Saccharomyces boulardii, koji prepared by fermentation of saccharomyces boulardii and application thereof
By using the fermentation of the yeast strain JQ-15 to prepare Jianqu, the problem of inconsistent quality and efficacy of traditional Jianqu fermentation was solved, the anti-inflammatory and laxative effects of Jianqu were improved, and the uniform quality and safety of Jianqu were ensured.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- 四川仟源中药饮片有限公司
- Filing Date
- 2024-06-26
- Publication Date
- 2026-07-10
AI Technical Summary
Traditional fermentation methods for making koji (fermented koji) result in inconsistencies in quality and efficacy, pose safety risks due to harmful bacteria, and make it difficult to guarantee the consistency of koji's quality and efficacy.
The fermentation of Jianqu (a type of fermented yeast) was carried out using the Saccharomycopsis fibuligera strain JQ-15. The fermentation process was controlled to ensure the consistency of the quality and efficacy of Jianqu.
It improves the anti-inflammatory and laxative effects of Jianqu (a type of traditional Chinese medicine), ensures the consistent quality and safety of Jianqu, and is suitable for the preparation of anti-inflammatory and laxative products.
Smart Images

Figure CN121203845B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more specifically to a capsule-coated yeast and its fermentation preparation and application. Background Technology
[0002] Jianqu, a traditional Chinese medicine, is composed of Polygonum hydropiper, bitter almond, hawthorn (fried), Atractylodes lancea, Angelica dahurica, and Perilla frutescens, among other ingredients. It has the effects of relieving exterior symptoms and harmonizing the middle jiao (digestive system), and is used for headaches due to cold or heat, food stagnation in the middle jiao, vomiting, and abdominal distension. Traditionally, Jianqu is fermented naturally using microorganisms found in the natural environment. However, due to the complex and diverse microbial flora in the environment, and the significant differences between microbial flora in different environments, the quality and efficacy of different batches of Jianqu can vary considerably. Furthermore, harmful bacteria present in the environment can easily cause excessive levels of harmful metabolites such as aflatoxin and aflatoxin var. malaise, posing certain safety risks and hindering the promotion and application of Jianqu. Therefore, screening for a dominant microbial strain for Jianqu fermentation is beneficial for ensuring the consistency of Jianqu's quality and efficacy and for its widespread application. Summary of the Invention
[0003] To address the aforementioned deficiencies or improvement needs of existing technologies, this invention provides a new strain of yeast called *Saccharomyces cerevisiae*, its fermentation preparation of *Jianqu*, and its application. The purpose is to screen a new strain—*Saccharomyces cerevisiae*—from existing *Jianqu* products. Compared to existing natural fermentation methods, *Jianqu* prepared using this strain exhibits better consistency in quality and efficacy, and also demonstrates superior anti-inflammatory and laxative effects. This solves the technical problem of poor consistency in quality and efficacy associated with existing *Jianqu* produced through natural fermentation.
[0004] To achieve the above objectives, according to one aspect of the present invention, a *Saccharomycopsis fibuligera* strain JQ-15 is provided, with accession number CGMCC NO.30767 and classification name Saccharomycopsis fibuligera.
[0005] According to another aspect of the present invention, a method for preparing Jianqu (a type of fermented yeast) using the sac-covered yeast fermentation method described in the present invention is also provided, comprising the following steps:
[0006] The pre-set inoculation amount of the capsule-forming yeast suspension was inoculated into the raw material block of Jianqu for fermentation. When the block was covered with white mold and emitted a fragrance, it was taken out, dried, and the fermentation was terminated to obtain the fermented product Jianqu.
[0007] Preferably, in the method, the spore count of the capsule-forming yeast suspension is 2 × 10⁻⁶. 8 ~3×10 9 CFU / mL.
[0008] Preferably, in the method, the preset inoculation amount is 2% to 15% based on the mass of the raw material blocks for fermentation, and fermentation is carried out at 25 to 30°C for 1 to 3 days.
[0009] According to another aspect of the present invention, a Jianqu (a type of traditional Chinese medicine) with anti-inflammatory and laxative effects is also provided, which is prepared according to the method described in the present invention.
[0010] According to another aspect of the present invention, the application of Jianqu as described in the present invention in the preparation of anti-inflammatory products is also provided.
[0011] Preferably, the application is used in the preparation of products for the prevention or improvement of colitis.
[0012] Preferably, in the application, the colitis is ulcerative colitis.
[0013] According to another aspect of the present invention, the application of Jianqu as described in the present invention in the preparation of laxative products is also provided.
[0014] Preferably, in the application, the laxative product contains scutellaria baicalensis extract as its active ingredient.
