The U6 promoter of wax gourd and its application in CRISPR / Cas9 gene editing of wax gourd

Abstract

This invention discloses the U6 promoter of *Cucurbita stenoptera* and its application in CRISPR / Cas9 gene editing of *Cucurbita stenoptera*, belonging to the field of molecular biology technology. The *Cucurbita stenoptera* U6 promoter of this invention comprises the U6-1 promoter and the U6-2 promoter. The nucleotide sequence of the U6-1 promoter is shown in SEQ ID NO.9, and the nucleotide sequence of the U6-2 promoter is shown in SEQ ID NO.11. By replacing the Arabidopsis thaliana U6 promoter and 3'-UTR in the vector with the corresponding 3'-UTR of the *Cucurbita stenoptera* U6 promoter and U6-1, a CRISPR / Cas9 gene editing vector is constructed. *Agrobacterium*-mediated transformation of *Cucurbita stenoptera* is then used to achieve the editing of the target gene, providing an effective approach for studying the gene function of *Cucurbita stenoptera* and accelerating the breeding of new varieties.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to the U6 promoter of *Cucumis melo* and its application in CRISPR / Cas9 gene editing of *Cucumis melo*. Background Technology

[0002] The wax gourd (Benincasa hispida Cogn. var. Chieh-qua How.) is a variety of winter melon in the Cucurbitaceae family. Because its stems, leaves, and fruit are densely covered with fine hairs, it is also called hairy gourd, hairy wax gourd, or small winter melon. The tender flesh of the wax gourd is smooth, light, crisp, and sweet, and can be used in various dishes, making it an important ingredient in Cantonese cuisine. With the development of production and the upgrading of consumption, the market demand for year-round supply and variety of wax gourds is increasing, and higher requirements are being placed on the heat resistance and disease resistance of varieties. In recent years, with the completion of the wax gourd genome assembly, candidate genes controlling important agronomic traits such as strong female development and heat resistance have been cloned. However, the creation of wax gourd germplasm resources currently mainly relies on traditional methods, and conventional breeding methods are insufficient to create breakthrough materials. Gene-directed editing technology based on CRISPR / Cas9 is an effective means to solve the above problems.

[0003] Genome editing, a crucial aspect of genetic engineering, refers to the technology of inserting, deleting, modifying, or replacing DNA within a living genome. Based on the nucleases used, gene editing systems are primarily categorized into three types: zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR-Cas systems. Compared to ZFNs and TALENs, CRISPR-Cas gene editing systems have become the mainstream gene editing system due to their high efficiency and simplicity. CRISPR-Cas systems can be further divided into two classes based on their effectors: Class 1 (including types I, III, and IV) using multi-subunit complexes as effectors and Class 2 (including types II, V, and VI) using single proteins as effectors. Different types of CRISPR-Cas systems are further subdivided into multiple subtypes. Because both classes use single proteins as effectors, they are relatively simple to operate and therefore more suitable for genome engineering. The CRISPR / Cas9 system is currently the most widely used gene editing system. The editing efficiency of CRISPR / Cas9 is affected by a variety of factors, such as the gene specificity of the target site, the location of the PAM sequence, the nature of the sgRNA sequence, the promoter of the Cas9 gene and sgRNA, the type of target tissue, and the transformation technology used.

[0004] In plants, the CRISPR / Cas9 gene editing system has been widely used for gene editing and the creation of new germplasm resources. For example, in rice, this system has been used to create germplasm resources resistant to bacterial blight, salt tolerance, drought tolerance, and cold tolerance through targeted gene editing, laying a solid foundation for subsequent rice genetic improvement. In maize, by targeted editing of the CLE promoter region, a key factor in the CLAVATA-WUSCHEL pathway, a series of mutants with different CLE expression levels have been obtained, resulting in a range of maize resources with varying yields. In soybeans, the CRISPR / Cas9 system has been used to precisely edit target genes, thereby improving soybean yield, oil content, and disease resistance. In cucurbitaceous crops such as melons, watermelons, and cucumbers, the CRISPR / Cas9 system has been used to edit the coding or non-coding regions of genes such as ERECTA and YABBY1, obtaining genetic materials with different plant types.

