Porcine epidemic diarrhea virus attenuated strain and vaccine and application thereof

Abstract

The invention relates to the field of veterinary biological products, in particular to a porcine epidemic diarrhea virus attenuated strain and a vaccine and application thereof. The porcine epidemic diarrhea virus attenuated strain provided by the invention is obtained through in-vitro separation culture and continuous five rounds of plaque purification and screening technology, and has stable culture characteristics. Meanwhile, the virulence of the strain on newborn piglets and weaned piglets is remarkably reduced, and the virulence does not have the phenomenon of reversion after continuous passage for five times in a pig body. The strain has good immunogenicity, and mucosal immunity and systemic immune response of an organism can be activated at the same time by adopting an oral immunization mode. A neutralizing antibody of 1: 8-1: 16 can be detected in oral fluid and serum after the piglets are immunized for 14 days, and a large amount of sIgA is generated in milk after the pregnant sows are immunized, so that the piglets obtain effective passive immune protection.

Description

Technical Field

[0001] This invention relates to the field of veterinary biological products, specifically to a weakened strain of porcine epidemic diarrhea virus, its vaccine, and its applications. Background Technology

[0002] Porcine epidemic diarrhea (PED) is an acute, highly contagious gastrointestinal disease caused by the porcine epidemic diarrhea virus (PEDV). Infected piglets mainly exhibit severe vomiting, diarrhea, depression, and decreased appetite, eventually dying from emaciation and severe dehydration.

[0003] In recent years, the genetic mutations of porcine epidemic diarrhea virus (PEDV) have become complex and rapid, leading to changes in its pathogenicity, histotropy, and antigenicity, posing challenges to the effectiveness of existing vaccines. However, despite widespread vaccination in most pig farms since 2020, studies have reported PEDV outbreaks, detecting the new subtype G2c strain. In 2025, the predominant clinically circulating strain was G2c (71.71%), a further increase compared to November 2024 (51.22%) and December 2024 (56.10%). This was followed by the S-indel strain (21.71%), while the proportions of G2b (3.95%) and G2a (1.31%) decreased. These studies indicate that the incidence of G2c strains has increased in recent years, and existing vaccines may not be effective in preventing G2c PEDV infection.

[0004] The prevention and control of porcine epidemic diarrhea (PEDV) relies primarily on vaccination, as there is currently no specific drug treatment for the disease. Piglets under 10 days old are most susceptible to PEDV, but their immune systems are not yet fully developed, making active immunization with vaccines ineffective. Therefore, piglets receive passive immune protection from maternal antibodies, particularly sIgA, obtained from the colostrum of immunized sows, which is currently recognized as the most important protective antibody. Traditional inactivated and live attenuated vaccines used clinically have low homology with recent epidemic variants, failing to provide effective cross-protection. Furthermore, they are mostly administered via injection, which cannot effectively activate the mucosal immune system to provide protective sIgA to piglets. Clinical practice shows that feeding PEDV-contaminated feed to pregnant sows can effectively control losses in pig farms during PEDV outbreaks. However, developing oral live attenuated vaccines presents technical challenges. Screening for attenuated strains with moderate virulence and overcoming the technical difficulties of easy degradation and inactivation in the sow's digestive system are particularly important. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a naturally occurring attenuated strain of porcine epidemic diarrhea virus (PEDV). This strain was isolated and cultured from intestinal samples of piglets infected with PEDV in a large-scale pig farm in Jilin Province. After five rounds of plaque purification and screening, it was named PEDV JLSY2023 F5, classified as porcine epidemic diarrhea virus. It was deposited on June 19, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 46471. The deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] The porcine epidemic diarrhea virus (PEDV) was sequenced using Illumina Novaseq metatranscriptome sequencing. The sequencing results have been uploaded to the GenBank database with accession number PV533621. The nucleotide sequence of the S (Spike) gene encoding the viral spike protein is shown in SEQ ID NO: 1. Genetic evolution analysis based on the deduced amino acid sequence of the S gene indicates that this strain belongs to the G2c subtype, which is a subtype of PEDV that has been increasingly prevalent in pig farms in my country in recent years. The nucleotide sequence of the ORF3 gene is shown in SEQ ID NO: 2. Comparison with strains AJ1102 (JX188454.1) and CV777 (AF353511.1) revealed a 101-base deletion between bases 200 and 300.