[0015] Overall, compared with the prior art, the above-described technical solutions conceived by this invention, due to the discovery of the new strain *Saccharomyces cerevisiae* JQ-15, can achieve the following beneficial effects:
[0016] The novel *Saccharomycopsis fibuligera* strain JQ-15 provided by this invention was deposited on May 24, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.30767 and classified as *Saccharomycopsis fibuligera*. Experiments have confirmed that, compared to Jianqu (a type of fermented koji) obtained through existing natural fermentation, Jianqu obtained using this strain JQ-15 exhibits superior anti-inflammatory and laxative effects. Furthermore, single-strain fermentation facilitates production management and control, ensuring consistent quality and efficacy, and promoting the widespread application of Jianqu. Attached Figure Description
[0017] Figure 1 This is a schematic diagram of the culture results of JQ-15 bacteria on PDA medium;
[0018] Figure 2 This is a schematic diagram of the qualitative culture results of protease from JQ-15 bacteria;
[0019] Figure 3 This is a schematic diagram of the qualitative culture results of amylase in JQ-15 bacteria;
[0020] Figure 4 The evaluation of the cytotoxicity of JQ-15 bacteria fermentation culture against RAW264.7 cells;
[0021] Figure 5 The evaluation of the cytotoxicity of JQ-15 bacteria fermentation to HT-29 cells;
[0022] Figure 6 This is a comparison of the anti-inflammatory effects of different extracts of *Jianqu* (a type of medicinal herb).
[0023] Figure 7 The effect of oral administration of Jianqu extract on the relative expression level of the MUC3 gene;
[0024] Figure 8 The changes in body weight of mice administered different Jianqu extracts by gavage;
[0025] Figure 9 These are the DAI scores of mice administered different Jianqu extracts by gavage;
[0026] Figure 10 These are the results of colon length measurements in mice administered different Jianqu extracts via gavage;
[0027] Figure 11 These are the results of measuring the fecal water content of mice administered different Jianqu extracts via gavage;
[0028] Figure 12 This is a comparison of the time it takes for mice to excrete black stools on the first day after gavage administration of different Jianqu extracts;
[0029] Figure 13 The effect of gavage administration of Jianqu extract on intestinal motility in mice. Detailed Implementation
[0030] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.
[0031] This invention uses naturally fermented koji obtained from Qianyuan as experimental material. Microorganisms were isolated and purified from the fermented koji produced by the factory. The results showed that the microorganisms in the koji were mainly Proteobacteria, Firmicutes, Ascomycota, Actinobacteria, and Bacteroidetes.
[0032] Further, the microorganisms in the fermented koji were isolated and purified, resulting in the screening of a strain JQ-15, which was identified as a new strain of *Saccharomycopsis fibuligera*. This strain was deposited on May 24, 2024, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.30767 and classification name *Saccharomycopsis fibuligera*. Experimental results showed that the koji obtained by fermentation using this strain was of superior quality compared to koji obtained through existing natural fermentation, exhibiting better anti-inflammatory and laxative effects.
[0033] Based on this, the present invention provides a saccharomycopsis fibuligera strain JQ-15, which has the accession number CGMCC NO.30767, the accession date of May 24, 2024, and the classification name Saccharomycopsis fibuligera.
[0034] The cladomycin-coated yeast is capable of producing protease and amylase.
[0035] In addition, the present invention also provides a method for preparing Jianqu (a type of fermented yeast) using the sac-covered yeast fermentation method described in the present invention, which includes the following steps:
[0036] The pre-set inoculation amount of the *Saccharomyces cerevisiae* JQ-15 suspension was inoculated onto the raw material block of Jianqu for fermentation. When the block was covered with white mold and emitted a fragrance, the Jianqu was removed, dried, and the fermentation was terminated to obtain the fermented product Jianqu.
[0037] The number of spores in the *Saccharomyces cerevisiae* JQ-15 suspension was 2 × 10⁻⁶. 8 ~3×10 9 CFU / mL; based on the mass of the raw material block of Jianqu, the preferred inoculation amount is 2-15%, and fermentation is carried out at 25-30℃ for 1-3 days.
[0038] In some embodiments, the number of spores in the *Saccharomyces cerevisiae* JQ-15 suspension is 3 × 10⁻⁶. 9 The inoculum concentration was set at 15% (CFU / mL), and the fermentation was carried out at 27–30°C for 1–2 days. After drying, the fermented product Jianqu was obtained.
[0039] In some embodiments, the number of spores in the *Saccharomyces cerevisiae* JQ-15 suspension is 2 × 10⁻⁶. 8 The inoculum concentration was 2% (CFU / mL), and the fermentation was carried out at 27-30℃ for 2-3 days. After drying, the fermented product Jianqu was obtained.
[0040] The present invention also provides a fermented koji with anti-inflammatory and laxative effects, wherein the fermented koji is obtained by fermentation according to the preparation method described in the present invention.
