissolved by the alkaline pH of the insect's midgut, and the protoxin is cleaved by intestinal proteases to produce the active toxin. The activated Bt toxin binds to receptors in the insect's intestinal epithelium, causing membrane damage and associated swelling and dissolution of the insect's gut. The insect dies from starvation and septicemia. See, for example, Li et al. (1991) Nature 353:815-821. Any bacterial host cell expressing the novel nucleic acid sequences disclosed herein and producing crystalline proteins is considered useful, such as Bacillus thuringiensis (Bt). B. thuringiensis ), Bacillus megaterium, Bacillus subtilis, Escherichia coli or Pseudomonas species.

[0057] The classification of various delta-endotoxins is based on their activity profiles and sequence homology. Until 1990, the major categories were determined by their activity profiles, with Cry1 proteins active against Lepidoptera (moths and butterflies), Cry2 proteins active against both Lepidoptera and Diptera (flies and mosquitoes), Cry3 proteins active against Coleoptera (beetles), and Cry4 proteins active against Diptera (Hofte and Whitely, 1989, Microbiol. Rev. 53: 242-255). In 1998, a new nomenclature was developed that systematically classified Cry proteins based on amino acid sequence homology rather than activity against certain insect species (Crickmore et al. 1998, Microbiol. Molec. Biol. Rev. 62: 807-813). The Bacillus thuringiensis δ-endotoxin Nomenclature Committee maintains a database of Cry protein nomenclature and the perceived cladistic relationships between various proteomes, accessible at: http: / / www.lifescissexac.uk / home / Neil_Crickmore / Bt / .

[0058] Comparison of the amino acid sequences of Cryotoxins with different specificities further revealed five highly conserved sequence segments. The toxic core structure of Cryotoxins comprises three distinct domains, from the N-terminus to the C-terminus: a cluster of seven α-helices involved in pore formation (referred to as "domain I" or "domain 1"), three antiparallel β-sheets involved in cell binding (referred to as "domain II" or "domain 2"), and a β-sandwich (referred to as "domain III" or "domain 3"). The location and characteristics of these domains are known to those skilled in the art. See, for example, Li et al. (1991), ibid., and Morse et al. (2001), Structure 9:409-417.

[0059] Bt (Bacillus thuringiensis) protein

[0060] Certain aspects of this disclosure relate to chimeric, recombinant, isolated, and / or modified Bt proteins. In particular, the present invention relates to chimeric Bt proteins comprising portions of a Cry10 protein and a Cry1 protein, referred herein as “Cry10 / Cry1” chimeric proteins. Additionally, this disclosure relates to a chimeric Cry protein designated “SCW108” and its recombinant and / or modified variants. Chimeric Cry10 / Cry1 proteins comprise portions of both Cry10Aa and Cry1Ab proteins. For example, the protein disclosed herein designated SCW108 (SEQ ID NO: 1) is a Cry10 / Cry1 chimeric protein generated by fusing domains I and II from SCW18 (SEQ ID NO: 2) and domain III from SCW400 (SEQ ID NO: 3). Its N-terminal and C-terminal tail regions are truncated. This disclosure covers various variants of SCW108, including fragments, deletions, substitutions, and other modifications. Furthermore, this disclosure also includes chimeric proteins comprising different domains of SCW18 (e.g., N-terminal and C-terminal tail regions or regions other than domains I, II, and III) and different domains of SCW400 (e.g., domains I and II), different combinations of domains of SCW18 and SCW400, and combinations of fragments of SCW18 and SCW400. In one embodiment, this disclosure covers an engineered hybrid insecticidal protein (i.e., a chimeric protein) comprising an amino acid sequence from a first Bacillus thuringiensis (Bt) Cry protein fused to an amino acid sequence from a second Bt Cry protein, wherein the second Bt Cry protein is different from the first Bt Cry protein. In some embodiments, the first Bt Cry protein is a Cry10 protein (e.g., Cry10Aa protein), and the second Bt Cry protein is a Cry1 protein (e.g., Cry1Ab11 protein). The amino acid sequences of the first and second Bt Cry proteins used for engineered chimeric proteins may include complete or incomplete variable and conserved regions (including domain I, domain II, and / or domain III) of the first Cry protein, and complete or incomplete variable and conserved regions (including domain III) of the second Cry protein. In one embodiment, such chimeric proteins have targeting at least the sugarcane weevil or sugarcane beetle (…). S. LevisActivity. It is known in the art that the possibility of creating chimeric proteins with enhanced properties by rearranging the domains of a variety of naturally occurring insecticidal crystal proteins known in the art is extremely low. See, for example, Jacqueline S. Knight, et al., “A Strategy for Shuffling Numerous Bacillusthuringiensis Crystal Protein Domains.” J. Economic Entomology, 97 (6)(2004): 1805-1813.

[0061] Cry10Aa is a known Cry toxin in the Cry10 group of Bt proteins (see, for example, Carozzi). et al. 2007US20070240239A1). To date, at least five Cry10 genes have been reported (Crickmore, N. “Full list of delta-endotoxins”; accessed March 24, 2023; available at: www.lifesci.sussex.ac.uk / home / Neil_Crickmore / Bt / toxins2.html). Ribeiro wait people The 2017 paper "Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil" (Plant Biotechnol J, 15: 997-1009. https: / / doi.org / 10.1111 / pbi.12694) indicates that the Cry10Aa protein confers high resistance to the cotton boll weevil. Anthonomus grandis It is toxic. Qureshi and Qureshi (2019, US20190345513A1) pointed out that co-expression of Cry11a12 and Cry10Aa in cotton plants may help control certain Coleoptera pests.

[0062] However, previous studies have not provided clear evidence that Cry10Aa protein or chimeric proteins containing Cry10Aa protein fragments can specifically inhibit Sugarcane weevilThe activity of [the protein]. For example, Carozzi et al. (2007 US20070240239A1) compared the amino acid sequence of a protein they named “AXMI-003” with a large number of Cry endotoxin genes, including Cry10Aa. By comparing the sequence of AXMI-003 with a truncated Cry10Aa sequence that has its C-terminal nontoxic domain removed, they found that AXMI-003 and Cry10Aa share 20% identity in the toxin domain. Among the 12 Cry genes compared with AXMI-003, Cry10Aa had the second smallest percentage of identity. Even among the Cry genes most similar to AXMI-003 compared by Carozzi et al. (particularly the Cry1I family and Cry1IE1), Carozzi et al. emphasized that "there are significant differences between AXMI-003 and existing Cry1I toxins (including Cry1IE1)" (Carozzi et al., 2007 US20070240239A1, paragraph

[0100] ). This suggests that any effects of AXMI-003 on insect pests may not necessarily be found in Cry1 or Cry10 genes (e.g., Cry10Aa).

[0063] Previous studies have revealed protein sequences that share some homology with SCW108, but have not found chimeric proteins, such as Cry10Aa and Cry1Ab or parts thereof or domains thereof.

[0064] For example, Chan et al. (2020, WO2020216322A1), in discussing methods for immobilizing recombinant proteins by trapping them in co-expressed protein crystals, provided an overall discussion of Cry "fusion" proteins and Cry1Ab, and compared their "NegCry3Aa" protein sequence with different Cry proteins, including Cry10Aa (see Figure 27, G, Chan et al.), but did not discuss Cry10Aa further. Sampson et al. (2020, US20200102573A1) disclosed two sequences with a certain degree of identity to SCW108—one with 41.11% identity and 99.00% coverage; the other with 42.28% identity and 93.00% coverage (SEQ ID NO: 287 and 288 in Sampson et al.)—but did not propose a chimeric protein. Carlson et al. (2018, WO2018075269A1) disclosed several proteins with approximately 82% homology to SCW108, but did not propose any chimeric proteins. Espinoza et al. (2010, WO2010043928A1) disclosed a Cry10Aa protein (SEQ ID NO: 7 in Espinoza et al.), which is effective against the cotton boll weevil (…). A. grandis The sequence described above is an activity against a coleopteran pest associated with the sugarcane weevil, and it shares 82.99% identity and 97% coverage with SCW108. Similarly, Carozzi et al. (2004, US20040250311) disclosed a Cry10Aa protein that shares 82.99% identity and 97% coverage with SCW108, but did not mention a chimeric protein or any activity against coleopteran pests. Similarly, Walfield and Pollock (1987, US4652628) disclosed a sequence (SEQ ID NO: 2 in Walfield and Pollock) that shares 92.98% identity and 83.00% coverage with SCW108, but did not mention a chimeric protein or any activity against coleopteran pests. Finally, Ribeiro et al.'s research revealed a Cry10Aa protein with 82.99% identity to SCW108, which is effective against the cotton boll weevil ( Anthonomus grandisThe study found that Cry10Aa protein is active against sugarcane weevils (a type of beetle), but it did not mention any chimerism with Cry1Ab, nor any activity against sugarcane weevils (Ribeiro et al., (2017), Transgenic cotton expressing Cry10Aa toxin confers highresistance to the cotton boll weevil, Plant Biotechnol J, 15: 997-1009. https: / / doi.org / 10.1111 / pbi.12694). However, there is currently no data to prove that Cry10Aa protein has activity against sugarcane weevils.

[0065] Cry1Ab is also a known Cry toxin in the Cry1 group of Bt proteins. To date, at least 100 Cry1A genes have been reported, including at least forty Cry1Ab genes (Crickmore, N. “Full list of delta-endotoxins”; accessed March 24, 2023; available at: www.lifesci.sussex.ac.uk / home / Neil_Crickmore / Bt / toxins2.html). For example, Cry1Aa, Cry1Ab, Cry1Ac, Cry1B, and Cry1F are known to have activity against lepidopteran insects, and are known to have protoxin forms of 130-140 kDa to toxic protein forms of approximately 60-70 kDa (see, for example, Hart et al. 2016, US20160304569A1). Mittendorf et al. (2018, EP3313867) disclosed a chimeric protein called “eCry3.1Ab” containing an active domain against coleopteran pests and a C-terminal portion of Cry1Ab. However, Mittendorf et al. did not propose constructing a chimeric protein with Cry10Aa, nor did they demonstrate any activity against the sugarcane weevil. Furthermore, Hart et al. (2016, US20160304569A1) disclosed a chimeric protein called “2OL-10” (SEQ ID NO: 42 of Hart et al.), which contains an N-terminal portion of Cry3A055 (known for its activity against coleopteran pests) and a C-terminal portion of Cry1Ab (known for its activity against lepidopteran pests). However, Hart et al. found that "adding only 25% of the Cry1Aa sequence disrupted the activity against coleopteran insects to which the parent Cry3A was active." Hart et al. concluded that this indicates that "hybrid proteins prepared by fusing portions of active coleopteran Cry proteins (e.g., Cry3A) and active lepidopteran Cry proteins (e.g., Cry1A) will not possess activity against coleopteran insects." (Hart et al.) people, 2016, US20160304569A1, paragraph

[0015] ). This disclosure by Hart et al. indicates that the chimeric protein between Cry10Aa and Cry1A proteins will eliminate the toxicity of Cry10Aa protein to coleopteran pests, and that such a chimera is therefore unlikely to be effective against coleopteran pests.