[0007] The present invention also provides a vaccine containing the porcine epidemic diarrhea virus strain described above.

[0008] Furthermore, the vaccine for the porcine epidemic diarrhea virus strain is an oral live vaccine.

[0009] Furthermore, the oral live vaccine comprises the porcine epidemic diarrhea virus antigen stock solution and a vaccine protectant.

[0010] Furthermore, the volume ratio of the vaccine protectant to the porcine epidemic diarrhea virus antigen stock solution is 5:1 to 15:1.

[0011] Preferably, the volume ratio of the vaccine protectant to the porcine epidemic diarrhea virus antigen stock solution is 10:1.

[0012] The present invention also provides the use of the porcine epidemic diarrhea virus strain in the preparation of a drug for the prevention of porcine epidemic diarrhea.

[0013] Specifically, the drug used to prevent swine epidemic diarrhea is a swine epidemic diarrhea vaccine.

[0014] Compared with the prior art, the present invention has the following advantages:

[0015] The virus strain of this invention was continuously back-transmitted to PEDV antigen-antibody-negative newborn piglets for 5 generations, and showed good stability. Low-dose virus shedding could be detected in anal swabs of piglets, but no obvious symptoms such as diarrhea and vomiting were observed, indicating that it has the potential to be developed into a live attenuated vaccine.

[0016] The attenuated strain of this invention, when prepared into an oral vaccine, can detect neutralizing antibodies and sIgA antibodies in both weaned piglets and pregnant sows, providing effective passive immune protection for piglets.

[0017] The attenuated strain of this invention has a wide range of applications. It can be used not only to prepare live or inactivated single or combined vaccines, but also to develop diagnostic products for porcine epidemic diarrhea and drugs against porcine epidemic diarrhea virus.

[0018] The attenuated strain of this invention is a natural attenuated strain isolated and purified from nature. After five rounds of plaque purification, it exhibits good stability, high safety, and strong immunogenicity in vitro.

[0019] The attenuated oral vaccine for porcine epidemic diarrhea prepared in this invention uses a protective agent with good safety profile. It can encapsulate the antigen into microspheres, effectively preventing the antigen from being inactivated or degraded by gastric acid and digestive enzymes. After entering the small intestine, it can slowly release the antigen, generating continuous immune stimulation and effectively activating mucosal immunity. This has important value for the prevention and control of porcine epidemic diarrhea and for in-depth research. Attached Figure Description

[0020] Figure 1 For the genetic evolution analysis based on amino acid deduction from the PEDV S gene, PEDV2023005, marked in the box, is strain JLSY2023.

[0021] Figure 2 The results of ORF3 gene sequence alignment analysis are shown, with PEDV2023005 marked in the box being strain JLSY2023.

[0022] Figure 3 Photographs of Vero cells infected with PEDV (10×10x magnification), where A: infected lesions, cells fused into syncytia; B: normal cell control.

[0023] Figure 4 Indirect immunofluorescence identification images, where A: PEDV JLSY 2023 infection of Vero cells; B: Cell control;

[0024] Figure 5 Results of the study on the genetic stability of the ORF3 gene. Detailed Implementation

[0025] The present invention will now be described in detail with reference to the accompanying drawings and embodiments. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that this attenuated strain can be obtained through genetic engineering methods, and modifications or substitutions can be made to the details and form of the technical solution of the present invention without departing from the spirit and scope thereof; however, all such modifications and substitutions fall within the protection scope of the present invention.