[0041] In addition, the present invention also provides the application of Jianqu as described in the invention in the preparation of anti-inflammatory products.
[0042] The anti-inflammatory product is for the prevention or improvement of colitis, especially ulcerative colitis.
[0043] The anti-inflammatory product contains ginseng extract as its active ingredient.
[0044] The present invention also provides an application of Jianqu as described in the invention in the preparation of laxative products.
[0045] The laxative product promotes intestinal motility and accelerates stool excretion; its active ingredient includes scutellaria baicalensis extract.
[0046] In some embodiments, the Jianqu extract is an aqueous extract of Jianqu, obtained according to the following method:
[0047] Add 100g of the prepared medicine to 1000mL of water and soak for 20 minutes.
[0048] First decoction: First bring the medicine to a boil over high heat, then reduce to low heat and start timing. Simmer for 15 minutes, then filter and collect the liquid, keeping the dregs.
[0049] Second decoction: Add an equal amount of water to the filtered dregs, bring the medicine to a boil over high heat, then reduce to low heat and start timing. Simmer for 10 minutes, filter and collect the liquid, mix it with the liquid obtained from the first filtration, and concentrate to 200mL to obtain Jianqu extract.
[0050] Gavage administration of Jianqu extract can significantly reduce the concentration of the pro-inflammatory cytokine IL-6 in inflammatory model cells, restoring it to normal levels. Animal experiments have verified that this Jianqu extract has better anti-inflammatory and laxative effects than Jianqu extract obtained by natural fermentation, and can be used to prepare anti-inflammatory products and / or laxative products.
[0051] The following are examples.
[0052] Example 1: Screening, isolation and identification of strain JQ-15
[0053] (1) Natural fermentation of fermented koji
[0054] Jianqu, produced by Sichuan Qianyuan, is a type of traditional Chinese medicine decoction piece. Its main ingredients include Polygonum hydropiper, Xanthium sibiricum, Artemisia annua, bitter almond, red adzuki bean, malt, hawthorn (fried), dried tangerine peel, patchouli, Atractylodes lancea, Magnolia officinalis, Aucklandia lappa, Angelica dahurica, Citrus aurantium (fried with wheat bran), and Areca catechu. The raw materials for Jianqu are prepared according to the relevant prescriptions in the National Drug Standard WS3-B-3238-98 of the State Drug Administration, and fermentation is carried out using the traditional Jianqu fermentation process, as detailed below:
[0055] Place the medicinal blocks neatly on a stainless steel rack, cover them with a clean cloth, and close the door. Allow them to ferment naturally at room temperature for 1-3 days (about 1 day in summer, about 2 days in spring and autumn, and about 3 days in winter). The temperature of the medicinal blocks should be warm but not hot to the touch, and the relative humidity in the fermentation room should be 60-90%. When the outer surface of the medicinal blocks is covered with white mold and has an aroma of alcohol, remove them and transfer them to a drying room.
[0056] Notes on operation: During fermentation, if the medicine block burns to the touch, it indicates that the temperature is too high. You can remove the covering to cool it down. If the relative humidity in the room is too low, spray water to increase the humidity.
[0057] Drying process:
[0058] Take the fermented lumps and place them in a hot air circulating oven, controlling the temperature at 95-105℃. Start timing when the temperature reaches 95℃ and dry for about 3 hours until dry. Remove the product. This product is a yellowish-brown rectangular block with a rough, yellowish-brown outer surface, white mold, and a loose, yellowish-brown cross-section. It has a fragrant aroma and a slightly bitter taste.
[0059] Take this product and observe it under a microscope: the epidermal cells of the seed coat are palisade-like; in basal view, the cells are polygonal with slightly thickened walls and large lumens containing reddish-brown to red substances. The endosperm cells are mostly broken, colorless, with numerous, very large, round or rectangular pits. The secretory cells are round, containing pale yellowish-brown to reddish-brown secretions. The thin-walled cells around the fiber bundles contain calcium oxalate crystals, forming crystal fibers. Identification was performed according to WS3-B-3238-98, and the result was positive for fibrous tissue.
[0060] (2) Sampling of the model
[0061] Three to five normally fermented batches were randomly selected as biological replicates. Specifically, samples were collected from three different stages of the natural fermentation process of the fermented koji, including the early, middle and late stages. The samples were placed in sampling tubes containing sterile protective solution and stored at -80°C for sequencing analysis and strain isolation.
[0062] (3) Isolation and identification of JQ-15 bacteria
[0063] Three batches of live Jianqu fermentation samples (collected at three time points before, during, and after fermentation) were aseptically mixed. 1g of sample was added to a 99mL Erlenmeyer flask containing 250mL of sterile water and glass beads, and shaken for 30 minutes to ensure uniform dispersion of fungal spores. 1mL of the bacterial suspension was serially diluted and incubated on potato dextrose agar (PDA) at 30℃ for 3-5 days. Different morphological colonies were streaked for isolation and purification, such as... Figure 1 As shown, the strains isolated were identified by 16S and 18S assays.