[0005] Currently, CRISPR / Cas9 gene editing systems have been successfully established in many cucurbitaceous crops, such as watermelon, cantaloupe, cucumber, loofah, and winter melon. However, research and methods for gene editing in wax gourd have not yet been reported. Furthermore, previous CRISPR / Cas9-mediated gene editing methods in cucurbitaceous plants have all used the U6 promoter (including the 3'-UTR) of Arabidopsis thaliana or tomato. Therefore, developing a CRISPR / Cas9-mediated gene editing method for wax gourd could advance gene editing research in wax gourd, accelerate the understanding of the biological functions of target genes, and provide theoretical evidence for wax gourd variety improvement. Summary of the Invention

[0006] The purpose of this invention is to provide the U6 promoter of wax gourd and its application in CRISPR / Cas9 gene editing of wax gourd, in order to solve the problems existing in the prior art. Considering that the promoter of sgRNA is an important factor affecting the editing efficiency, this invention is a CRISPR / Cas9-mediated gene editing method based on the U6 promoter of wax gourd driving sgRNA expression. This method can promote the progress of gene editing research on wax gourd, accelerate the analysis of the biological function of the target gene, and provide a theoretical basis for the improvement of wax gourd varieties.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] In a first aspect, the present invention provides a Cucurbita U6 promoter, comprising a Cucurbita U6-1 promoter and a Cucurbita U6-2 promoter, wherein the nucleotide sequence of the Cucurbita U6-1 promoter is shown in SEQ ID NO.9 and the nucleotide sequence of the Cucurbita U6-2 promoter is shown in SEQ ID NO.11.

[0009] Secondly, the present invention also provides an sgRNA expression cassette, wherein the sgRNA expression cassette includes the aforementioned Cucurbita U6 promoter.

[0010] Preferably, the sgRNA expression cassette further includes a 3'-UTR corresponding to Cucurbita U6-1; the nucleotide sequence of the 3'-UTR corresponding to Cucurbita U6-1 is shown in SEQ ID NO.10.

[0011] Thirdly, the present invention also provides the application of the aforementioned Cucurbita U6 promoter or the aforementioned sgRNA expression cassette in improving the CRISPR / Cas9 gene editing efficiency of Cucurbita.

[0012] Fourthly, the present invention also provides a CRISPR / Cas9 gene editing vector for *Cucurbita stenoptera*, wherein the promoter in the *Cucurbita stenoptera* CRISPR / Cas9 gene editing vector is either the *Cucurbita stenoptera* U6-1 promoter or the *Cucurbita stenoptera* U6-2 promoter, the nucleotide sequence of the *Cucurbita stenoptera* U6-1 promoter is shown in SEQ ID NO. 9, and the nucleotide sequence of the *Cucurbita stenoptera* U6-2 promoter is shown in SEQ ID NO. 11.

[0013] Preferably, the Cucurbita CRISPR / Cas9 gene editing vector is obtained by replacing the Arabidopsis U6 promoter and 3'-UTR in the initial vector with the Cucurbita U6 promoter and the corresponding 3'-UTR of Cucurbita U6-1.

[0014] Fifthly, the present invention also provides the application of the aforementioned CRISPR / Cas9 gene editing vector in the gene editing of *Cucurbita stenoptera*.

[0015] In a sixth aspect, the present invention also provides a CRISPR / Cas9 gene editing method for winter melon, comprising the following steps:

[0016] The nucleotide sequence of the target gene site was constructed into the CRISPR / Cas9 gene editing vector of the wax gourd to obtain the CRISPR / Cas9 gene editing recombinant vector; the CRISPR / Cas9 gene editing recombinant vector was transformed into Agrobacterium tumefaciens, infected wax gourd, and positive transformed plants were screened to achieve CRISPR / Cas9 gene editing of the target gene in wax gourd.

[0017] Preferably, the target gene is the EBS gene of Cucurbita moschata.

[0018] Preferably, the nucleotide sequence of the coding region of the EBS gene is as shown in SEQ ID NO.5.