[0026] Example 1

[0027] 1. Isolation of the virus strain: Intestinal tissue was collected from piglets suspected of having viral diarrhea in a pig farm in Songyuan City, Jilin Province. Physiological saline was added at a mass-to-volume ratio of 1:5, and the mixture was homogenized. The homogenate was subjected to three freeze-thaw cycles and centrifuged at 8000 rpm for 20 min. The supernatant was collected, filtered first through a 0.45 μm filter, then through a 0.22 μm filter for sterilization. 2% penicillin-streptomycin mixed solution was added. The resulting pathological treatment solution was aliquoted and stored at -80℃ for later use. Vero cells were inoculated with the pathological treatment solution. Before inoculation, the cells were washed twice with 0.01 mol / L sterile PBS. Cells were inoculated at 10% and 20% volume ratios, and 1 / 2 working volume of maintenance medium (containing 10 μg / ml trypsin in serum-free DMEM) was added. After mixing, the cells were incubated at 37℃ in a 5% CO2 incubator for 2 hours for adsorption. The pathological material was not discarded; maintenance medium was added to the working volume, and the cells were mixed and cultured continuously. Continuous observation continued until lesions appeared (see...). Figure 3 When the lesion degree reaches 80%, the cell culture is harvested. After repeated freeze-thaw cycles at -80℃ and room temperature three times, the supernatant is collected by centrifugation at 8000 rpm and 4℃ for 10 min. This is used as the P1 generation seed. After culturing to P3 using the above method, plaque purification experiments are performed. Plaques with a suitable diameter are selected for purification. Then, five rounds of plaque purification are performed to obtain six monoclonal strains. The six monoclonal strains are inoculated into Vero cells for culture, and their titers are compared. The S gene and ORF3 gene are sequenced separately. Finally, the clone strain with a high titer and no mutations in the S gene and ORF3 gene is selected for preservation.

[0028] 2. Neutralization test: The virus with a calibrated viral titer was diluted to 2000 TCID using serum-free DMEM containing 10 μg / ml trypsin. 50 / ml, take 1ml of diluted virus solution and mix it with an equal volume of PEDV positive serum, TGEV positive serum, PDCoV positive serum, PoRV positive serum, serum-free DMEM, and commercial negative swine serum, respectively, and incubate at 37℃ for 1 hour. At the same time, set up controls for each serum with the same treatment. Vero cells were cultured into a dense monolayer using 24-well cell culture plates. The cells were washed twice with 0.01 mol / L sterile PBS and inoculated sequentially with six different inoculum solutions, four replicates of each solution, 0.25 ml per well. Four wells were included as normal cell controls. The culture plates were incubated at 37°C in a 5% CO2 incubator for 2 hours to allow the inoculum to absorb. The inoculum was then discarded, and the cells were washed twice with PBS. Serum-free DMEM containing 10 μg / ml trypsin was added to each well, and the plates were incubated at 37°C in a 5% CO2 incubator for 120 hours. Daily observations were performed. The results showed significant lesions in the virus control wells, TGEV-positive serum neutralization wells, PDCoV-positive serum neutralization wells, PoRV-positive serum neutralization wells, and negative porcine serum neutralization wells. No lesions were observed in the healthy cell controls or PEDV-positive serum neutralization wells. This indicates that the strain of this invention is a porcine epidemic diarrhea virus that can be specifically neutralized by PEDV-positive serum.

[0029] 3. Indirect Immunofluorescence Detection: Vero cells were cultured into a monolayer in 96-well plates and then inoculated with third-generation PEDV JLSY2023 strain virus culture. A negative control (uninoculated Vero cells) and a positive control (inoculated with CV777 strain) were also established. After 24 hours of culture, cytopathic effects were observed under a microscope. The culture medium was gently aspirated, and the cells were washed twice with pre-chilled PBS (4°C). 100 μl of pre-chilled 80% acetone solution (-20°C) was added to each well, and the plate was fixed at 4°C for 15 min. The cells were washed three times with PBS for 5 min each time. 100 μl of 1% BSA solution was added to each well for blocking for 30 min. The blocking solution was discarded, and the cells were gently washed twice with PBS for 3 min each time. 50 μl of appropriately diluted primary antibody (mouse anti-PEDV-S monoclonal antibody (5B2)) was added to each well, and the plate was incubated at 37°C for 1 h. Wash three times with PBS, 5 min each time; add FITC (fluorescein isothiocyanate)-labeled goat anti-mouse IgG secondary antibody (1:2000), incubate at 37℃ for 30 min, wash three times with PBS, 5 min each time. Add 100 μl PBS to each well, observe and photograph under an inverted fluorescence microscope. Negative controls were set up during the experiment, with only primary antibody added and only secondary antibody added. Results showed that the negative control wells showed no fluorescence; the positive control wells and the wells inoculated with PEDV JLSY 2023 strain showed green fluorescence in the cytoplasm. Further confirmation that the isolated virus was porcine epidemic diarrhea virus is shown in the following results. Figure 4 .