[0064] Bacterial 16S was amplified using universal primers 27F (TACGGYTACCTTGTTACGACTT) and 1492R (AGAGTTTGATCMTGGCTCAG).
[0065] The internal transcriptional spacer (ITS) region of the fungal rRNA gene was amplified using universal primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) under Taq DNA polymerase.
[0066] The final volume of the PCR amplification system was 20 μL, containing 2 μL of 10×PCR buffer, 2 μL of dNTP (2 mM), 1 μL (10 pmol) of each primer, 10 ng of template DNA, 1 μL of Taq polymerase, and added ddH2O to replenish volume. The PCR amplification program included initial denaturation at 95°C for 5 minutes, 30 amplification cycles (95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 40 seconds), and a final extension at 72°C for 7 minutes, before being sent to a sequencing company for sequencing. The obtained nucleotide sequences were aligned using the BLAST alignment tool and compared with highly homologous sequences in the NCBI Gene Bank database. The result, labeled as No. 15, was identified as a new strain of Saccharomycopsis fibuligera, designated as strain JQ-15. It was deposited on May 24, 2024, at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.30767 and classification name Saccharomycopsis fibuligera. The deposit date was May 24, 2024.
[0067] Example 2: Performance Study of JQ-15 Strains
[0068] The isolated pure strain JQ-15 was inoculated onto PDA solid medium and cultured in a constant temperature and humidity incubator at 30℃ and 75% to form a mycelial growth. After punching holes to form mycelial cakes, the mycelial cakes were placed in the wells of protease and amylase qualitative medium and cultured at 30℃ for 3 days. The results are as follows. Figure 2 As shown, observe whether a clear zone appears on the culture medium. If a clear zone appears on the protease qualitative culture medium, it indicates that the bacterium can produce protease.
[0069] Staining was performed using 0.5% iodine solution, and the results were as follows: Figure 3 As shown, observe whether a color change occurs on the culture medium. If a color change occurs on the amylase qualitative culture medium, it indicates that the bacterium can produce amylase.
[0070] The specific qualitative culture media are as follows:
[0071] Protease qualitative culture medium: 3.0g skim milk powder, 3.0g agar, 200mL water.
[0072] Amylase qualitative culture medium: 5g yeast extract, 10g peptone, 15g soluble starch, 15g agar powder.
[0073] 0.5% iodine solution: 1g iodine tablets, 2g potassium iodide, 200mL distilled water. First, dissolve the potassium iodide in a small amount of water, then dissolve the iodine tablets in the potassium iodide solution. After the iodine tablets are completely dissolved, add enough water.
[0074] Depend on Figure 2 and Figure 3 It can be seen that the JQ-15 bacterium can produce protease and amylase, which is consistent with the enzyme production performance of Saccharomycopsis fibuligera.
[0075] Example 3: Safety evaluation of fermentation koji-making using strain JQ-15
[0076] (1) Directional fermentation of koji
[0077] JQ-15 strain was selected from the identified strains and cultured. After the fungal spores of JQ-15 matured, a spore suspension was prepared by washing with sterile distilled water containing Tween 80 (0.2%, v / v) and adjusting the concentration to 2 × 10⁻⁶. 8 Spores / mL.
[0078] The raw materials for Jianqu (a type of fermented medicinal material) were washed, dried at 80℃, pulverized, sieved, and mixed according to the standard formula. Under aseptic conditions, directional fermentation was carried out by inoculating a suspension of strain JQ-15 at an inoculum rate of 2%–15%. Natural fermentation served as a control. For natural fermentation, sterile water was directly inoculated at an equal percentage. An appropriate amount of starch paste was added according to the formula to form a certain number of rectangular blocks. Fermentation was then carried out according to the Jianqu fermentation temperature and humidity. Three batches of fermentation using strain JQ-15 were conducted.
[0079] The first batch of JQ-15 strain was inoculated at 2% (V / W), fermented at room temperature of 30℃ and 75% humidity for 2 days, and was named JQ-15(1-4);
[0080] The second batch of JQ-15 strain was inoculated at 2% (V / W), fermented at room temperature of 30℃ and 75% humidity for 3 days, and was named JQ-15(2-4);
[0081] The third batch of JQ-15 strain was inoculated at 15% (V / W), fermented at room temperature of 30℃ and 75% humidity for 2 days, and was named JQ-15(3-13).