[0066] In some aspects, this disclosure relates to a chimeric polypeptide having: a) a sequence having at least two domains selected from domain I, domain II, and domain III of a Cry10Aa protein; and b) a domain III sequence from a Cry1A protein. In some embodiments of this aspect, the domain III sequence from the Cry1A protein is derived from a Cry1Ab protein. In some embodiments of this aspect, the domain III sequence from the Cry1Ab protein is derived from a Cry1Ab11 protein. In some embodiments of this aspect, the polypeptide comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with SEQ ID NO: 1, and / or variants or fragments thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the sequence having at least two domains selected from domain I, domain II, and domain III of the Cry10Aa protein includes a sequence having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, or at least 97% sequence identity with SEQ ID NO: 2, and the Cry1A protein domain III sequence includes a sequence having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, or at least 97% sequence identity with SEQ ID NO: 3. In some embodiments of this aspect, the polypeptide includes a sequence having at least 80% sequence identity with SEQ ID NO: 2 and a sequence having at least 90% sequence identity with SEQ ID NO: 3. In some embodiments of this aspect, the polypeptide includes the sequence of SEQ ID NO: 1.

[0067] In another aspect, this disclosure relates to a chimeric polypeptide comprising: at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 1; at least one addition at the N-terminus or C-terminus compared to SEQ ID NO: 1; at least one domain exchange compared to SEQ ID NO: 1; at least one truncation compared to SEQ ID NO: 1; and / or at least one other modification compared to SEQ ID NO: 1. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polypeptide has insecticidal activity against at least one agricultural insect pest. In some embodiments of this aspect, the at least one insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus, Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa ​​decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .

[0068] Certain aspects of this disclosure relate to polynucleotides encoding polypeptides of any of the foregoing embodiments. In some embodiments of this aspect, the polynucleotide comprises the sequence of SEQ ID NO: 4. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide has codons optimized for expression in agriculturally important crops. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide is a non-genomic polynucleotide. In some embodiments of this aspect, the polynucleotide is a synthetic polynucleotide, and / or said polynucleotide is cDNA.

[0069] This disclosure provides a Cry10 / Cry1 chimeric protein named SCW108 (SEQ ID NO: 1), variants thereof, and fragments thereof. SCW108 (SEQ ID NO: 1) is 687 residues in length. The Cry10 / Cry1 chimeric protein SCW108 is generated by fusing domains I and II from SCW18 (SEQ ID NO: 2) and domain III from SCW400 (SEQ ID NO: 3). The nucleotide sequence encoding SCW108 is shown in SEQ ID NO: 4.

[0070] In some embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide having at least 80% sequence identity with SEQ ID NO:1. In further embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:1.

[0071] This disclosure contemplates chimeras that incorporate two or more of the protein domains disclosed herein. Variants and / or fragments of the proteins disclosed herein include, but are not limited to, homologous (or partially homologous) sequences and peptides based on sequences selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and / or derived from polynucleotides altered by site-directed mutagenesis, domain exchange, DNA shuffling, or any other method known in the art.

[0072] In other embodiments, the isolated and / or recombinant proteins disclosed herein can be used as recombinant proteins expressed in transgenic plants, microorganisms, and fungi. Thus, a recombinant microorganism or fungus expressing an active insecticidal protein and a transgenic plant are provided. The method involves transforming an organism with a nucleic acid sequence encoding an insecticidal polypeptide. Specifically, these insecticidal polynucleotides can be used to prepare plant, microorganism, fungal, and other animal cells with insecticidal activity. Therefore, the present invention provides transformed bacteria, yeast, fungi, plants, plant cells and animal cells, plant tissues, plant parts, propagules, organs, tissues, embryos, and seeds. Another embodiment of this disclosure includes a composition comprising insecticidal nucleic acids and / or insecticidal proteins incorporated into or expressed in a microorganism, fungus, or plant. The embodiments herein can be used in agriculture as methods for protecting plants from insect pests and for controlling insect pests or insect pest populations.

[0073] As used herein, the terms “insecticide activity,” “insecticide gene,” or “insecticide polynucleotide” refer to the nucleotide sequence encoding a polypeptide that exhibits insecticidal activity. As used herein, the term “insecticide activity” refers to the ability of a substance (e.g., a polypeptide) to inhibit the growth, feeding, or reproduction of insect pests and / or kill insect pests. “Insecticide polypeptide,” “insecticide protein,” or “insect toxin” are intended to refer to proteins with insecticidal activity.

[0074] As used herein, the terms “insecticide activity” and “pesticide efficacy” are synonymous and refer to the activity of an organism or substance (e.g., a protein) that can be measured by, but is not limited to, pest mortality, pest weight loss, pest repellency, and other behavioral and bodily changes following appropriate feeding and exposure. In this way, insecticide activity affects at least one measurable parameter of pest fitness. Assessments of insecticide activity are well known in the art. See U.S. Patent Nos. 6,570,005 and 6,339,144. As used herein, “insecticide efficacy” refers to the level of insecticide or pesticidal activity exhibited by an organism or substance. Generally, higher insecticide efficacy corresponds to lower pest fitness and higher pest mortality.

[0075] The isolated and / or recombinant proteins disclosed herein include various embodiments that can be conveniently used as insecticidal compositions for exogenous applications, such as for topical and / or systemic application to field crops, forage grasses, fruits and vegetables, and ornamental plants, and / or as recombinant proteins for expression in transgenic plants or microorganisms. The insecticidal compositions of the present invention will be described in more detail in the next section (“Compositions Containing Sugarcane Weevil Proteins”). In one embodiment, the biological insecticidal composition comprises a water-dispersible granule. The granule comprises one or more of the sugarcane weevil proteins disclosed herein. In another embodiment, the insecticidal composition comprises an oil-flowable suspension of one or more of the sugarcane weevil proteins disclosed herein.

[0076] Orally acceptable or orally applicable insect feeds in which the insecticidal proteins of this disclosure can be incorporated are well known in the art, as described herein. These can be contained in any composition that can be orally ingested by the target insect pest, for example, in the form of cell extracts, cell suspensions, cell homogenates, cell lysates, cell supernatants, cell filtrates, cell precipitates, and / or protein extracts or purified proteins or fusion proteins of this disclosure, when the proteins or fusion proteins of this disclosure are expressed from host cells (e.g., plant, fungal, or bacterial cells). In one embodiment, a composition containing the insecticidal peptides of this disclosure can be formulated as a powder, granule, pellet, granule, spray, emulsion, gel, or solution, any of which can be topically applied to a matrix that is, or can be, an orally ingestible, orally acceptable, or orally applicable feed for the target insect pest.

[0077] In some embodiments, controlling insect pests includes feeding the composition to the pests, applying the composition to the outer surface of the pests, applying the composition to plants that the pests feed on, applying the composition to soil where the pests may be present, applying the composition to a general area of ​​the pest population, or injecting the composition into the plant or the pest. In one specific embodiment, the plant is a sugarcane plant. In some embodiments, the insect pest population is reduced by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%. In some embodiments, insect infestation is reduced by 50% to 100% compared to methods of treating insect infestation using exogenous sugarcane weevil protein without the use of this disclosure.

[0078] SCW protein in expression cassette

[0079] Certain aspects of this disclosure relate to an isolated construct or expression cassette comprising a nucleotide or polynucleotide encoding a polypeptide of any of the foregoing embodiments, wherein the nucleotide or polynucleotide is operatively linked to a promoter and optionally operatively linked to a heterologous regulatory element. In some embodiments of this aspect, the polypeptide comprises SEQ ID NO: 1. In some embodiments of this aspect, the polynucleotide comprises SEQ ID NO: 4. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the promoter is selected from constitutive promoters, inducible promoters, and tissue-specific promoters.

[0080] In another aspect, this disclosure provides a method for preparing an expression cassette comprising a nucleic acid sequence encoding one of the sugarcane weevil proteins of this disclosure. Methods for preparing expression cassettes are well known in the art. Expression cassettes are typically designed with a promoter at the 5' end of the cassette, upstream of a desired polynucleotide segment encoding a protein of this disclosure, said protein comprising SEQ ID NO: 1, variants and / or fragments of SEQ ID NO: 1, and combinations thereof.

[0081] A promoter may consist of multiple different promoter elements that are operatively linked to initiate transcription of a sequence encoding a protein disclosed herein. A DNA sequence consisting of a promoter-protein-coding DNA may be operatively linked at its 3' end to a transcription termination signal sequence that functions in microorganisms, fungi, animals, and / or plants to produce a recombinant DNA construct.

[0082] On one hand, the aforementioned recombinant DNA construct is contained in an expression cassette for expression in cells. The expression cassette is designed with a promoter upstream of the desired polynucleotide segment encoding the protein of this disclosure at its 5' end. The 5' untranscribed DNA may contain a promoter, which may consist of multiple different promoter and enhancer elements operatively linked to initiate transcription of a downstream sequence, including a sequence encoding the polypeptide of this disclosure. One or more transcribed but not translated DNA sequences may be operatively linked to the 3' end of the promoter in the expression cassette, including a leader sequence and / or intron sequences. The intron sequences are optionally located at the 3' end of the leader sequence, or in some cases within an open reading frame encoding the desired protein. A polynucleotide segment encoding an optional translocation polypeptide (e.g., a signal peptide or chloroplast transport peptide) may be inserted into the 5' end of the protein-coding sequence of this disclosure to localize the protein of this disclosure to a specific subcellular location. The nucleotide sequence encoding the protein disclosed herein is optionally operably located within the above-described expression cassette and operably linked with any necessary polyadenylation (polyA) and / or transcription termination sequences that function in microbial, fungal, animal, and / or plant cells.

[0083] As used herein, an "expression cassette" refers to a nucleic acid sequence capable of directing the expression of a specific nucleotide sequence in a suitable host cell. It contains a promoter operatively linked to the target nucleotide sequence, which in turn is operatively linked to a termination signal. It typically also contains the sequence required for the correct translation of the nucleotide sequence. An expression cassette containing the target nucleotide sequence may have at least one component that is heterologous to at least one of its other components. Expression cassettes may also be naturally occurring but obtained through recombinant processes for heterologous expression. However, typically, expression cassettes are heterologous relative to the host; that is, the specific nucleic acid sequence of the expression cassette is not naturally present in the host cell and must be introduced into the host cell or a progenitor cell of the host cell through a transformation event. Expression of the nucleotide sequence in the expression cassette can be controlled by a constitutive promoter or an inducible promoter, the latter initiating transcription only when the host cell is exposed to certain specific external stimuli. In the case of multicellular organisms such as plants, the promoter may also be tissue- or organ- or developmentally stage-specific.

[0084] Expression cassettes containing the target nucleotide sequence can be chimeric, meaning that at least one component is heterologous relative to at least one of its other components. Expression cassettes can also be expression cassettes containing a natural promoter driving their native gene; however, they are obtained in a recombinant form that can be used for heterologous expression. This use of the expression cassette means that it is not naturally present in the cell in which it is introduced. The term "isolated nucleic acid molecule" as used herein refers to a synthetically produced nucleic acid molecule that exists outside its natural environment and is therefore not a natural product. Isolated nucleic acid molecules can exist in purified form or in non-natural environments, such as, but not limited to, recombinant microbial cells, plant cells, plant tissues, or plants.

[0085] The aforementioned elements are arranged sequentially and can be used in various combinations depending on the desired expression outcome. Other aspects of this disclosure include an isolated nucleic acid sequence or construct containing a promoter operatively linked to a coding region encoding, for example, a recombinant SCW108 protein. Such coding regions are typically operatively linked to a transcription termination region, thereby enabling the promoter to drive transcription of the coding region, thereby allowing cells to produce recombinant proteins in vivo.

[0086] In one embodiment, this disclosure provides isolated or recombinant polynucleotides encoding the insecticidal polypeptides disclosed herein, wherein said polynucleotides have codons optimized for expression in crops. In one aspect, the crop is sugarcane.