[0030] Example 2

[0031] Sequencing analysis

[0032] Total RNA was extracted from the isolated pathogen culture and sent to Qingke Biotechnology for Illumina NovaSeq metatranscriptome sequencing. Sequencing results showed that the pathogen was PEDV, and the genome sequence was uploaded to the GenBank database with accession number PV533621. The nucleotide sequence encoding the viral spike protein S (Spike) gene is shown in SEQ ID NO: 1. Genetic evolution analysis based on the deduced amino acid sequence of the S gene indicated that this strain belongs to the G2c subtype (analysis results are shown in...). Figure 1 This is a subtype of PEDV that has been increasingly prevalent in domestic pig farms in recent years. The nucleotide sequence of the ORF3 gene is shown in SEQ ID NO: 2. Comparison with strains AJ1102 (JX188454.1) and CV777 (AF353511.1) revealed a 101-base deletion between bases 200 and 300. The ORF3 gene alignment results are shown below. Figure 2 .

[0033] The isolated and purified strain was named PEDV JLSY2023 F5, classified as Porcine epidemic diarrhea virus, and deposited on June 19, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 46471. The depository address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0034] Example 3

[0035] Pathogenicity test

[0036] 1. Challenge: Select 15 PEDV antigen-antibody-negative piglets aged 3-5 days, and whose pathogen screening results showed negative for PoRV, TGEV, PDCoV, PRV, CSFV, PRRSV, and ASFV. Randomly divide the piglets into 3 groups of 5 piglets each. The first group received 5 ml of a solution containing 10... 7 TCID 50 Viral fluid, Group 2, 5ml orally, containing 10 6 TCID 50 The third group was orally fed 5 ml of DMEM culture medium and kept under the same conditions in different rooms in the challenge area.

[0037] 2. Clinical Symptom Observation and Detection: Observe the clinical symptoms of piglets daily after challenge. If the challenged piglets die, perform an immediate necropsy and observe the pathological changes in their organs and tissues; if the challenged piglets do not die, cull them 7 days after challenge, collect their small intestine and its contents, process the material according to the method in Example 1, extract viral RNA, and perform RT-PCR detection. At the same time, isolate the pathogen according to the same method in Example 1 and observe cytopathic effects.

[0038] 3. Experimental Results: In the first group, only one piglet developed transient diarrhea, while the remaining piglets did not exhibit obvious symptoms such as diarrhea, vomiting, dehydration, or poor appetite. RT-PCR testing of the piglets' intestines and contents showed that the piglets in the first and second groups were PEDV positive after challenge, while the control piglets in the third group were PEDV negative, indicating that the virus can colonize the piglets after oral challenge. The results are shown in Table 1.

[0039] Table 1. Pathogenicity test results of PEDV / JLSY / 2023 strain

[0040] Group Piglet age Number of piglets Infectious drug dosage Incidence rate mortality rate RT-PCR positive rate A group 3～5 5 <![CDATA[10 7 TCID 50 / 5ml]]> 20％(1 / 5) 0％(0 / 5) 100％(5 / 5) Group Two 3～5 5 <![CDATA[10 6 TCID 50 / 5ml]]> 0％(0 / 5) 0％(0 / 5) 100％(5 / 5) Group 3 3～5 5 DMEM 5ml 0％(0 / 5) 0％(0 / 5) 0％(0 / 5)

[0041] Example 4

[0042] Safety testing of the strain

[0043] 1. Investigation of the genetic stability of the strain

[0044] The strain purified by cloning in Example 1 after 5 rounds was designated as generation P8. It was then continuously passaged in vitro to generation P28. RNA was extracted every 5 generations for RT-PCR and sequencing. The primer sequences for ORF3 gene sequencing are as follows:

[0045] Upstream primer: 5'-TCCTAGACTTCAACCTTACGAA-3'

[0046] Downstream primer: 5'-CTAGACCATTATCATTCACT-3'

[0047] Sequencing results were compared with the P8 generation sequence, showing that no gene mutation occurred in the ORF3 gene after 20 generations of in vitro propagation, indicating that the attenuated strain of this invention has good genetic stability. (See attached figures.) Figure 5 .