[0082] During fermentation, the morphological changes of the fermented koji were observed and recorded. At a 15% inoculum size, white mold covered the surface after one day of fermentation. To further shorten the fermentation time, the inoculum size could be appropriately increased. When the koji was covered with white mold and emitted a fragrance, it was removed and dried in a 95℃ oven for 3 hours to terminate fermentation. Finally, the dried koji was stored at room temperature.
[0083] Among them, Jianqu obtained by natural fermentation in the laboratory (30℃, adding sterile water (equal to the bacterial solution) to the Jianqu raw material, fermentation at 75% humidity for 2 days) was used as control 1, and Jianqu obtained by fermentation in the Jianqu factory (approximately 27℃, 70%-90% humidity, fermentation for 2 days) was used as control 2.
[0084] (2) Preparation of Jianqu extract
[0085] Soaking: Soak the three batches of Jianqu prepared in (1) above, the Jianqu obtained by natural fermentation in the laboratory, and the Jianqu obtained by fermentation in the Jianqu factory, in 1000mL of water for 20 minutes with 100g of Jianqu.
[0086] First decoction: First bring the medicine to a boil over high heat, then reduce to low heat and start timing. Simmer for 15 minutes, then filter and collect the liquid, keeping the dregs.
[0087] Second decoction: Add an equal amount of water to the filtered dregs, bring the medicine to a boil over high heat, then reduce to low heat and start timing. Simmer for 10 minutes, filter and collect the liquid, mix it with the liquid obtained from the first filtration, and concentrate to 200mL to obtain the extracted Jianqu effective components, which is Jianqu extract. Store separately at -20℃ for later use.
[0088] (3) Safety evaluation of Jianqu extract
[0089] The cytotoxicity of each established sample to HT-29 and RAW264.7 cells was detected using the CCK-8 assay. Cells were seeded into 96-well plates at a density of 1 × 10⁻⁶ cells / well. 4 Cells were cultured in 12 replicates per well until they reached 70%–80% coverage of each well. The old culture medium was removed, and 100 μL of DMEM high-glucose medium was added to each well to prepare culture media containing different concentrations of Jianqu extract (5%, 10%, 15%, 20%, 25%). A control group (no Jianqu extract) was used. After 24 hours of culture, the old culture medium was removed, and 100 μL of serum-free medium containing CCK-8 (10% by volume) was added to each well. After incubation for 1–4 hours, the absorbance at 450 nm was measured using a microplate reader, and the relative cell viability (ratio to control group) was calculated. The relative viability results for RAW264.7 cells are shown below. Figure 4 The relative survival rate of HT-29 cells is as follows: Figure 5 As shown.
[0090] Compared to the control group without sample in the cell wells, the cell viability in the experimental group reflects the cytotoxicity of the sample. According to the toxicity evaluation criteria described in ISO 10993-5:2009, a cell viability of more than 70% can be defined as non-cytotoxic.
[0091] Depend on Figure 4 It can be seen that the Jianqu extract in the above culture medium is not toxic to RAW264.7 cells at a certain concentration (<15%), and has a high safety profile.
[0092] Depend on Figure 5 It can be seen that the above-mentioned Jianqu extract can significantly promote cell growth when added at a concentration of 5% to 20%, and the Jianqu extract obtained by fermentation with the addition of JQ-15 has a similar or even better promoting effect than the Jianqu extract obtained by natural fermentation. This demonstrates that the Jianqu extract obtained by fermentation with the addition of JQ-15 has high safety.
[0093] Example 4: Anti-inflammatory effects of extracts from fermented koji made from strain JQ-15
[0094] The anti-inflammatory effect of the *Jianqu* extract obtained in Example 3 was evaluated using cell experiments, as follows:
[0095] ① Anti-inflammatory cell experiment
[0096] The cells used were RAW264.7 cells (mouse mononuclear macrophage leukemia cells), and the experimental procedures were as follows:
[0097] Macrophages at 1×10 5After densely seeding into 48-well plates and culturing for 24 hours;
[0098] Experimental group 1: Remove the culture medium and add 200uL of DEME medium containing 15% of the first batch JQ-15 (1-4) fermentation extract. After 1 hour, add 4uL of LPS (50ug / ml) and treat for 24 hours. Collect the supernatant.
[0099] Experimental group 2: Remove the culture medium and add 200uL of DEME medium containing 15% of the extract of Jianqu obtained by fermentation of the second batch of JQ-15(2-4). After 1 hour, add 4uL of LPS (50ug / ml) and treat for 24 hours. Collect the supernatant.
[0100] Experimental group 3: Remove the culture medium and add 200uL of DEME medium containing 15% of the extract of Jianqu obtained by fermentation of the third batch of JQ-15(3-13). After 1 hour, add 4uL of LPS (50ug / ml) and treat for 24 hours. Collect the supernatant.