[0087] Recombinant polynucleotides can be used to construct expression vectors for subsequent transformation into target organisms, to develop probes for isolating other homologous (or partially homologous) genes, and to generate altered sugarcane weevil polypeptides by methods known in the art, such as site-directed mutagenesis, domain exchange, or DNA shuffling. In a specific embodiment, the polynucleotide sequence is SEQ ID NO: 1.

[0088] In some embodiments, the sugarcane weevil polypeptide comprises an amino acid sequence modified from the full-length nucleic acid sequence disclosed herein, as well as shorter amino acid sequences resulting from the use of alternative downstream start sites or from processing to produce a shorter protein with insecticidal activity. Processing may occur in the organism expressing the protein or in pests that have ingested the protein. Therefore, isolated or recombinant nucleic acid sequences conferring insecticidal activity are provided herein. The amino acid sequence of the sugarcane weevil polypeptide is also provided herein. Proteins translated from these genes enable cells to control or kill pests that ingest them.

[0089] Molecular biology and biotechnology methods

[0090] Any methods known in the art for modifying cellular DNA (e.g., genomic DNA and organelle DNA) and producing proteins can be used to practice what is disclosed herein.

[0091] The term "recombinant" or "modified nucleic acid" refers to a polynucleotide synthesized by artificially manipulating isolated polynucleotide segments through genetic engineering or chemical synthesis, combining two originally separate sequence segments. In this way, polynucleotide segments with desired functions can be linked together to produce the desired functional combination.

[0092] In some implementations, a non-integrative expression system can be used to induce the expression of one or more introduced genes. The expression system (expression vector) may include, for example, an origin of replication or autonomous replication sequence (ARS) and expression control sequences, promoters, enhancers, and necessary processing information sites, such as ribosome binding sites, RNA splicing sites, polyadenylation sites, transcription termination sequences, and mRNA stabilizing sequences. Where appropriate, it may also contain signal peptides of secretory polypeptides from the same or related species, which enable the protein to cross and / or remain in the cell membrane, cell wall, or be secreted from the cell.

[0093] The screening and molecular analysis of recombinant strains and / or plants or plant cells and materials disclosed herein can be performed using nucleic acid hybridization techniques. Hybridization procedures can be used to identify polynucleotides with sufficient homology to the useful subject regulatory sequences taught herein, such as those modified using the techniques described herein. Specific hybridization techniques are not essential to this invention. These techniques can be readily applied by those skilled in the art as hybridization techniques have been improved. Hybridization probes can be labeled with any suitable markers known to those skilled in the art. Hybridization and washing conditions (e.g., temperature and salt concentration) can be varied to alter the stringency of the detection threshold. For further guidance on hybridization conditions, see, for example, Sambrook et al. (1989) (see below) or Ausubel et al. (1995) Current Protocols in Molecular Biology, John Wiley & Sons, NY, NY).

[0094] Similarly, screening can be performed using peptide-based techniques, including enzyme-linked immunosorbent assay (ELISA), fluorescence detection (if fluorescent labeling is used), or Western blotting. Those skilled in the art will understand that any available peptide-based technique can be used for the screening aspects or implementations disclosed herein.

[0095] In addition, polymerase chain reaction (PCR) can be used for screening and molecular analysis of genetically modified strains and / or plants or plant cells and materials, as well as for creating desired isolated nucleic acids. PCR is a repetitive, enzymatic, primerized method for synthesizing nucleic acid sequences. This procedure is well known and commonly used by those skilled in the art (see Mullis, U.S. Patents 4,683,195, 4,683,202, and 4,800,159; Saiki et al. (1985) Science 230: 1350-1354). PCR is based on the enzymatic amplification of a target DNA fragment flanked by two oligonucleotide primers that hybridize to the opposite strand of the target sequence. The 3' ends of the primers face each other. Repeated cycles of template denaturation, primer annealing to their complementary sequences, and extension of the annealed primers in DNA polymerase result in the amplification of the segment defined by the 5' end of the PCR primer. Since the extension product of each primer can serve as a template for another primer, each cycle effectively doubles the amount of DNA template produced in the previous cycle. This leads to the exponential accumulation of specific target fragments, reaching millions of times within hours. This can be achieved by using thermostable DNA polymerases, such as those from thermophilic bacteria. Thermus aquaticus The Taq polymerase isolated from it allows for a fully automated amplification process. Other available enzymes are known to those skilled in the art.

[0096] The nucleic acids and proteins disclosed herein may also contain homologs of the specific disclosed sequences. Homology or genetic identity can be 80%–100%. In some cases, such homology or genetic identity is greater than 80%, 85%, 90%, or 95%. Those skilled in the art can readily determine the degree of homology or identity required for any intended use of the sequence. The percentage of sequence identity between the two nucleic acids used herein was determined using algorithms known in the art, such as those disclosed in Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264–2268, with modifications thereof found in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873–5877. This algorithm has been incorporated into the NBLAST and XBLAST procedures of Altschul et al. (1990) J. Mol. Biol. 215:402–410. Use the NBLAST procedure for BLAST nucleotide searching, score=100, word length=12, to obtain nucleotide sequences with the desired percentage of sequence identity. For vacancy alignments for comparison, use Gapped BLAST, as described in Altschul et al. (1997) Nucl. Acids. Res. 25:3389-3402. When using the BLAST and Gapped BLAST procedures, use the default parameters for the respective procedures (NBLAST and XBLAST). See www.ncbi.nih.gov.

[0097] Plant cells and all forms of plants are also preferred targets for coatings and other applications of the insecticidal compositions disclosed herein. Monocotyledonous plant cells can be used, particularly including sugarcane (e.g., species of the genus *Saccharum*). SaccharumCells can be derived from tissue types including embryos, callus, leaf discs, and other explants. The plant cells targeted by the insecticidal composition can be differentiated or undifferentiated (e.g., callus, undifferentiated callus, immature and mature embryos, immature zygotic embryos, immature cotyledons, hypocotyls, suspension culture cells, protoplasts, leaves, leaf cells, root cells, phloem cells, and pollen). Plant cells include, but are not limited to, cells derived from: seeds, suspension cultures, explants, immature embryos, embryos, zygotic embryos, somatic embryos, embryogenic callus, meristems, somatic meristems, organogenic callus, protoplasts, leaf bases, leaves from mature plants, leaf tips, immature inflorescences, cotyledons, immature cotyledons, hypocotyls, meristematic zones, callus, cells from leaves, cells from stems, cells from roots, cells from buds, gametophytes, sporophytes, pollen, and microspores. Plant cells also include various forms of cultured cells (e.g., single cells, protoplasts, embryos, and callus), wherein the protoplasts or cells are produced from plant parts selected from leaves, stems, anthers, pistils, roots, fruits, flowers, seeds, cotyledons, hypocotyls, embryos, or meristematic cells. In this document, recombinant host cells refer to cells that have been genetically modified to contain isolated or recombinant nucleic acid molecules, or contain one or more genes to produce at least one recombinant protein. Nucleic acids encoding the sugarcane weevil protein of this disclosure can be introduced by any method known in the art suitable for a particular cell type, including but not limited to transformation, liposome transfection, electroporation, or any other method known to those skilled in the art.

[0098] This invention provides a method for detecting any nucleotide or polypeptide from the aforementioned embodiments of genetically modified plant material, comprising the following steps: Obtain plant material samples for analysis; DNA was extracted from the sample; Provide primer pairs that contain at least forward and reverse primers; Amplify the region between primer pairs; and Detecting the presence of amplification products; or including the steps Obtain plant material samples for analysis; Extract DNA or RNA from the sample; Provide probes or combinations of probes designed to bind to polynucleotides comprising polynucleotides according to the foregoing embodiments; Hybridize the probe with the sample; and The actual hybridization of the detection probe.

[0099] Antibody

[0100] This invention also covers antibodies against the sugarcane weevil polypeptide or variants or fragments thereof of this embodiment. The antibodies disclosed herein include polyclonal antibodies and monoclonal antibodies, as well as antibody fragments that retain their ability to bind to the sugarcane weevil polypeptide. An antibody, monoclonal antibody, or fragment thereof is said to be able to bind to a molecule if it can specifically react with the molecule, thereby causing the molecule to bind to the antibody, monoclonal antibody, or fragment thereof.

[0101] This invention provides a kit for detecting the presence of sugarcane weevil peptides in a sample or for detecting the presence of a nucleotide sequence encoding sugarcane weevil peptides in a sample. In one embodiment, the kit provides antibody-based reagents for detecting the presence of sugarcane weevil peptides in a sample. In another embodiment, the kit provides labeled nucleic acid probes for detecting the presence of one or more polynucleotides encoding sugarcane weevil peptides. The kit is accompanied by appropriate reagents and controls for carrying out the detection method, as well as instructions for use.

[0102] This invention provides a kit for detecting one or more polynucleotides or peptides from genetically modified plant material according to the foregoing embodiments. In one embodiment, the kit comprises tools for detecting the presence of one or more polynucleotides from the foregoing embodiments and / or tools for detecting one or more peptides from the foregoing embodiments, wherein the tools comprise primer pairs designed for binding to the polynucleotide, or wherein the tools comprise primer pairs and probes designed for binding to the polynucleotide, and / or wherein the tools comprise antibodies for detecting one or more peptides from the foregoing embodiments.

[0103] Composition including sugarcane weevil protein and related nucleotides

[0104] Another aspect of this disclosure relates to an insecticidal composition comprising: (i) one or more polypeptides of any of the foregoing embodiments, wherein the concentration of the one or more polypeptides is sufficient to control at least one agricultural insect pest; (ii) one or more polynucleotides of any of the foregoing embodiments, wherein the polynucleotides have codons optimized for expression in agriculturally important crops; and / or (iii) one or more isolated constructs or expression cassettes of any of the foregoing embodiments. In some embodiments of this aspect, the one or more polypeptides comprise SEQ ID NO: 1. In some embodiments of this aspect, the one or more polynucleotides comprise SEQ ID NO: 4. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the at least one insect pest is a coleopteran pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), when the composition is applied to sugarcane plants or sugarcane plantations, the concentration of the one or more polypeptides is sufficient to control at least one agricultural insect pest in or on sugarcane plants. Some embodiments of this aspect (which may be combined with any of the foregoing embodiments) further include one or more inert ingredients, acceptable carriers, surfactants or adjuvants commonly used in the formulation field, or other components that facilitate product handling and application to specific target pests. Suitable carriers and adjuvants may be solid or liquid and correspond to substances commonly used in formulation technology, such as natural or recycled minerals, solvents, dispersants, wetting agents, thickeners, binders, or fertilizers. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition further includes one or more inert ingredients and / or acceptable carriers. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste (e.g., for coating or smearing), colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier (e.g., polymeric material). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as an orally acceptable, orally applicable, or orally ingestible feed for insect pests. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated for direct soil application and / or direct potting substrate application. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a controlled-release formulation.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), control of coleopteran pests includes: a) reducing pest infestation by 40%, 50%, 60%, 70%, 80%, 90%, or 100%; or b) increasing pest mortality by 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the coleopteran pests are selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil

[0105] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabaeidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil Such formulations can be prepared by conventional methods, such as drying, lyophilizing, homogenizing, extracting, filtering, centrifuging, sedimentation, or concentrating cell cultures containing the polypeptides.

[0106] The compositions disclosed herein comprise at least one SCW108 protein disclosed herein, or a mutant, recombinant, or otherwise modified version thereof. In some embodiments, the composition further comprises one or more other Bt proteins, such as Cry8 proteins or any other Cry protein. In some embodiments, the compositions disclosed herein also comprise additional active agents, such as chemical mixtures (e.g., insecticidal chemicals), insecticidal proteins (e.g., Bt proteins), or biocontrol agents (e.g., Bacillus thuringiensis). In some embodiments, the compositions disclosed herein also comprise agricultural-related agents (i.e., agrochemicals). In some embodiments, the compositions disclosed herein comprise one or more agrochemicals, including but not limited to herbicides, insecticides, fungicides, bactericides, nematicides, molluscicides, acaricides, plant growth regulators, harvesting aids, and fertilizers.