[0019] The present invention discloses the following technical effects:

[0020] This invention provides a CRISPR / Cas9 gene editing method based on the expression of sgRNA driven by the U6 promoter of *Cucurbita spp.* The editing efficiency of CRISPR / Cas9 is affected by various factors, such as the gene specificity of the target site, the position of the PAM sequence, the nature of the sgRNA sequence, and the promoters of the Cas9 gene and sgRNA. Among these, the sgRNA promoter directly relates to sgRNA expression and is a crucial factor affecting editing efficiency. Previously, in CRISPR / Cas9 systems established in cucurbitaceous crops, the sgRNA expression cassette promoter was the *Arabidopsis thaliana* U6 promoter. However, considering that this promoter is a foreign sequence, its expression effect is inevitably affected by various conditions, thus impacting the editing effect. This invention addresses this problem by cloning the U6 promoter (including the 3'-UTR) from the *Cucurbita spp.* genome, constructing the corresponding sgRNA expression cassette, fusing it with an existing plant expression vector to obtain a new CRISPR / Cas9 vector, and then using *Agrobacterium*-mediated transgenesis to edit the *Cucurbita spp.* EBS gene. This method constructs a CRISPR / Cas9 gene editing vector and uses Agrobacterium-mediated transformation of wax gourd to edit the target gene, providing an effective approach for studying the gene function of wax gourd and accelerating the breeding of new varieties. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The spectrum of the pCBC-DT1T2 intermediate vector;

[0023] Figure 2 The image shows the pHSE401-Arabidopsis U6 promoter vector.

[0024] Figure 3 To modify the pCBC-DT1T2-cucurbita vector map;

[0025] Figure 4 The image of pHSE401-cucumber carrier;

[0026] Figure 5 The steps for Agrobacterium-mediated genetic transformation of Cucurbita moschata include: A) seed sowing and culture on MS medium; B) germination of seeds; C) cutting off half of the cotyledons on one side of the apical meristem of the seed; D) culture in the dark for 3 days; E) washing with sterile water; F) transfer to differentiation medium; G) growth for 4-6 weeks; H) subculture on differentiation medium; and I) transfer to rooting medium.

[0027] Figure 6 The situation of genetically modified wax gourd materials being grown in greenhouses;

[0028] Figure 7 The diagram shows the EBS gene editing methods for Cucurbita japonica; where A is a schematic diagram of target site design and expected cleavage site, B is a diagram of 4 different types of editing methods, and C is a sequence comparison sequencing peak diagram of different types of editing methods. Detailed Implementation

[0029] The gene sequence of EBS from *Chieh-qua* is identical to that of *Citrus aurantium*, therefore *Citrus aurantium* EBS (ID: Bhi08G000706) was used as the *Chieh-qua* EBS gene for subsequent experiments. The pCBC-DT1T2 intermediate vector and the CRISPR / Cas9 gene editing vector pHSE401 were kindly provided by Professor Chen Qijun's laboratory at China Agricultural University (vector information can be found in the literature "Xing, L., Dong, L., Wang, P., et al., 2014. ACRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC PlantBiol, 14:327."). *Chieh-qua* A36 is a homozygous material screened and isolated by our laboratory. It has advantages such as moderate fruit size, abundant seeds, and consistent germination rate. This variety has been disclosed in the literature "Chromosome-level genome assembly and population genomics reveals crucial selection for subgynoecy development in chieh-qua".

[0030] Example 1: Construction of a gene editing method mediated by the U6 promoter of Cucurbita moschata

[0031] 1. Construction of the gene-editing vector for Cucurbita moschata

[0032] (1) Modification of pCBC-DT1T2 and pHSE401 vectors

[0033] Since the expression cassettes of sgRNA driven by the pCBC-DT1T2 and pHSE401 vectors are driven by the Arabidopsis U6 promoter, and the corresponding 3'-UTR serves as the transcription termination signal, Figure 1 and Figure 2 This invention utilizes the artificially synthesized target sequence of Cucurbita U6 followed by Infusion technology to obtain the target vector. Specifically, it includes the following steps:

[0034] ① Two U6 sequences were obtained from the genome of *Cucurbita spp.*, located on chromosomes 8 and 3 respectively, and named U6-1 and U6-2. The nucleotide sequence of the U6-1 genome is shown in SEQ ID NO.1, the nucleotide sequence of the U6-2 genome is shown in SEQ ID NO.2, the nucleotide sequence of the U6-1 promoter is shown in SEQ ID NO.9, the nucleotide sequence of the 3'-UTR (U6-1-Ter) of U6-1 is shown in SEQ ID NO.10, and the nucleotide sequence of the U6-2 promoter is shown in SEQ ID NO.11. Based on the pCBC-DT1T2 and pHSE401 vector backbone, the *Arabidopsis thaliana* U6 promoter on the vector was replaced with the *Cucurbita spp.* U6 promoter, and the 3'-UTR of *Cucurbita spp.* U6-1 was used as a termination signal. These two sequences were artificially synthesized (by Beijing Qingke Biotechnology Co., Ltd.), and their nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0035] ② The pCBC-DT1T2 vector was digested with Nco I and Sal I to remove the gRNA scaffold and Arabidopsis U6-29 promoter; the pHSE401 vector was digested with Hind III to remove the Arabidopsis U6-26 promoter, SmR gene, gRNA scaffold and the 3'-UTR (AtU6-26 Ter) of Arabidopsis U6-26, and the larger fragments were recovered to obtain the linearized vector backbone.

[0036] Using artificially synthesized sequences SEQ ID NO.3 and SEQ ID NO.4 as templates, PCR amplification was performed using primers F1: attgccatggcggttctcgttttagagctagaaatagcaa (SEQ ID NO.12), R1: ccattgtataactttgccGAAGAGACGGACGTTAGTTGC (SEQ ID NO.13), F2: acggccagtgccaagcttGTATAAATTAAGCATGTCAAT (SEQ ID NO.14), and R2: ctgcaggcatgcaagcttTTCGTATTGGATTTTCATCAT (SEQ ID NO.15). The PCR products were recovered and ligated to the aforementioned enzyme-digested vectors using infusion technology. These ligations were then transformed into *E. coli*, and the resulting *E. coli* pCBC-DT1T2 vector was obtained after PCR identification and sequencing. Figure 3 ) and the pHSE401 carrier of wax gourd ( Figure 4 ).

[0037] (2) Design of target sites for the target gene

[0038] ① Determine the target site region of the target gene (EBS gene of winter melon). The nucleotide sequence of the coding region of the EBS gene is shown in SEQ ID NO.5.

[0039] ② Target sites were designed using the Cas-Designer online software (http: / / www.rgenome.net / cas-designer / ). The PAM Type was set to SpCas9 from Streptococcus pyogenes: 5'-NGG-3'; the Organization Type was set to Plants; and the Genomes were set to Benincasa hispida. The target sequence was entered in the Target Sequence field, and the crRNA length was set to 19. Based on the output results, two target sites were selected with moderate GC content (around 50-60%), high predicted cleavage efficiency (>50%), and no mismatches (Mismatches were 1, 0, 0). The final selected EBS gene target site sequences are as follows: EBS-Target 1: TCAGAGGCACCAACAAGGT (SEQ ID NO.16); EBS-Target 2: GAGTGCTCACACCATTGAA (SEQ ID NO.17). Off-target analysis was performed using the Cas-OFFinder online tool to confirm that the selected target sites would not cause off-target effects.

[0040] (3) Cloning of expression vectors containing target gene sites

[0041] ① Using the modified pCBC-DT1T2 wax gourd as a template, PCR amplification was performed using four primers. -BsF / -BsR were the normal primer concentrations; -F0 / -R0 were 20-fold dilutions. The reaction system and reaction conditions are shown in Table 1.

[0042] Table 1. PCR reaction system and reaction conditions

[0043]

[0044]

[0045] A PCR product of 1144 bp (SEQ ID NO. 6) containing the EBS gene target site was obtained. Primer sequences are as follows:

[0046] DT1-BsF: ATATATGGTCTCGATTGGAGTGCTCACACCATTGAAGTT (SEQ ID NO. 18);

[0047] DT2-BsR:ATTATTGGTCTCGAAACACCTTGTTGGTGCCTCTGAC (SEQ ID NO. 19);

[0048] DT1-F0: TGGAGTGCTCACACCATTGAAGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 20);

[0049] DT2-R0: AACACCTTGTTGGTGCCTCTGACAATCTCTTAGTCGACTCTAC (SEQ ID NO. 21);

[0050] ② The PCR product was purified and recovered, and the recombinant vector was obtained by ligation using the enzyme digestion-ligation system shown in Table 2.

[0051] Table 2 Enzyme digestion and ligation system

[0052]

[0053] Connection conditions: 37℃, 3 min; 16℃, 5 min; after 32 cycles, 85℃, 5 min.