[0101] Positive control 1: Remove the culture medium, add 200uL of DEME medium containing 15% Jianqu extract obtained by laboratory natural fermentation, add 4uL of LPS (50ug / ml) after 1h, treat for 24 hours and collect the supernatant.
[0102] Positive control 2: Remove the culture medium and add 200uL of DEME medium containing 15% Jianqu extract obtained by natural fermentation in Jianqu factory. After 1h, add 4uL of LPS (50ug / ml) and treat for 24 hours. Collect the supernatant.
[0103] Inflammation model cell group: Remove the culture medium, replace with new DEME culture medium, add 4uL of LPS (50ug / ml) after 1h, treat for 24h and collect the supernatant;
[0104] Normal cell group: Remove the culture medium, culture in DEME medium for 25 hours and collect the supernatant.
[0105] Sample collection:
[0106] Collect the supernatant of cultured cells from each treatment group. Centrifuge at 10,000 rpm at 4°C for 10 min, collect the supernatant, discard cell debris and suspended particles, and store at -80°C.
[0107] ②Inflammatory factor detection:
[0108] The concentration of the pro-inflammatory cytokine IL-6 in the supernatant of cultured cells was detected using a kit, and the results are as follows: Figure 6 As shown.
[0109] An IL-6 level <7 pg / ml is generally considered normal. IL-6 concentration is positively correlated with inflammation; elevated levels indicate inflammation. Figure 6 The presence of IL-6 > 10 pg / ml in the model cell group indicates successful establishment of the inflammation model. The positive control group, supplemented with Jianqu extract obtained through laboratory-based natural fermentation or fermentation at a Jianqu factory, showed an IL-6 concentration < 7 pg / ml, which recovered to normal levels, demonstrating a significant anti-inflammatory effect. The experimental group, supplemented with Jianqu extract obtained through fermentation using JQ-15 bacteria, had an even lower IL-6 concentration than the positive control group. This suggests that the Jianqu extract obtained through JQ-15 bacteria fermentation not only has anti-inflammatory effects but also exhibits superior anti-inflammatory efficacy compared to natural fermentation.
[0110] Example 5: Study on the protective function of fermented koji made from strain JQ-15 on the intestinal barrier.
[0111] Mucin MUC3 plays an important role in resisting bacterial invasion, protecting the intestinal mucosa, promoting epithelial proliferation and inflammation healing. Its reduced expression is an important cause of the development of various intestinal diseases such as neonatal enteritis and inflammatory bowel disease. Therefore, effectively upregulating MUC3 expression is of great significance for the prevention and treatment of intestinal inflammatory diseases.
[0112] Take HT29 cells in good growth condition, digest them when they reach 80% confluence, and feed them with (2-4) × 10⁻⁶ cells. 5 The samples were seeded at a density of / well in 6-well plates and cultured in McCoy's 5A galactose medium containing 10% FBS until 60%–80% confluence. The medium was then aspirated. The experimental groups were incubated in McCoy's 5A galactose medium containing 20% (v / v) of the sample for 24 hours, while the control group was treated with PBS at the same ratio.
[0113] After grouping and processing, cells were collected, washed with PBS, and 1 mL of Trizol was added to each well to lyse the cells. Total RNA was extracted from the cells, followed by reverse transcription to obtain cDNA. Finally, RT-PCR was performed. The upstream primer for MUC3 was 5'-CCGGACCTCAATGACAACACT-3', and the downstream primer was 5'-ACCACGATGCTGCCATTCCT-3', with a product length of 146 bp. The upstream primer for the internal reference gene GAPDH was 5'-GGGGAAGGTGAAGGTCG-GAGT-3', and the downstream primer was 5'-CTCGCTCCTGGAAGAT-GGTGAT-3', with a product length of 240 bp.
[0114] The RT-PCR reaction conditions were: 95℃ for 1 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 45 s, for 40 cycles. (Using 2...) -ΔΔCtThe ΔCt value was calculated using the method to quantitatively compare the expression level of the target gene MUC3. The results of the relative expression level of the MUC3 gene are as follows: Figure 7 As shown.
[0115] The results show that after three batches of fermentation with JQ-15, the expression of the mucin MUC3 gene was significantly increased in all samples. The second and third batches showed better results, indicating that the fermentation process obtained with higher JQ-15 inoculum or longer fermentation time was more conducive to preventing inflammatory bowel diseases and protecting the intestinal barrier.
[0116] Example 6: JQ-15 strain fermentation improves enteritis
[0117] Seven-week-old male C57BL / 6 mice, weighing 20.0±2.0 g, were selected and housed under specific pathogen-free (SPF) conditions. Six mice were fed a standard diet during the study period, with each cage containing six mice. After a one-week acclimatization period, subsequent experiments were conducted. The environment was maintained under a 12-hour light / dark cycle at a room temperature of 21±2℃ and a relative humidity of 40±5%.