[0107] In one embodiment, the formulation of the bio-insecticide composition can be prepared by a variety of methods well known in the art, including but not limited to drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, or concentration. In any such orally acceptable, orally applicable, orally ingestible bait intended for consumption by target insect pests, the concentration of the protein disclosed herein should be at least about 0.001% to about 99% of the total weight of the composition. In one embodiment, the concentration of the protein disclosed herein should be about 1 part protein to 4 parts target insect pest bait.

[0108] The above composition can be obtained by adding surfactants, inert carriers, preservatives, humectants, feeding stimulants, attractants, encapsulating agents, adhesives, emulsifiers, dyes, UV protectants, buffers, flow aids or fertilizers, micronutrient donors or other formulations that affect plant growth. Suitable surfactants include, but are not limited to, anionic compounds, such as carboxylates, including metal carboxylates; carboxylates of long-chain fatty acids; N-acylsarcosine salts; monoesters or diesters of phosphates and fatty alcohol ethoxylates, or salts of such esters; fatty alcohol sulfates, such as sodium dodecyl sulfate, sodium octadecyl sulfate, or sodium cetyl sulfate; ethoxylated fatty alcohol sulfates; ethoxylated alkylphenol sulfates; lignin sulfonates; petroleum sulfonates; alkylaryl sulfonates, such as alkylbenzene sulfonates or lower alkylnaphtalene sulfonates, such as butylnaphtalene sulfonate; salts of sulfonated naphthalene-formaldehyde condensate; and sulfonated phenol-formaldehyde condensate. Salts of condensates; more complex sulfonates, such as amide sulfonates, such as the sulfonated condensation product of oleic acid and N-methyl taurine; or dialkylsulfosuccinates, such as sodium sulfonate of dioctyl succinate. Nonionic agents include condensation products of fatty acid esters, fatty alcohols, fatty acid amides or fatty alkyl or alkenyl substituted phenols with ethylene oxide, fatty acid esters of polyol ethers (e.g., sorbitol fatty acid esters), condensation products of such esters with ethylene oxide (e.g., polyoxyethylene sorbitol fatty acid esters), block copolymers of ethylene oxide and propylene oxide, alkynyl diols (e.g., 2,4,7,9-tetraethyl-5-decyn-4,7-diol), or ethoxylated alkynyl diols. Examples of cationic surfactants include, for example, aliphatic monoamines, diamines, or polyamines, such as acetates, naphthenic esters, or oleates; or oxyamines, such as amine oxides of polyoxyethylene alkylamines; amide-linked amines prepared by condensation of carboxylic acids with diamines or polyamines; or quaternary ammonium salts.

[0109] Examples of inert materials include, but are not limited to, inorganic minerals such as kaolin, layered silicates, carbonates, sulfates, phosphates, mica, amorphous silica, talc, clay, volcanic ash, or plant materials such as cork, corn cob powder, peanut shells, rice husks, and walnut shells. Kaolin, for example, includes kaolinite, dickite, pearl clay, silica-rich kaolinite, halloysite, and...

[0110] Hydrocarboxylate can be used as a carrier material. Montmorillonite, such as bedeite, chlorodiazepite, lithium montmorillonite, saponite, zinc montmorillonite, and bentonite, can be used as carrier materials. Vermiculite, such as biotite, can be used as a carrier material.

[0111] The composition of this embodiment may be in a suitable form for direct application or a concentrate of the main composition, which needs to be diluted with an appropriate amount of water or other diluent before application. The insecticide concentration will vary depending on the nature of the specific formulation, specifically whether it is a concentrate or for direct application. The composition contains 1% to 98% of a solid or liquid inert carrier and 0% to 50% or 0.1% to 50% of a surfactant. These compositions will be applied according to the label dosage of commercially available products, for example, approximately 0.01 to 5.0 pounds per acre in dry condition or approximately 0.01 to 10 pints per acre in liquid condition.

[0112] The compositions disclosed herein include cell or tissue extracts, suspensions, homogenates, lysates, supernatants, filtrates, and precipitates, wherein such cells or tissues express at least one... Sugarcane weevil Proteins, and / or also provide purified proteins derived from such cells and / or tissues.

[0113] sugarcane plants

[0114] The sugarcane plants disclosed herein include species and hybrids of the genus *Saccharum*, such as the tropical species (*Saccharum officinarum*), the Chinese species (*Saccharum sinense*), the Indian species (*Saccharum barberi*), the large-stemmed wild species (*Saccharum robustum*), the spontaneum species (*Saccharum spontaneum*), species of the genus *Saccharum*, and hybrids of the genus *Saccharum*. Cultivated sugarcane crops are typically hybrids of many sugarcane species that can be crossbred between varieties. Sugarcane is classified as a monocotyledonous plant and belongs to the same plant family (Poaceae) as other important crops (such as maize, rice, and wheat). As one of the world's major sources of sugar, sugarcane is a key crop for the economies of many subtropical and tropical countries that grow sugarcane, particularly Brazil. Furthermore, as a source of ethanol, sugarcane offers a potential environmentally valuable alternative to gasoline for certain fuel processes worldwide.

[0115] The prominent nodes of sugarcane are the most commercially valuable part of the plant, rich in sucrose between the nodes (i.e., the internodes of the stem). The internodes of the stem are rich in vascular tissue, and the vascular tissue of sugarcane contains abundant sucrose deposits.

[0116] Sugarcane propagation is carried out by cutting the top of mature sugarcane near the base, and then removing the stalks from the vegetation. Additionally, tissue-cultured seedlings derived from buds and cultivated in greenhouses can also be used for propagation. Harvesting of mature sugarcane can be done by hand (a labor-intensive process providing thousands of jobs) or by machine using heavy machinery. Sugar is extracted from the sugarcane stalks through a milling process and then supplied to the commercial market through a refining process.

[0117] In some aspects, this disclosure relates to treating seeds, plant parts, or plant tissues with recombinant proteins or compositions containing recombinant proteins according to any of the above embodiments. In some embodiments, the plant part is selected from leaves, stems, anthers, pistils, roots, fruits, flowers, seeds, cotyledons, hypocotyls, embryos, somatic embryos, or meristematic cells. Plant parts include differentiated and undifferentiated tissues, including but not limited to roots, stems, buds, leaves, pollen, and seeds.

[0118] In some aspects, this disclosure relates to a transgenic plant, plant part, propagule, seed, tissue, organ, embryo, or plant cell comprising a polypeptide of any of the foregoing embodiments, a polynucleotide of any of the foregoing embodiments, or an isolated construct or expression cassette of any of the foregoing embodiments. In some embodiments of this aspect, the one or more polypeptides comprise SEQ ID NO: 1. In some embodiments of this aspect, the one or more polynucleotides comprise SEQ ID NO: 4. In other aspects, this disclosure relates to a plant, plant part, propagule, seed, tissue, organ, embryo, or plant cell transformed (e.g., transient or stable transformation) with at least one polynucleotide encoding one of the insecticidal polypeptides.

[0119] As used herein, the term "plant" refers to any plant at any developmental stage, particularly seed plants. The term "plant cell" refers to the structural and physiological unit of a plant, comprising a protoplast and cell wall. Plant cells can be isolated single cells or cultured cells, or they can be part of higher-level tissue units such as plant tissues, plant organs, or the whole plant. The term "plant cell culture" refers to a culture of plant units such as protoplasts, cultured cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes, and embryos at various developmental stages. The term "plant material" refers to leaves, stems, roots, flowers or parts of flowers, fruits, pollen, egg cells, zygotes, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant. The term "plant organ" refers to a distinctive and clearly structured and differentiated part of a plant, such as a root, stem, leaf, bud, or embryo. The term "plant tissue" refers to a group of plant cells organized into structural and functional units. Any tissue of a plant, whether within the plant or in a culture state, is included. This term includes, but is not limited to, whole plant, plant organs, plant seeds, tissue cultures, and any group of cells organized into structural and / or functional units. The use of this term in conjunction with or alone with any particular type of plant tissue covered above or in this definition does not exclude any other type of plant tissue.

[0120] In some aspects, this disclosure relates to an insecticidal composition applied to protoplasts or cells of plants from any of the above embodiments. Plant cells can be differentiated or undifferentiated (e.g., callus, undifferentiated callus, immature and mature embryos, immature zygotic embryos, immature cotyledons, hypocotyls, suspension culture cells, protoplasts, leaves, leaf cells, root cells, phloem cells, and pollen). Plant cells include, but are not limited to, cells from: seeds, leaves, stems, roots or buds, suspension cultures, explants, immature embryos, embryos, zygotic embryos, somatic embryos, embryogenic callus, meristems, somatic meristems, organogenic callus, protoplasts, leaf bases, leaves from mature plants, leaf tips, immature inflorescences, cotyledons, immature cotyledons, hypocotyls, meristematic zones, callus, gametophytes, sporophytes, pollen, or microspores. Plant cells also include various forms of cultured cells (e.g., single cells, protoplasts, embryos, and callus tissues), wherein protoplasts or cells are derived from plant parts selected from leaves, stems, anthers, pistils, roots, fruits, flowers, seeds, cotyledons, hypocotyls, embryos, or meristematic cells. Besides sugarcane as described above, plant cells or tissues can also be derived from plants including, but not limited to, maize (e.g., corn), Zea mays ), barley (for example, Hordeum vulgareMillet (e.g., fingermillet, fonio millet, foxtail millet, pearl millet, barnyard millets, millet) Eleusine coracana ), fine-stemmed millet ( Panicum sumatrense ), millet ( Panicum milaceum ), Pennisetum glaucum, species of the genus Digitaria ( Digitaria spp.), species of the genus Barnyardgrass ( Echinocloa spp.), oats (e.g.) Avena sativa Rice (e.g., indica rice, japonica rice, aromatic rice, glutinous rice). Oryza sativa , glumed rice ( Oryza glaberrima ), rye (e.g., Secale cereale , Secale cereanum ), foxtail grass (for example, Setaria italica , Setaria viridis ), species of the genus *Brucea* ( Brachypodium sp.), sorghum (e.g., Sorghum bicolor ), teff (e.g., Eragrostis TEF ), triticale (e.g., X Triticosecale Wittmack, Triticosecale schlanstedtense Wittm. Triticosecale neoblaringhemii A. Camus, Triticosecale neoblaringhemii A. Camus), wheat (e.g., common wheat, spelt, durum, einkorn, emmer, kamut). Triticum aestivum , Triticum spelta , Triticum durum , Triticum urartu , Triticum monococcum , Triticum turanicum Species of the genus *Wheat* ( Triticum spp.), switchgrass (e.g., Panicum virgatum ), species of the genus Brassica ( Brassica sp.), tobacco (e.g., Nicotiana benthamiana , Nicotiana tabacum ),peanut( Arachis hypogaea ), banana (Musa species) Musa sp.)), potato ( Solanum tuberosum),strawberry( Fragaria ananassa ),coffee( Coffea arabica ), cotton (upland cotton) Gossypium hirsutum )),tomato( Solanum lycopersicum (or any other polyploid and / or asexually reproduced plant species.)

[0121] Plant expression

[0122] There are various plant gene transformation technologies, mainly divided into two categories: indirect gene transfer and direct gene transfer. Indirect transfer refers to the insertion of exogenous DNA into the genome through the action of biological vectors, while direct transfer is based on physical and biochemical processes.