[0054] ③ Transform 5 μL of the sample into competent E. coli cells and screen using Kans plates. PCR identification was performed using U6-1-IDF and U6-2-IDR primers. Positive clones were identified as the constructed *Cucumis melo* CRISPR / Cas9 vector containing the EBS dual-target gene, named EBS-pHSE401. The complete expression cassette sequence containing the dual-target gene is shown in SEQ ID NO.7. The PCR primer sequences are as follows:

[0055] U6-1-IDF: GTGGTAAATTATGGATACATCT (SEQ ID NO. 22);

[0056] U6-2-IDR: CCTAATGCAGGAATTCGAGCT (SEQ ID NO. 23);

[0057] 2. Methods of genetically modifying wax gourd

[0058] (1) EHA105 Agrobacterium tumefaciens was transformed into EBS-pHSE401 vector from Cucurbita moschata.

[0059] The constructed EBS-pHSE401 vector was transformed into EHA105 Agrobacterium competent cells using a freeze-thaw method. The bacterial culture was then spread on LB agar plates containing rifampicin (50 mg / L) and kanamycin (50 mg / L) and cultured at 28°C to obtain Agrobacterium culture containing the EBS-pHSE401 vector. An equal volume of 0.5 times the volume of 70% glycerol was then added, mixed well, and stored at -80°C for later use.

[0060] (2) Agrobacterium-mediated transgenic cucurbita

[0061] ① Seed disinfection and sowing: Plump A36 wax gourd seeds were soaked in 55℃ warm water for 15 minutes, then soaked at room temperature for 5 hours, and then the seed coat was removed. The seeds were then soaked in a 3% NaClO solution for 8 minutes in a clean bench, continuously agitated, and rinsed 5 times with sterile water. Afterwards, the seeds were transferred to sterile filter paper to absorb excess moisture, and then sown onto MS medium using sterile forceps. Figure 5 (A) was cultured in the dark at 28°C.

[0062] ② Explant acquisition and infection: Seeds that have germinated after 3-5 days of culture ( Figure 5 (B) Place the seed on filter paper moistened with infection medium, cut off half of the cotyledon from the side closest to the apical meristem, and use the U-shaped end as the explant. Figure 5 (C) Preheat Agrobacterium containing the EBS-pHSE401 plasmid to OD. 600 =0.6-0.8, after centrifugation at room temperature to collect bacteria, adjust to OD using infection medium. 600 Use approximately 0.2-0.3 g / mL as the infection solution. First, brush the U-shaped opening of the explant with a nanobrush, then transfer it to a 20 mL syringe. Add 10 mL of Agrobacterium suspension, expel excess air, and seal the syringe with a rubber cap. Pull the plunger from 10 mL to 20 mL, and infect the cotyledon explant under vacuum for 3 minutes, shaking the syringe during this time. Then, slowly push the plunger back to 10 mL.

[0063] ③ Co-culture: After drying the treated explants with sterile filter paper to remove Agrobacterium, transfer them to a co-culture medium. Figure 5 (C), cultured at 28℃ in the dark for 3 days (C). Figure 5 (D).

[0064] ④ Adventitious bud regeneration: Rinse the co-cultured explants 3-4 times with sterile water, transfer them to sterile filter paper to absorb the moisture, and then transfer them to differentiation medium. Figure 5 (EF) were grown at 28℃ under 16h light / 8h dark conditions for 4-6 weeks. After about 3 weeks of culture, the explants were transferred to a new differentiation medium for subculture. Figure 5 (middle GH).

[0065] ⑤ Rooting of regenerated buds: Cut off the regenerated buds and transfer them to a rooting medium. Figure 5 Cultivate in (I) medium.

[0066] ⑥ Acclimatization and Transplanting: After the plant's root system has developed well, loosen the mouth of the tissue culture bottle and harden the seedlings for one week. Then, remove the plant from the culture medium, wash away the culture medium near the roots, and transplant it into a flowerpot filled with substrate (peat nutrient soil and vermiculite in a 3:1 volume ratio). Cover with a transparent cover to prevent water loss and wilting, and acclimatize under low light conditions for a few days. After the plant grows new leaves, transplant it to a greenhouse for normal growth and development. Figure 6 The culture medium formulations mentioned above are shown in Table 3.