[0118] Ulcerative colitis inducer: Sodium dextran sulfate (DSS, molecular weight 40,000) is prepared with distilled water to a final concentration of 20 g / L; the DSS solution in the water bottle should be replaced every 2-3 days.
[0119] After one week of acclimatization, mice in each group were administered the same dose of different samples via gavage. In the model and experimental groups, colitis was induced by replacing the mice's drinking water with a 2% (w / v) sodium dextran sulfate solution (DSS), while the normal control group received normal drinking water. The specific details of the gavage administration for each group are as follows:
[0120] Colitis model group: After one week of adaptation, the drinking water of mice was replaced with 2% (w / v) sodium dextran sulfate solution (DSS), and 150uL of physiological saline was administered by gavage daily;
[0121] Healthy control group: After one week of acclimatization, mice were given normal drinking water and 150uL of physiological saline by gavage daily;
[0122] Experimental group 1: After mice had adapted for one week, their drinking water was replaced with 2% (w / v) sodium dextran sulfate solution (DSS), and 150uL of the first batch of Jianqu extract obtained by JQ-15 bacteria fermentation was administered by gavage daily.
[0123] Experimental group 2: After mice had adapted for one week, their drinking water was replaced with 2% (w / v) sodium dextran sulfate aqueous solution (DSS), and 150uL of Jianqu extract was obtained by gavage daily through natural fermentation.
[0124] During the modeling period, the changes in mouse weight, bloody stool, and stool viscosity were recorded daily. The severity of colitis in each animal during the experiment was assessed according to the common mouse disease activity score (DAI) standard in Table 1.
[0125] Table 1. Assessment criteria for disease activity
[0126] Score Percentage weight loss (%) fecal viscosity Fecal occult blood 0 none normal Negative 1 1-5 soft stool Light blue 2 6-10 mucus-like stool Blue (Hidden Blood) 3 11-20 thin liquid stool Deep Blue 4 >20 - Naked bloody stool
[0127] The DAI score is the sum of three indicators: weight, stool viscosity, and fecal occult blood. In the table, "-" indicates "nothing". "Normal stool" is formed stool; "pasty stool" is pasty or semi-formed stool that does not stick to the anus; "loose stool" is pasty stool that can stick to the anus.
[0128] Mice were weighed at the same time every day, and the weight ratio (measured weight / initial weight) of each group of mice was determined as follows: Figure 8 As shown, the DAI scores of mice in each group are as follows: Figure 9 As shown; after the experiment, the mice were sacrificed, their colons were harvested, and their length was measured. The colon length measurement results for each group of mice are shown below. Figure 10 As shown.
[0129] Typically, in mouse models, weight loss, loose stools, diarrhea, bloody stools or fecal occult blood, and ulcers are considered indicative of successful colitis modeling. Figure 8 and Figure 9 It can be seen that the weight of mice in the normal control group did not change significantly and the DAI score was 0, while the weight of mice in the model group decreased significantly and the DAI score was 12, and the colon length was significantly shortened, indicating that the colitis model was successfully established in this embodiment.
[0130] Compared to the model group, the mice in both experimental groups showed less weight loss, lower DAI scores, and longer colons, indicating that gavage administration of Jianqu extract can improve colitis. In particular, the Jianqu extract obtained by gavage administration with the addition of JQ-15 fermentation showed better improvement than naturally fermented Jianqu. This suggests that Jianqu has a significant anti-inflammatory effect, especially Jianqu obtained by fermentation using strain JQ-15.
[0131] The results above show that the Jianqu sample obtained by fermenting traditional Chinese medicine raw materials by strain JQ-15 can significantly improve the trend of weight loss in mice with colitis (*p<0.05) and significantly increase their colon length (*p<0.05), which has a significant effect on improving colitis in mice. Moreover, its improvement effect is better than that of naturally fermented Jianqu, and it can be used to prepare products for the prevention or improvement of colitis.
[0132] Example 7: The laxative effect of fermented koji made from strain JQ-15
[0133] (1) Laxative experiment
[0134] Animal constipation model: The model was established with loperamide for 2 weeks, and the weight of the mice was recorded every 2 days during the experiment.
[0135] Preparation of loperamide solution: Dissolve 6mg of loperamide hydrochloride capsules (Xi'an Janssen) in 6ml, heat until the solute is completely dissolved, and shake well to obtain 1mg / ml.
[0136] Preparation of ink: Accurately weigh 10g of gum arabic, add 80mL of water, and boil until the solution is clear. Weigh 5g of activated carbon (powder) and add it to the above solution, then boil three times. After the solution cools, add water to make up to 100mL. Store in a refrigerator at -20℃ and shake well before use.