[0123] Depending on the genetic transformation technique and the species or genotype to be transformed, different tissues and / or cells may be used. Typically, these tissues or cells include, but are not limited to, embryogenic callus, callus tissue, protoplasts, embryos, somatic embryos, meristems, and any other plant parts, tissues, or cells with regenerative capacity.

[0124] Indirect transformation based on Agrobacterium spp. ( Agrobacterium The bacterial-mediated transformation system (AMPS) is the most widely used method for obtaining transgenic plants. Advantages of this method include the ability to transfer relatively long DNA segments without rearrangement, while maintaining low copy number integration of the transgene, thus ensuring higher genotypic stability of the resulting events. Currently, various Agrobacterium species and strains, plasmids, and protocols have been developed and improved for genetic transformation of multiple plant species. The advantages of these methods include: a higher probability of single-copy events, stable integration, genetically inherited introduced traits, consistent gene expression across generations, and low gene silencing rates.

[0125] Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) and Agrobacterium rhizogenes ( A. Rhizogenes is Gram-negative soil plant pathogens belonging to the Rhizobium family can cause diseases in dicotyledonous plants, namely crown gall. (crown) Agrobacterium is a Gram-negative soil plant pathogen belonging to the Rhizobium family. It can cause diseases in dicotyledonous plants, namely crown gall and hairy root gall. In this plant-pathogen interaction, Agrobacterium (…) AgrobacteriumThere is a natural gene transfer process between bacteria and plant cells, in which a fragment of bacterial DNA (T-DNA) is transferred into the plant cell and integrated into the nuclear genome. Under natural conditions, bacteria transfer T-DNA (“transferred DNA”), which is part of the bacterial plasmid Ti (“tumor-inducing”), and integrates it into the genome of the infected plant cell. The T-DNA fragment transferred to the plant cell contains genes involved in the constitutive biosynthesis of plant hormones (auxins and cytokinins), which alter the normal developmental program of the infected tissue and lead to tumor formation. It also contains oncogenes for synthesizing sugars and amino acids (called opines), which are the carbon and nitrogen sources for bacteria (Oger et al., 1997). T-DNA is defined by 25-base-pair (bp) repeats at its left and right boundaries and is crucial for its transfer. Phenolic compounds released from damaged plant tissue activate specific regions (vir regions), initiating the transfer of T-DNA into the plant cell. Agrobacterium also possesses a chromosome (chv) gene that promotes the binding between bacteria and host cells, thereby forming channels containing T-DNA complexes (Sheng & Citovsky. 1996).

[0126] Because the fragment to be transferred is defined by its boundaries, any sequence flanked by those boundaries can be transferred into plants by Agrobacterium, allowing manipulation of these sequences to transfer the target coding sequence. Replacing or deleting the coding region of wild-type T-DNA (oncogene) produces non-oncogenetic (disarmed) Agrobacterium strains that can carry the target sequence. The modified T-DNA is able to transfer the target sequence into plants because the virulence gene (vir region) remains intact.

[0127] Furthermore, the Agrobacterium indirect transformation system allows for the transfer of artificial plasmid constructs into plants, provided the construct contains such a T-DNA boundary, and allows for the flexible use of molecular tools and materials developed for other bacterial strains.

[0128] These artificial plasmid constructs have promoters from different sources, such as plant promoters, viral promoters, bacterial and / or chimeric promoters, as well as genes that confer antibiotic resistance, herbicide resistance or tolerance or enzyme activity (phosphog-mannose isomerase (PMI) / mannose (Man)). Therefore, these markers can be used to select transformed cells or plants.

[0129] These constructs can also contain helper genes that interfere with related morphogenesis signaling pathways, thereby enhancing the efficiency of genetic transformation and plant tissue regeneration. Examples include, but are not limited to, LEAFY COTYLEDON1 (Lotan et al., 1998), Lec1 (Lowe et al., 2002), LEAFY COTYLEDON2 (Stone et al., 2001), WUSCHEL (WUS; Zuo et al., 2002), and e BABY BOOM (BBM; Boulirier et al., 2002).

[0130] In a first aspect of the invention, foreign or exogenous DNA to be introduced into a plant is cloned into a binary plasmid located between shared sequences (T-DNA) on its left and right boundaries. This binary plasmid is transferred into Agrobacterium cells and subsequently used to infect plant tissues. The vector containing the T-DNA region of the exogenous DNA is inserted into the plant genome. Marker gene expression cassettes and characteristic gene expression cassettes may be located in the same region of the T-DNA, in different T-DNA regions of the same plasmid, or in different T-DNA regions of different plasmids. In one embodiment of the invention, these expression cassettes are located in the same region as the T-DNA. Methods of indirect transformation via Agrobacterium are well known to those skilled in the art.

[0131] Alternatively, direct DNA transfer can be used to introduce DNA directly into plant cells. One method of direct DNA transfer is to bombard plant cells with a vector containing the DNA to be inserted using a particle gun (particle-mediated gene gun transformation). Other plant cell transformation methods include protoplast transformation (optionally in the presence of polyethylene glycol); sonication of plant tissues, cells, or protoplasts in a medium containing polynucleotides or vectors; microinjection of polynucleotides or vectors into plant material; microinjection, vacuum permeation, sonication, chemical transformation using silicon carbide, chemical transformation using PEG, and plant cell electroporation. Disadvantages of direct transformation include challenges associated with plant tissue regeneration and low transgene expression.

[0132] Furthermore, gene transformation can be achieved through direct insertion at specific sites via nuclease-mediated homologous recombination (genome editing). In recent years, genome editing technologies based on engineered or chimeric nucleases have made it possible to generate genetically modified organisms in a more precise and specific manner. The introduction of exogenous or foreign genes is achieved through homologous recombination, i.e., the introduction of a homologous recombination template (HR) containing exogenous DNA linked to a DNA fragment homologous to the recipient organism's genome. Available tools include the chimeric enzyme system CRISPR (clustered, regularly spaced, short palindromic repeats)-Cas, zinc finger (ZFN) nucleases, and TAL effector nucleases (TALENs). The Crispr-Cas system is an enzymatic system containing two main components: an endonuclease (Cas) and a guide RNA (single guide RNA - sgRNA; a guide to a specific cleavage site of the Cas endonuclease). The guide RNA may also contain two components: Crispr RNA (crRNA) - a 17-20 base sequence complementary to a specific DNA genomic sequence, and optional tracrRNA. The specific cleavage performed by the endonuclease and the guidance of sgRNA will be repaired through homologous recombination, specifically, the insertion of exogenous DNA side-joined by a homologous sequence into the cleavage site. This enzymatic system can be introduced into cells in various ways, using plasmids, through direct or indirect transformation, or using vectors such as proteins and other chemical reagents. Expression of the system components can occur transiently or stably, utilizing the cellular mechanisms of the recipient organism, or in vitro, delivering all ready-to-use components (endonuclease + sgRNA, transcribed and combined in vitro prior to cellular delivery) to the target cells or tissues. The contents described herein are not exhaustive and should not limit the use of different variants, systems, and methods of genome editing within the scope of this invention, including variants, systems, and methods known in the art and those not yet discovered.

[0133] After transformation, the transgenic plants regenerate from the transformed plant tissues, and offspring with exogenous DNA can be screened using suitable markers (e.g., kanamycin, genimycin, or glufosinate resistance). Those skilled in the art are familiar with the composition of suitable regeneration media.

[0134] Alternatively, other selection methods can be applied without inserting any genetic markers into the host genome (recipient organism) as previously described.

[0135] Promoters suitable for plant expression can be isolated from plants or other organisms. Various promoters have been isolated or developed, including constitutive promoters, "on and off" promoters, and promoters that respond to tissue-specific abiotic stresses. Many of these promoters have intron sequences associated with proper gene expression. In a preferred aspect of the invention, the promoter is a constitutive promoter, selected from the non-limiting group consisting of: CaMV 35s, CoYMV (Commelina yellow mottle virus), FMV 35s, ubiquitin, actin rice promoter (Act-1), Act-2, nopaline synthase promoter (NOS), octopine synthase promoter (OCS), zeatol dehydrogenase promoter (Adh-1), PvUbi1, SCBV, etc.

[0136] Additional elements such as introns, enhancer sequences, and transport proteins can be integrated into the expression cassette to enhance gene expression levels. Examples include transcriptional or translational enhancers such as the CaMV 35s enhancer, FMV 35s, Nos, supP, untranslated leader sequences from wheat major chlorophyll a / b binding polypeptide (L-Cab), and the kosak sequence 5' upstream of the translation initiation site.

[0137] Termination sequences were also considered on the expression cassette. Examples of suitable, functional plant polyadenylation signals include those from Agrobacterium tumefaciens carmine synthase (nos), protease inhibitor II gene rbcS (small subunit of pea ribulose-1,5-bisphosphate carboxylase), Lhcb1 (tobacco chlorophyll a / b binding protein), CaMV 35s, octopus carmine synthase, α-tubulin genes, etc.

[0138] According to the present invention, polynucleotides encoding proteins may have optimized (or otherwise altered) codons to improve their expression in plant material. Such codon optimization can be used to alter the predicted secondary structure of RNA transcripts produced in any transformed cells, or to disrupt hidden RNA instability elements present in unaltered transcripts, thereby enhancing the stability and / or availability of transcripts in transformed cells.

[0139] Several marker genes for plant event selection have been identified, some of which confer antibiotic resistance and others herbicide resistance. Examples of marker genes that can be used selectively in this invention include genes that confer resistance or tolerance to hygromycin, kanamycin, gentamicin, genimycin, glyphosate, and glufosinate, or genes that confer resistance to toxins such as eutypine. Other forms of selection may also be used, such as hormone-based selection systems, visual selection by expressing fluorescent proteins, mannose isomerases, xylose isomerases, etc. In one embodiment of the invention, the event selection marker gene is a gene that confers resistance to kanamycin and genimycin.

[0140] Use selectable marker genes, for example nptII Genes are crucial for selecting transformed cells during gene modification (HORSCH et al., 1985). Therefore, the insertion of genes into the events described in this invention... nptII The purpose of gene selection is to select cells that have been transformed with target genes.

[0141] Suitable methods for detecting plant material derived from genetically modified plants (events) based on antibody binding include (but are not limited to): Western blotting, enzyme-linked immunosorbent assay (ELISA), and mass spectrometry (e.g., surface-enhanced laser desorption / ionization (SELDI)). These immunological techniques are familiar to those skilled in the art. Typical steps involve incubating the sample with an antibody bound to a protein, washing to remove unbound antibodies, and detecting whether the antibody has bound. Many such detection methods are based on enzymatic reactions: for example, antibodies can be conjugated to enzymes such as peroxidase, and a color change can be detected upon application of a suitable substrate. Such antibodies can be monoclonal or polyclonal.

[0142] Methods for detecting plant material in an event include, but are not limited to, biofeeding assays, in which the leaves or other suitable parts of the plant in the event, or any plant material derived from the event, are infested by one or more insect pests. Measurements of the assay may include assessing leaf or plant damage after a time adjustment period, assessing mortality, or assessing other insecticidal effects. Such bioassays can be performed in the field or in a greenhouse and may involve natural or artificial insect infestations.

[0143] In another embodiment of the invention, the kit may include antibody binding detection techniques, such as Western blotting, ELISA, SELDI, or test strips. In another embodiment of the invention, the kit may include techniques for detection by biological insect detection (e.g., leaf-feeding bioassay or biomortality assay). In another embodiment of the invention, the kit may include any combination of the above detection techniques.