[0048] 2. Virulence reversion test

[0049] Twenty 3-day-old piglets that were negative for both PEDV antigen and antibody were selected. The P9 and P28 virus cultures prepared in Example 1 were orally inoculated into groups 1 and 2, respectively, with 2 piglets in each group. The dosage was 2 ml (containing 10...). 6.5 TCID 50Piglets were euthanized 72 hours after inoculation, and their gastrointestinal tissues were examined and recorded for any abnormalities. Small intestinal tissues from two piglets in each group were homogenized to prepare tissue filtrate (a mixture of individual inoculum). Two ml of the small intestinal tissue filtrate from groups 1 and 2 was orally inoculated into 3-day-old piglets in groups 3 and 4, respectively. These piglets were euthanized 72 hours after challenge. The same method was used to observe and inoculate piglets in groups 5 and 6, and so on, for a total of 5 generations.

[0050] Experimental results: P9 and P28 generation virus cultures were passaged for 5 generations in 3-day-old piglets. No obvious mucosal shedding or congestion was found in the gastrointestinal tract of the piglets during necropsy, which preliminarily indicates that the strain did not show virulence reversion.

[0051] 3. Safety trials in pregnant sows (overdose immunization)

[0052] 3.1 Vaccination: Ten healthy pregnant sows, 4-6 weeks before farrowing, with negative PEDV antigen and antibody tests, were selected and divided into two groups of five sows each. One group received an intramuscular injection of 3.2 ml (virus content 10) of PEDV JLSY2023 P9 generation virus culture per sow. 6.5 TCID 50 / ml), that is, 10 doses / head. Another group included 5 negative control sows, each of which was injected intramuscularly with 3.2ml of serum-free DMEM.

[0053] 3.2 Clinical observation: After vaccination, observe the mental state, feed intake, body temperature, local reaction at the injection site and other clinical manifestations (vomiting, diarrhea, etc.) of each pig, and record their farrowing situation and whether there are any abnormalities such as abortion or stillbirth.

[0054] 3.3 Experimental Results: No obvious abnormal reactions were observed in sows in either the experimental or control groups, indicating that overdose immunization of pregnant sows with this strain is safe. The results are summarized in Table 2.

[0055] Table 2. Safety trial results of PEDV / JLSY / 2023 immunized pregnant sows.

[0056] Group Number of sows Inoculation dosage abnormal body temperature Local inflammation Foraging mental state diarrhea symptoms Miscarriage P9 5 <![CDATA[10 7 TCID 50 3.2ml / head 0 / 5 0 / 5 5 / 5 normal 5 / 5 normal 0 / 5 0 / 5 Comparison 5 DMEM 3.2ml / head 0 / 5 0 / 5 5 / 5 normal 5 / 5 normal 0 / 5 0 / 5

[0057] Example 5

[0058] Preparation of oral attenuated live vaccine

[0059] 1. Antigen Preparation: Vero cells were cultured to a monolayer in cell culture medium (DMEM containing 10% FBS and 1% penicillin-streptomycin). Cells were washed twice with sterile 1×PBS, and an appropriate amount of serum-free DMEM was added. PEDV virus solution was seeded onto Vero cells at a MOI of 0.05–0.1, and trypsin was added to the DMEM to a final concentration of 3–5 μg / mL to form an adsorption solution. Adsorption was carried out at 37°C and 5% CO2 for 1.5 h. After adsorption, the adsorption solution was discarded, and serum-free DMEM containing 5–10 μg / mL trypsin was added as a maintenance solution. The cells were cultured in a cell culture incubator at 37°C and 5% CO2. After continuous culture for 48–72 h until cytopathic effects reached 80%, the cell culture was harvested and placed in a -80°C freezer, subjected to three freeze-thaw cycles, and the supernatant was collected by centrifugation.

[0060] 2. Preparation of vaccine protective agent: Dissolve 7.5-8.5 g of sodium chloride, 0.1-0.3 g of potassium chloride, 1.3-1.5 g of disodium hydrogen phosphate, 0.2-0.3 g of potassium dihydrogen phosphate, 5-10 g of D-trehalose, 1.5-3 g of sodium alginate, 1.5-3 g of chitosan, and 3-5 g of carboxymethyl cellulose in 800 ml of water for injection, adjust the pH to 6.5-7.5, bring the volume to 1000 ml, and autoclave at 116°C for 20 minutes to obtain the vaccine protective agent.