[0137] After fasting overnight each day, gavage was administered. The details of gavage administration for each group are as follows:
[0138] Healthy control group: 200uL of distilled water was administered by gavage, followed by 150uL of distilled water after 1 hour;
[0139] Model group: 200uL of loperamide solution was administered by gavage, followed by 150uL of distilled water by gavage 1 hour later;
[0140] Experimental group 1 (JQ-15 fermentation): 200uL of loperamide solution was administered by gavage, and 150uL of fermentation sample of JQ-15 strain was administered by gavage 1 hour later;
[0141] Experimental group 2 (natural fermentation): 200uL of loperamide solution was administered by gavage, and 150uL of naturally fermented koji sample was administered by gavage 1 hour later.
[0142] On day 11 of loperamide modeling, mice in the normal control and model control groups were gavage with distilled water, while the experimental groups were gavage with the test sample. Thirty minutes later, they were gavage with loperamide. The mice from each group were then transferred to separate, clean cages lined with absorbent paper. Two hours later, feces were collected from the cages, the number of feces was counted, and the wet weight of the feces was immediately measured. The collected feces were then dried at 70°C for 18 hours, and the dry weight of the feces was recorded. The water content of the feces was calculated using the following formula:
[0143] Fecal moisture content (%) = (wet weight - dry weight) / wet weight × 100%.
[0144] The results of fecal water content in each group of mice after the experiment are as follows: Figure 11 As shown.
[0145] On day 13 of loperamide modeling, mice in the normal control and model control groups were gavage with distilled water, while the experimental group was gavage with the test sample. 30 minutes later, loperamide was administered by gavage, and 0.5 hours later, each mouse was gavage with 250 μL of ink. All animals were housed individually and provided with normal drinking water and food. The time of the first black feces excreted by each animal was recorded from the start of ink administration. The results are as follows: Figure 12 As shown.
[0146] (2) Small intestinal motility test
[0147] On day 15 of the modeling with loperamide, the animals were fasted for 16 hours but allowed free access to water before the end of the experiment. On the day of measurement, each experimental group, as well as the blank and model control groups, were given the test sample or distilled water again. 30 minutes later, each experimental group and the model control group were administered loperamide by gavage, while the blank and normal control groups were administered distilled water by gavage. 30 minutes later, each group was given an indicator. 25 minutes later, the animals were euthanized by cervical dislocation, and the ink propulsion rate was calculated. The results are as follows: Figure 13 As shown, the ink propulsion rate is calculated using the following formula:
[0148]
[0149] Depend on Figure 11 It can be seen that, compared with the constipation model group, the water content of mouse feces was significantly increased when JQ-15 fermented koji was administered by gavage (*p<0.05), and the water content was higher than that of the naturally fermented koji group and the normal control group.
[0150] Depend on Figure 12 It can be seen that, compared with the normal control group, the time for the first black stool to be excreted in the model group mice was significantly prolonged, indicating that the constipation model was successfully established. However, the time for the first black stool to be excreted in mice by gavage with JQ-15 fermented or naturally fermented Jianqu was significantly shortened (*p<0.05). In particular, the time for the first black stool to be excreted in mice by gavage with JQ-15 fermented Jianqu was comparable to that of normal mice.
[0151] Depend on Figure 13 It can be seen that, compared with the model group, the ink propulsion rate of the JQ-15 fermentation group and the natural fermentation group was significantly improved, that is, the small intestinal motility was significantly enhanced, and there was obvious intestinal motility.
[0152] The above results indicate that both JQ-15 fermentation and natural fermentation have significant laxative effects, with JQ-15 fermented koji having a better laxative effect and being suitable for preparing laxative products.
[0153] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.
Claims
1. A type of capsule-coated yeast, characterized in that, The described cyst-forming yeast is strain JQ-15, with accession number CGMCCNO.30767 and classification name Saccharomycopsis fibuligera.
2. A method for preparing Jianqu (a type of fermented rice) using the yeast fermentation method described in claim 1, characterized in that, Includes the following steps: The pre-set inoculation amount of the capsule-forming yeast suspension was inoculated into the raw material block of Jianqu for fermentation. When the block was covered with white mold and emitted a fragrance, it was taken out, dried, and the fermentation was terminated to obtain the fermented product Jianqu.
3. The method as described in claim 2, characterized in that, The spore count of the capsule-coated yeast suspension was 2 × 10⁻⁶. 8 ~3×10 9 CFU / mL.
4. The method as described in claim 3, characterized in that, Based on the mass of the raw material blocks for fermentation, the preset inoculation amount is 2%~15%, and fermentation is carried out at 25~30℃ for 1~3 days.
5. The use of a genistein obtained by the method of any one of claims 2 to 4 in the preparation of a product for improving ulcerative colitis.
Citation Information
Patent Citations
Massa medicata fermentata fujianensis and preparation method thereof
CN113713061A