[0144] The invention has been generally described, and will be better understood by referring to certain specific embodiments, which are included herein to further illustrate the disclosure and are not intended to limit the scope of the invention as defined by the claims.

[0145] The following words and phrases have the following meanings.

[0146] As used in this article, “associated nucleic acids” or “operably linked nucleic acids” refers to at least two nucleic acids that are physically or functionally related. For example, if a promoter or regulatory DNA sequence is operably linked to a DNA sequence encoding RNA or protein, or is located at a position where the regulatory DNA sequence can affect the expression level of the coding or structural DNA sequence, then the two sequences are said to be “associated.”

[0147] As used herein, the term "biological insecticidal composition" refers to a substance, compound, or mixture that exhibits insecticidal activity against insects and comprises at least one aspect of biological origin. Many embodiments of this disclosure are derived from bacteria and / or plants.

[0148] As used in this article, "insect control / insect population control" refers to the suppression of the survival, growth, feeding, and / or reproductive capacity of insect pests through toxic effects, or the limitation of insect-related damage or loss to crops. "Insect control" may or may not refer to killing insects.

[0149] As used herein, “delivery” means contacting a composition (in the most preferred embodiment herein, an insecticidal protein) with insects to produce a toxic effect and control the insects. Insectic proteins can be delivered in a variety of known ways, such as through transgenic plants expressing insecticidal proteins, formulated protein compositions, sprayable protein compositions, bait substrates, or any other toxin delivery system recognized in the art.

[0150] The terms “identity” and “percentage of identity” used herein refer to the degree of similarity between two nucleic acid or protein sequences. For sequence comparison, one sequence is typically used as a reference sequence and compared with the test sequence. When using a sequence comparison algorithm, the test and reference sequences are input into a computer, subsequence coordinates are specified as needed, and sequence algorithm program parameters are specified. The sequence comparison algorithm then calculates the percentage of sequence identity of the test sequence relative to the reference sequence based on the specified program parameters. In the context of two nucleic acid or two amino acid sequences, the phrase “substantially identical” means that two or more sequences or subsequences have at least about 50% nucleotide or amino acid residue identity when compared and aligned to obtain maximum correspondence. This identity can be measured by one of the following sequence comparison algorithms or by visual inspection. In some embodiments, substantially identical sequences have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or even at least about 90% or 95% nucleotide or amino acid residue identity. In some embodiments, substantially identical sequences exist within a sequence region of at least about 50 residues, or within a sequence region of at least about 100 residues, or within a sequence region of at least about 150 residues. In further embodiments, sequences are said to be substantially identical when they are identical over the entire coding region.

[0151] The term "insecticide" as used in this article refers to the descriptive term for insecticidal activity against insects.

[0152] As used herein, the term "isolated toxin" refers to a synthetically produced toxin that exists outside its natural environment and is therefore not a natural product. Isolated toxins can exist in purified form or in non-natural environments, such as, but not limited to, recombinant microbial cells, plant cells, plant tissues, or plants.

[0153] The term “promoter” as used in this article refers to a recognition site on a DNA sequence or set of DNA sequences that provides an expression control element for a structural gene, and to which RNA polymerase specifically binds and initiates RNA synthesis (transcription) of that gene.

[0154] As used herein, the term "protein" refers to an organic compound consisting of one or more chains of amino acids. These amino acids can be natural, non-natural, or a combination of natural and non-natural amino acids. The terms "protein," "peptide," and "polypeptide" are used interchangeably herein.

[0155] As used herein, the term "recombination" refers to any modification, alteration, or manipulation of a polynucleotide or protein. The terms "recombination" and "genetic modification" are used interchangeably to refer to any modification, alteration, or manipulation of a polynucleotide or protein in its native form or structure, or in its native environment or context. Modifications, alterations, or manipulations of polynucleotides or proteins may include, but are not limited to, the following examples (including, but not limited to): deletion of one or more nucleotides or amino acids; preparation of a fusion protein from two heterologous polypeptide components; whole-gene deletion; codon optimization; conserved amino acid substitution; or insertion of one or more heterologous polynucleotides.

[0156] As used herein, the term "susceptible insect larvae" refers to insect larvae whose growth is inhibited after oral ingestion of a sample of feed containing one or more proteins of the present disclosure, said feed being artificially produced or obtained from plant tissues artificially coated with or expressing one or more proteins of the present disclosure derived from recombinant genes, as measured by: failure to gain weight, suppression of molting cycle frequency, observed lethargy, reduced fecal production, or death compared to: 1) larvae that do not exhibit any of these signs when fed the same feed provided to susceptible larvae, or 2) larvae fed a control feed that does not contain one or more proteins of the present disclosure.

[0157] As used in this article, the term "transformation" refers to the process of introducing a foreign DNA sequence (e.g., a vector, recombinant DNA molecule) into a cell or protoplast, enabling the foreign DNA to integrate into the chromosome or to replicate autonomously. Transformation includes stable or transient transformation of the foreign DNA sequence.

[0158] As used in this article, “transformed cell” refers to a cell whose genetic composition (chromosomal DNA or other naturally occurring intracellular DNA) is altered by introducing exogenous DNA molecules into the cell.

[0159] As used in this article, the term "treatment" refers to the application of a composition to achieve insecticidal activity against target insect pests. Insecticide treatments are typically applied to plants or planted areas to control insect pests.

[0160] As used herein, the term "vector" refers to a DNA molecule capable of replicating in a host cell, and / or a DNA molecule to which another DNA sequence can be operatively linked, thereby enabling the replication of the linked sequence. A plasmid is an exemplary vector.

[0161] Nucleotides are represented by their bases using the following standard abbreviations: adenine (A), cytosine (C), thymine (T), and guanine (G). Amino acids are also represented by the following standard abbreviations: alanine (A), arginine (R), asparagine (N), aspartic acid (D), cysteine ​​(C), glutamine (Q), glutamic acid (E), glycine (G), histidine (H), isoleucine (I), leucine (L), lysine (K), methionine (M), phenylalanine (F), proline (P), serine (S), threonine (T), tryptophan (W), tyrosine (Y), and valine (V).

[0162] The standard recombinant DNA and molecular cloning techniques used in this paper are well known in the art, and for a more detailed description, see Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989). The transformation methods are well known to those skilled in the art and are detailed below.

[0163] Example

[0164] Example 1. Design of chimeric Cry proteins for bioassay

[0165] This embodiment describes the selection process of candidate Cry proteins and their domains, which will be incorporated into the design of novel Cry10 / Cry1 chimeric proteins (such as SCW108), as well as the production process of chimeric proteins for bioassays.

[0166] Identification of candidate Cry proteins

[0167] To identify potential candidate Cry proteins, we conducted a literature review outlining Bt proteins reported to possess insecticidal activity against insect pests, particularly Coleoptera species. Cry10Aa, a known Cry toxin within the Cry10 group of Bt proteins (see, e.g., Carozzi et al., 2007 US20070240239A1), was identified as a potential candidate. However, previous studies have not clearly demonstrated that Cry10Aa protein or chimeric proteins containing a portion of Cry10Aa protein exert anti-Cleoptera pest activity (e.g., sugarcane weevil), nor are there direct data to prove that Cry10Aa protein possesses anti-sugarcane weevil activity.

[0168] Mittendorf et al. (2018, EP3313867) disclosed the “eCry3.1Ab” protein, a chimeric protein with an active domain targeting coleopteran pests and a C-terminal portion of Cry1Ab. Therefore, Cry1Ab (especially its III domain) was selected as a candidate sequence donor to be included in the chimeric Cry protein.

[0169] However, Mittendorf et al. did not propose constructing a chimeric protein using Cry10Aa, nor did they demonstrate any activity against the sugarcane weevil. Furthermore, Hart et al. (2016, US20160304569A1) showed that a chimeric protein between Cry10Aa and Cry1A is unlikely to be effective against Coleoptera pests. Although previous studies have not definitively demonstrated that the Cry10Aa protein or chimeric proteins containing a portion of Cry10Aa protein specifically exert anti-sugarcane weevil activity, previous research has shown that Cry10Aa is active against other Coleoptera pests (e.g., see Espinoza et al., (2010) WO2010043928A1; Ribeiro et al., (2017), Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil, PlantBiotechnol J, 15: 997-1009. https: / / doi.org / 10.1111 / pbi.12694). Therefore, despite previous studies indicating contraindications to its use in combination with Cry1A protein, this study still chose to include Cry10Aa protein in the chimera.

[0170] Synthesis and Cloning of Candidate Cry Proteins

[0171] The coding sequence of SCW108 (SEQ ID NO: 4) was designed such that its encoded protein sequence (SEQ ID NO: 1) contains domains I and II of the SCW18 sequence (SEQ ID NO: 2) at its N-terminus and domain III of the SCW400 sequence (SEQ ID NO: 3) at its C-terminus. The coding sequences of SEQ ID NO: 4, as well as the controls SCW6 and SCW18, were synthesized and cloned into the pD424-CH *E. coli* expression vector. This vector was induced by IPTG and produced a recombinant protein fused with a C-terminal histidine (His-6) tag.

[0172] Small-scale expression screening

[0173] These vector constructs were then transformed into *E. coli* BL-21(DE3) expression strains. Small-scale expression screening was subsequently performed using 4 mL of induction medium from all 31 clones, followed by cell lysis and small-scale immobilized metal affinity chromatography (IMAC). Proteins were eluted from the IMAC resin with imidazole-containing buffer, and the presence of soluble protein expression was detected by SDS-PAGE. SCW108, SCW6, and SCW18 proteins were detected by SDS-PAGE and were therefore considered positive clones.

[0174] amplify expression

[0175] Expression of SCW108, SCW6, and SCW18 was subsequently scaled up in 4 L of autoinduction medium (FWStudier, Protein Expr. Purif. , 41, 207–234. 2005). After induction at 20°C for 48 hours, cells were harvested and lysed using lysis buffer containing lysozyme. Freeze-thaw and sonication were then performed. The lysates were then centrifuged, and the supernatant was purified by IMAC using an Akta Pure® FPLC system (GE Healthcare). The purified eluted sample was dialyzed against buffer A (TrisCl 50 mM, NaCl 300 mM, glycerol 10%) and quantified by BCA assay. Protein purity was then assessed by SDS-PAGE density assay. The final protein sample was concentrated to 500 μg / mL for further processing. Sugarcane weevil Further testing is required in bioassays.

[0176] result

[0177] Following expression, all three proteins showed soluble positive results. These positive clones were then scaled up for bioassay analysis.

[0178] Example 2. Bioassay using chimeric Cry proteins

[0179] This embodiment describes a method for testing the efficacy of the chimeric SCW108 protein designed and produced using the method of Example 1. More specifically, this embodiment describes the oral delivery of the soluble chimeric Cry protein to… Sugarcane weevil ( Sphenophorus levis , S. Levis The method for detecting sugarcane weevils. Compared with the control chimeric protein SCW6 and the non-chimeric protein SCW18, SCW108 caused stunted growth or significantly increased mortality in sugarcane weevils.

[0180] Materials and methods

[0181] Sugarcane weevil breeding

[0182] Bioassays require the use of Sugarcane weevil (S. levis) The newborn larvae. However, due to the low survival rate of eggs and larvae, rearing... Sugarcane weevil It is quite challenging. S. Levis The larval stage lasts 26 to 50 days with a survival rate of only 35.8%, while the pupal stage lasts 5 to 13 days with a survival rate as high as 93% (Degaspari, N. et al., Biologia de Sphenopherus levisVaurie, 1978 (Col.: Curculionidade), em dieta artificial e no campo. Pesquisa Agropecuária Brasileira, Brasília, DF, v. 22, n. 3, p. 553-558, 1987). This results in slow insect population growth, requiring continuous collection of adults from the field to replenish the population available for testing. Sugarcane weevil There is a seasonal cycle, so a large number of adult insects can only be collected between October and March. At the beginning of the bioassay screening phase, about 25 larvae / day are available for collection, but the number of larvae available for bioassay increases in late September and October.