[0067] Table 3 Different culture medium formulations

[0068]

[0069] 3. Identification of gene editing in the order Cucurbita.

[0070] (1) Cloning and sequencing of the target gene fragment

[0071] ① DNA was extracted from leaves of wild-type wax gourd and successfully transformed wax gourd. This DNA was then used as a template for PCR amplification using primers EBS-ID-F and EBS-ID-R to obtain a 751 bp genomic fragment (SEQ ID NO. 8) containing two target sites. The primer sequences are as follows:

[0072] EBS-ID-F:CGAGCTCCAGCTAGGGTTTC (SEQ ID NO. 24);

[0073] EBS-ID-R: GCAATAGCTGCAAGGAAATGG (SEQ ID NO. 25).

[0074] ②After amplification, take 5μL of the PCR stock solution and perform electrophoresis on a 1.2% agarose gel. Send the remaining stock solution to a sequencing company for sequencing.

[0075] (2) Analysis of gene editing methods

[0076] Sequencing results of the EBS gene in wild-type and successfully transformed leaves were compared, and four different types of EBS gene editing methods were identified in the successfully transformed leaves. Figure 7(AB). The first editing method involves a 2-base deletion at target site 1 and a 4-base deletion at target site 2; the second editing method involves a 6-base deletion at target site 1 and a 1-base insertion at target site 2; the third editing method involves a 342bp deletion between target sites 1 and 2; the fourth editing method involves a 3-base deletion at target site 1 and a 4-base deletion at target site 2. Figure 7 (C)

[0077] In summary, the gene-editing vector constructed in this invention has proven effective in winter melon, successfully editing the target gene and thus establishing a practical CRISPR / Cas9-mediated gene-editing method for winter melon.

[0078] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A U6-1 promoter for *Gnaphalium affine*, characterized in that, The nucleotide sequence of the U6-1 promoter of *Cucumis melo* is shown in SEQ ID NO.

9.

2. An sgRNA expression cassette, characterized in that, The sgRNA expression cassette includes the Cucurbita U6-1 promoter as described in claim 1.

3. The sgRNA expression cassette according to claim 2, characterized in that, The sgRNA expression cassette also includes the 3'-UTR corresponding to Cucurbita U6-1; the nucleotide sequence of the 3'-UTR corresponding to Cucurbita U6-1 is shown in SEQ ID NO.

10.

4. The application of the Cucurbita U6-1 promoter as described in claim 1 or the sgRNA expression cassette as described in any one of claims 2-3 in improving the CRISPR / Cas9 gene editing efficiency of Cucurbita.

5. A CRISPR / Cas9 gene editing vector for winter melon, characterized in that, The promoter in the CRISPR / Cas9 gene editing vector of *Cucumis melo* is the *Cucumis melo* U6-1 promoter, and the nucleotide sequence of the *Cucumis melo* U6-1 promoter is shown in SEQ ID NO.

9.

6. The CRISPR / Cas9 gene editing vector for *Cucumis melo* according to claim 5, characterized in that, The Cucurbita CRISPR / Cas9 gene editing vector was obtained by replacing the Arabidopsis U6 promoter and 3'-UTR in the initial vector pCBC-DT1T2 with the Cucurbita U6-1 promoter as described in claim 1 and the corresponding 3'-UTR of Cucurbita U6-1 as described in claim 3.

7. The application of the CRISPR / Cas9 gene editing vector of *Cucurbita moschata* as described in any one of claims 5-6 in gene editing of *Cucurbita moschata*.

8. A CRISPR / Cas9 gene editing method for wax gourd, characterized in that, Includes the following steps: The nucleotide sequence of the target gene site is constructed into the CRISPR / Cas9 gene editing vector of wax gourd as described in any one of claims 5-6 to obtain the CRISPR / Cas9 gene editing recombinant vector; the CRISPR / Cas9 gene editing recombinant vector is transformed into Agrobacterium, which infects wax gourd, and positive transformed plants are screened to achieve CRISPR / Cas9 gene editing of the target gene of wax gourd; The target gene is *Cucumis melo*. EBS Gene; The EBS The nucleotide sequence of the gene coding region is shown in SEQ ID NO.5.

Images