[0183] Bioassay

[0184] The purified Cry protein (selected in Example 1) was added at a concentration of 500 μg / mL to... Sugarcane weevil In the artificial feed, at 45℃ (maximum), the ratio of protein solution to feed was 1 part protein solution to 4 parts feed, yielding 100 μg Bt protein / mL feed. After incorporation, the feed was evenly distributed into a 96-well detection plate (300 μL feed per well), and one newborn was infected per well. Sugarcane weevil The larvae are incubated at 25°C for 7 days.

[0185] The Cry protein concentration (100 μg / mL feed) used in the bioassay was selected based on the LC50 values ​​of Coleoptera-specific Bt proteins in the literature, ranging from 0.1 to 5.1 μg / mL (GR Oliveira et al.). BMC Biotechnol. 11, 85. 2011; M. Ekobu et al. J. Econ. Entomol. 103, 1493–1502. 2010; IO Oyediran et al. Insect Sci 23, 913–917 (2016). The toxic protein is expected to cause... Sugarcane weevil The larval mortality rate exceeded 50%. Therefore, a feed protein concentration of 100 μg / mL ensured that the Cry protein would not cause death in the sugarcane weevil. Sugarcane weevil Non-toxic.

[0186] Toxicity screening program

[0187] The screening protocol consisted of bioassays using the same concentration of protein (100 μg / mL feed). After 7 days of incubation, the mortality percentage was calculated, taking into account both dead larvae and the actual mortality rate (larvae with low activity after brush contact). The LC50 for each purified recombinant Cry protein was also calculated. As mentioned above, sugarcane weevil larvae have low survival rates; therefore, the mortality rate for the screening bioassay controls was consistently 30–40%. Here, the higher mortality rate is due to the higher toxicity of the Cry protein.

[0188] result

[0189] The results of the chimeric Cry protein toxicity screening are shown in Table 1, and in Figure 1 A summary was provided.

[0190] Table 1: Bioassay results for sugarcane weevil

[0191] Figure 1 In this context, the relative mortality rate is reported as the percentage of mortality that is higher than the expected mortality rate of the control group, which is the percentage of the negative control mortality rate minus the average actual mortality rate. This corresponds to the “corrected” mortality rate shown in the rightmost column of Table 1. Figure 1 The results showed that SCW108 (SEQ ID NO: 1) exhibited a higher mortality rate compared to both SCW6 (also known as e-Cry3.1Ab) and SCW18 (also known as Cry10Aa1; SEQ ID NO: 2).

[0192] These surprising results indicate that the SCW108 protein is highly toxic to the sugarcane weevil. These results are surprising because they contradict the predictions of Hart et al. (2016, US20160304569A1): SCW108 is a chimeric protein between fragments of Cry10Aa and Cry1A proteins; it not only failed to eliminate the toxicity of Cry10Aa to coleopteran pests (sugarcane weevil in this case), but also showed a significantly higher killing effect of SCW108 on the sugarcane weevil than Cry10Aa alone. Figure 1 (Table 1).

[0193] Example 3. Bioassay of SCW108 protein variant

[0194] This embodiment describes a method for testing the efficacy of the SCW108 variant. More specifically, this embodiment describes a method for orally delivering soluble and / or variant SCW108 protein to the sugarcane weevil (SCW). Compared to both SCW6 (also known as e-Cry3.1Ab) and SCW18 (also known as Cry10Aa1; SEQ ID NO: 2), the SCW108 variant is expected to cause significantly higher growth retardation or mortality in the sugarcane weevil.

[0195] Synthesis and Cloning of Candidate Cry Proteins

[0196] Variants of the SCW108 chimeric protein described in the above embodiments were constructed, including variants containing one or more of the following modifications, alone or in any combination: point mutations, domain exchanges, truncation, and other variations in amino acid sequence and / or protein structure. The synthesis and cloning of these variants were performed according to the methods described in Example 1.

[0197] Express

[0198] The variants were expressed in small-scale and large-scale expression screenings, as described in Example 1. The variants are expected to exhibit soluble positive results. Positive clones will then be scaled up for bioassay analysis.

[0199] Sugarcane weevil breeding

[0200] As described in Example 2, raising Sugarcane weevil Used for biological assays.

[0201] Bioassay

[0202] Bioassays were performed on the SCW108 variant as described in Example 2.

[0203] Toxicity screening program

[0204] The screening scheme was carried out as described in Example 2.

[0205] result

[0206] The analysis and presentation of bioassay results are as described in Example 2. Compared to the SCW108 protein tested in Example 2, the SCW108 variant is expected to... Sugarcane weevil It has roughly equal or higher toxicity, and compared to SCW6 / e-Cry3.1Ab and SCW18 / Cry10Aa1, in Sugarcane weevil This results in a significantly higher rate of developmental delay or mortality.

[0207] Example 4. In vivo expression and efficacy of SCW108 in plants

[0208] This embodiment describes the use of SCW108 in plants to control [a disease / problem] in sugarcane. Sugarcane weevil The method. Specifically, this embodiment describes a method for expressing SCW108 The generation of constructs, the transformation of constructs into sugarcane, and sugarcane SCW108 Assessment of protein presence, determination of the number of inserted transgene copies, and bioassay of the inserted transgene.

[0209] Materials and methods

[0210] Developing constructs using SCW108 and nptII genes

[0211] Constructs for expressing embodiments of this disclosure are developed using conventional gene cloning techniques, including commercial bacterial plasmids, restriction enzyme digestion, and fragment ligation (using ligases).

[0212] The construct disclosed in this invention is constructed by... SCW108 and nptII The construct is formed by cassette ligation. The T-DNA containing two cassettes is transferred from the cloning plasmid to the base plasmid (a binary plasmid vector whose host bacterial spectrum includes Escherichia coli and Agrobacterium tumefaciens) using restriction endonucleases, thereby generating the construct.

[0213] After completing the final cloning step, the construct was inserted into a suitable *E. coli* strain using heat shock technology. The isolated colonies containing the construct were inoculated into LB liquid medium supplemented with 150 µg / mL spectinomycin and cultured at 37°C with shaking at 250 rpm for 16 hours. Then, a stock solution containing bacterial suspension and 10% (v / v) glycerol was prepared and stored in an ultra-low temperature freezer at -80°C.

[0214] The construct of this invention was transferred from *Escherichia coli* to a suitable *Agrobacterium tumefaciens* strain by isolating and purifying plasmid DNA and transforming it into *Agrobacterium* using electroporation. Similar to the *E. coli* strain, the stock solution containing the *Agrobacterium* suspension and 10% (v / v) glycerol was stored in an ultra-low temperature freezer at -80°C.

[0215] Agrobacterium-mediated plant transformation

[0216] To obtain embryogenic callus, sugarcane leaf rolls grown in the field or greenhouse for up to 12 months were collected to isolate the initial explants.

[0217] After surface sterilization, under aseptic conditions, cross sections approximately 0.05–5 mm thick were cut from above the meristem. The sections were placed on the surface of callus induction medium [MS – Murashige and Skoog, from Murashige and Skoog (1962) A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Plant Physiology, 15, 473–497; sucrose, vitamin B5, amino acids selected from proline, casein hydrolysate, citric acid, mannitol, copper sulfate, glycine, gelling agent, 2,4D]. The cultures were kept in the dark at 26 ± 2°C and passaged every 15 days for 3 to 5 cycles, each cycle lasting 7–28 days. One week before transformation, callus tissue with characteristics favorable to embryogenesis was selected again: nodular, compact, opaque, and slightly yellowish.

[0218] The Agrobacterium culture, comprising a suitable strain transformed by the construct of this invention, was cultured in glycerol stock solution as the starting medium for 2-3 days in the dark at 28°C. The culture was then resuspended in MS liquid medium supplemented with acetylsyleugenone to prepare an Agrobacterium suspension, and the final OD was adjusted. 600 It is prepared at a concentration of 0.1-1.0 (MS salt, sucrose, and vitamin B5) for infection of callus tissue.

[0219] Callus tissue with embryogenesis characteristics was visually selected and directly transferred to Agrobacterium suspension, and stirred at a constant speed of 50 rpm for 30 minutes in the dark.

[0220] Subsequently, callus tissue was isolated from the Agrobacterium suspension and excess suspension was removed. The callus tissue was then placed in a semi-solid culture medium (MS salt, sucrose, vitamin B5, citric acid, gelling agent, 2,4-D and acetylsuccinone) and cultured at 22°C in the dark for 1–5 days.

[0221] After co-culturing, the callus tissue was transferred to DT resting medium (MS salt; sucrose, vitamin B5, amino acids selected from proline and asparagine, casein hydrolysate, citric acid, copper sulfate, glycine, gelling agent, 2,4D, timentin) and stored in the dark at 26°C for 5–14 days.

[0222] Transformed cells were screened by continuous subculturing in a selective medium containing phytoregulators and the selector genistein. The selective medium containing genistein included MS salts, sucrose, vitamin B5, amino acids selected from proline and asparagine, casein hydrolysate, copper sulfate, glycine, a gelling agent, 2,4D, and termetin. Callus was kept in the dark at 26°C for 21 days, then transferred to regeneration medium (equivalent to the selective medium without 2,4D), followed by elongation medium (containing MS salts, sucrose, vitamin B5, casein hydrolysate, a gelling agent, and termetin). The callus was exposed to a 16-hour photoperiod at 4,000 lux in the presence of the selector for proliferation, rooting, and acclimatization, before being transferred to a greenhouse. This process was used to generate clones expressing the target protein.

[0223] Enzyme-linked immunosorbent assay (ELISA)

[0224] In order to pass the ELISA assessment SCW108 Gene expression was studied in different sugarcane tissues at different stages of crop development.

[0225] To analyze SCW108 protein by ELISA, 200 mg ± 1 plant tissue samples were impregnated using a TissueLyser instrument (QIAGEN, Germanytown, Maryland, USA). 350 µL of phosphate extraction buffer (PBS) containing Tween™ 20 (0.138 M NaCl; 0.027 mM KCl; 0.05% Thermo Scientific™ Tween™ 20, pH 7.4) was added to the impregnated tissue.

[0226] After adding buffer, homogenize by vortexing, then centrifuge at maximum speed for 20 minutes. Collect the supernatant and quantify total protein using the Bradford method (SCW108) and BCA (NptII).

[0227] The standards used to obtain calibration curves were the diluted commercially available BSA (bovine serum albumin) standards provided in the kit described above. Standard solutions (prepared with PBST buffer) at concentrations of 2000 µg / mL, 1000 µg / mL, 500 µg / mL, 250 µg / mL, 125 µg / mL, and 0 µg / mL were used. 10 µL of each standard solution was added to the wells of the microplate in triplicate. A total of six curves were generated through independent dilutions. For the samples, 10 μL of the three independent protein extracts was used per well. Then, 200 μL of Coomassie Brilliant Blue reagent was added to each well containing the calibrator and sample. The plate was capped and incubated at room temperature for 5 minutes. The absorbance at 595 nm was read using SoftmaxPro® 7.0 software (Molecular Device, US).

[0228] Each study sample was measured three times to obtain total soluble protein. After each repeated quantification of total protein, the sample with the smallest median variation in quantification was selected for ELISA analysis. After total protein quantification, the sample was diluted 8-fold.

[0229] The SpectraMax® microplate reader (Molecular Devices, USA) was used to read the spectrum at two different wavelengths, 450 nm and 630 nm, in 96-well plates to obtain the results. The SCW108 protein was detected and quantified using a His-tagged commercial kit.

[0230] The correlation between the absorbance values ​​of the test samples and the predicted values ​​in the equation estimated by measuring the absorbance of the standard curve was analyzed. Synthetic proteins were diluted to the desired concentration in PBST buffer. Each sample was analyzed in replicates.

[0231] Determine the copy number of the transgene inserted into the host plant germplasm.

[0232] Taqman® PCR (qPCR / Taqman®) assessment of inserted plants SCW108 and nptII Gene copy number. Taqman® real-time PCR reactions are performed in rapid mode using QuantStudio 6 and 7 Flex Real-Time PCR (Applied Biosystems™, EUA). SCW108The endogenous positive control for the reaction (used to confirm the presence and quality of the DNA used and the validity of the reaction), the sugarcane polyubiquitin gene (forward primer: 5'ACCATTACCCTGGAGGTTGAGA 3' (SEQ ID NO: 6); reverse primer: 5'GTCCTGGATCTTCGCCTTCA 3' (SEQ ID NO: 7); probe: VIC-5'CTCTGACACCATCGAC 3'-MGB (SEQ ID No: 8) was used in multiplex mode.

[0233] qPCR reactions were performed using 1X TaqMan® Fast PCR Master Mix II (Applied Biosystems, USA). Each primer concentration was 150–300 nM, and the corresponding probe concentration was 100–200 nM. The thermal cycling program was as follows: 50°C for 2 minutes to activate uracil N-glycosylation enzyme; 95°C for 20 seconds to activate DNA polymerase; and 40 cycles of 95°C for 3 seconds (denaturation) and 60°C for 30 seconds (annealing and extension).

[0234] Data analysis was performed by manually inputting the threshold for the exponential phase of the amplification curve. For SCW108 and NptII Gene copy number is inferred through DeltaCt (dCt) analysis, which subtracts the Ct value of the target gene (the number of cycles at which the fluorescence signal emitted by the amplified product reaches a threshold) from the Ct value of the endogenous gene. In this analysis, it is assumed that the copy number doubles at each Ct value, and a known copy number of the same control is used as a reference.

[0235] In vitro biological test: Sugarcane weevil

[0236] Using the events generated in Example 3, in vitro bioassays (feed bioassays) were conducted with the target pest, the sugarcane weevil. The results showed that the insecticidal protein SCW108 expressed in the plant was effective in controlling the pest.

[0237] For bioassays, plant tissues from genetically modified sugarcane plants (successful events) and non-transgenic sugarcane plants (negative controls) were collected, freeze-dried, mixed with insect gel bait, and aliquoted into bioassay plates. Each well of the culture plate was inoculated with... Sugarcane weevil The larvae (neonate) were incubated for 7 days at 27±1℃, relative humidity 60±10%, and photoperiod 12:12h (light:dark). At the end of incubation, the larval mortality rate was assessed.

[0238] result

[0239] As a response SCW108 and NptII The result of the transformation event was the discovery of at least one copy of the event's genome. SCW108 Genes and NptII The presence of the gene (one copy in each of the two replicate experiments), the latter analysis based on the detection of the gene promoter. Choose one or two copies. SCW108 Genes and NptII Gene events are tested in vitro.

[0240] Seven days after bioassay, the modified plants (expressing...) were identified. SCW108 The average relative efficacy of the plant.

Claims

1. A recombinant polypeptide comprising: a) a sequence having at least two domains selected from domain I, domain II and domain III of a Cry10Aa protein; and b) a domain III sequence from a Cry1A protein or a Cry1Ab protein, optionally a Cry1Ab11 protein.

2. A recombinant polypeptide having at least 40%, at least 60%, at least 90%, or 100% sequence identity with SEQ ID NO: 1, and / or a variant or fragment thereof.

3. The recombinant polypeptide of claim 2, wherein the polypeptide comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 1 and / or its variants or fragments.

4. The recombinant polypeptide according to any one of claims 1-3, wherein the sequences comprising domain I, domain II and / or domain III of the Cry10Aa protein contain sequences having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95% or at least 97% sequence identity with SEQ ID NO: 2, and wherein the sequence comprising domain III of the Cry1A protein contains sequences having at least 80%, at least 83%, at least 85%, at least 87%, at least 90%, at least 93%, at least 95% or at least 97% sequence identity with SEQ ID NO:

3.

5. A recombinant polypeptide comprising: at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 1; at least one addition at the N-terminus or C-terminus compared to SEQ ID NO: 1; at least one domain exchange compared to SEQ ID NO: 2; at least one truncation compared to SEQ ID NO: 2; and / or at least one other alteration compared to SEQ ID NO: 2, optionally wherein the recombinant polypeptide comprises SEQ ID NO: 2 or SEQ ID NO:

3.

6. The recombinant polypeptide according to claim 1, wherein the polypeptide has: at least one amino-terminal substitution, deletion and / or insertion compared to SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3; and / or at least one addition at the N-terminus or C-terminus compared to SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO:

3.

7. The recombinant polypeptide according to any one of claims 1-6, wherein the recombinant polypeptide is a fusion protein, variant thereof, or fragment comprising at least a portion of the polypeptide according to any one of claims 1-3.

8. The recombinant polypeptide according to any one of claims 1-7, wherein the polypeptide has insecticidal activity against at least one agricultural insect pest, wherein the at least one insect pest is a coleopteran pest, and optionally wherein the coleopteran pest is Sugarcane weevil ( Sphenophorus levis ).

9. A recombinant polynucleotide encoding a polypeptide of any one of claims 1-8, optionally wherein said recombinant polynucleotide comprises SEQ ID NO:

4.

10. The recombinant polynucleotide of claim 9, wherein the polynucleotide has a codon optimized for expression in agriculturally important crops.

11. The recombinant polynucleotide of claim 9 or 10, wherein the polynucleotide is a non-genomic polynucleotide, optionally wherein the polynucleotide is a synthetic polynucleotide, and / or wherein the polynucleotide is cDNA.

12. An isolated construct or expression cassette comprising a nucleotide encoding a polypeptide of any one of claims 1-8 or a polynucleotide of any one of claims 9-11, wherein said nucleotide or polynucleotide is operatively linked to a promoter and optionally operatively linked to a heterologous regulatory element.

13. The isolated construct or expression cassette according to claim 12, wherein the polypeptide comprises SEQ ID NO: 2; and / or wherein the polynucleotide comprises SEQ ID NO:

4.

14. The isolated construct or expression cassette according to claim 12 or claim 13, wherein the promoter is selected from constitutive promoters, inducible promoters, and tissue-specific promoters.

15. A transgenic plant, plant part, propagule, seed, tissue, organ, embryo, or plant cell comprising a polypeptide of any one of claims 1-8, a polynucleotide of any one of claims 9-11, or an isolated construct or expression cassette of any one of claims 12-14; optionally wherein the polypeptide is SEQ ID NO: 2 and / or wherein the polynucleotide is SEQ ID NO:

4.

16. An insecticidal composition comprising: (i) One or more polypeptides of any one of claims 1-8, wherein the concentration of said one or more polypeptides is sufficient to control at least one agricultural insect pest. (ii) One or more polynucleotides of any one of claims 9-11, wherein said polynucleotide has a codon optimized for expression in agriculturally important crops; and / or (iii) One or more separate constructs or expression boxes of any one of claims 12-14; Optionally, the polypeptide is SEQ ID NO: 2; and / or the one or more polynucleotides are SEQ ID NO:

4.

17. The insecticidal composition of claim 16, wherein the at least one agricultural insect pest is a coleopteran pest, and wherein when the composition is applied to a plant or plantation, the concentration of the one or more polypeptides is sufficient to control at least one agricultural insect pest in or on the plant, optionally wherein the plant is a sugarcane plant.

18. The insecticidal composition according to claim 16 or claim 17, further comprising one or more inert components and / or an acceptable carrier; (i) The composition is formulated as a suspension, solution, emulsion, spreader, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granules, adjuvant, paste, gel, culture medium, artificial feed, or encapsulated in an agriculturally acceptable carrier; (ii) wherein the composition is formulated as an orally acceptable, orally administerable or orally ingestible bait for consumption by insect pests; (Iii) The composition is formulated for direct soil application and / or direct potting substrate application; and / or (iv) The composition is formulated as a controlled-release formulation.

19. The insecticidal composition according to any one of claims 16-18, wherein, Control of Coleoptera pests includes: a) Reduces pest infestation by 40%, 50%, 60%, 70%, 80%, 90%, or 100%; or b) Increases pest mortality by 40%, 50%, 60%, 70%, 80%, 90%, or 100%.

20. The insecticidal composition according to any one of claims 16-19, wherein the coleopteran pest is the sugarcane weevil.

21. A method for controlling insect pest populations, comprising: a) Provide a composition comprising at least one polypeptide of any one of claims 1-8 or provide a composition of any one of claims 16-19; and b) Contact the insect pest population with an effective amount of the composition; Optionally, the polypeptide described therein is SEQ ID NO:

2.

22. The method of claim 21, wherein (i) The contact in step (b) includes one or more of the following: providing the pest with a composition formulated as an insect bait; feeding the pest with the composition; applying the composition to the outer surface of the pest; applying the composition to a plant; applying the composition to a plant part fed by the pest; applying the composition to a soil area where the pest may be present; applying the composition to an area where the pest population may be present; providing the composition formulated as a controlled-release formulation to an area where the pest is expected to appear; applying the composition to an insect pest trap; injecting the composition into a plant; or injecting the composition into a pest; or The contact in step (b) includes applying the composition to a plant or an area to be planted, optionally wherein the composition is applied to the plant in at least one of the following ways: foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment.

23. The method of claim 21 or claim 22, wherein the composition is formulated as a suspension, solution, emulsion, spreader, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granules, adjuvant, paste, gel, culture medium, artificial feed, or encapsulated in an agriculturally acceptable carrier; and / or The composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation or concentration.

24. The method according to any one of claims 21-23, wherein the insect pest population is reduced by 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to an insect pest population that has not been exposed to the composition; optionally wherein the insect pest or insect pest population is resistant to at least one Bt toxin.

25. The method according to any one of claims 21-24, further comprising providing a chemical mixture, an insecticidal protein, and / or a biocontrol agent, and contacting an insect pest population with an effective amount of the chemical mixture, the insecticidal protein, and / or the biocontrol agent before, during, or after step (b).

26. The method according to any one of claims 21-25, wherein the insect pest is a coleopteran pest, and optionally wherein the coleopteran pest is a sugarcane weevil.

27. A method for controlling insect pest populations, comprising: a) Providing an insecticidal composition comprising at least one polypeptide according to any one of claims 1-8; b) Introducing the insecticidal composition into an insect pest population, wherein the introduction is achieved by providing the composition in or on a food source of the insect pest; and The population of the aforementioned insect pests has decreased.

28. Use of the polypeptide of any one of claims 1-8 for inhibiting insect growth, controlling or killing insects and / or controlling or killing insect populations.

29. A kit for detecting peptides and / or polynucleotides, comprising tools for detecting the presence of one or more peptides according to any one of claims 1-8 and / or the presence of one or more polynucleotides according to any one of claims 9-11. The tool may contain primer pairs designed to bind to the polynucleotide, or the tool may contain primer pairs and probes designed to bind to the polynucleotide, and / or the tool may contain an antibody for detecting the polypeptide.

Images