[0061] 3. Preparation of oral attenuated live vaccine: Preferably, the volume ratio of the vaccine protectant to the antigen stock solution is 5:1 to 15:1, and more preferably, the ratio is 10:1. The antigen is slowly added dropwise to the stirred vaccine protectant and mixed thoroughly to obtain the final vaccine. Each dose contains 10 mg of antigen. 6.0 TCID 50 .

[0062] 4. Vaccine quality inspection: The vaccine shall be tested for sterility, mycoplasma-free, mold-free, and exogenous virus-free in accordance with the appendix of the current Veterinary Pharmacopoeia, and the virus content shall be determined. All of these shall meet the requirements.

[0063] Example 6

[0064] Immunogenicity test of oral attenuated live vaccine

[0065] 1. Active immunization efficacy test

[0066] 1.1 Experimental Protocol: Ten healthy, 21-day-old PEDV antibody-negative weaned piglets were selected and randomly divided into two groups. One group was orally immunized with a PEDV JLSY2023 attenuated live vaccine (prepared in Example 5), 1 ml / pig; the other group of five piglets served as a negative control, each receiving 1 ml of DMEM orally. After 21 days of feeding under the same conditions, serum was collected on days 0, 7, 14, and 21 post-immunization, along with oral fluid for antibody detection. On day 21 post-immunization, piglets were challenged with the virulent PEDV strain BJ23. 7 TCID 50 Each piglet was observed for 10 days after the viral challenge, and the incidence of disease was recorded. Anal swabs were collected daily for viral shedding detection.

[0067] 1.2 Experimental Results: Neutralizing antibodies in the serum and sIgA antibodies in the oral saliva of immunized piglets were detectable 14 days after oral administration of the attenuated live vaccine. Antibody levels in piglets further increased 21 days post-immunization, with an average serum neutralizing antibody titer of 1:32. No obvious diarrhea symptoms were observed in immunized piglets after viral challenge; 4 / 5 of anal swab tests were negative for viral shedding, with only one pig showing low-level viral shedding. In the unimmunized control group, PEDV antibodies remained negative from day 0 to 21. Low-level viral shedding was detected 1 day after challenge, and high-dose viral shedding continued from day 2 to 6 post-challenge. 5 / 5 of the piglets exhibited watery stools, soft stools, anorexia, and emaciation; two of these piglets died 8 days post-challenge. Specific results are shown in Tables 3, 4, and 5.

[0068] Table 3. Results of serum neutralizing antibody detection in PEDV JLSY 2023 immunized weaned piglets.

[0069]

[0070] Table 4. Results of sIgA antibody detection in oral fluid of PEDV JLSY 2023 immunized weaned piglets.

[0071]

[0072] Table 5 Results of PEDV JLSY 2023 Active Immune Challenge Trial

[0073] Group Number of piglets Infectious drug dosage Incidence rate mortality rate Protection rate Immunogroup 5 <![CDATA[10 7 TCID 50 ]]> 0 / 5 0％ 100％ Comparison 5 <![CDATA[10 7 TCID 50 ]]> 5 / 5 40％ /

[0074] 2. Passive immunization efficacy test

[0075] 2.1 Experimental Protocol: Six healthy PEDV-negative sows at approximately 8 weeks of gestation were selected and randomly divided into two groups. Under identical feeding conditions, three sows in group A were orally immunized with a live attenuated PEDV JLSY2023 vaccine (2 ml / sow). Three sows in group B served as a negative control, orally administering 2 ml of DMEM. A second immunization was administered 28 days after the initial vaccination. Serum was collected on days 0, 28, and 49 after the initial vaccination, and milk was also collected from the first three days postpartum for antibody detection. When piglets were 5 days old, 10 piglets of similar weight from each group (A and B) were challenged with the virulent PEDV strain BJ23. 4 TCID 50 Each piglet was observed for 10 days after the viral challenge, and the incidence of disease was recorded. Anal swabs were collected daily for viral shedding detection.

[0076] 2.2 Experimental Results: Neutralizing antibodies were detectable in the serum of immunized sows 28 days after oral administration of the attenuated live vaccine. Antibody levels further increased 49 days post-immunization, with an average serum neutralizing antibody titer of 1:80.6. High levels of specific sIgA antibodies were detected in colostrum. Two piglets in the immunized group experienced diarrhea lasting 3 days after challenge, followed by improvement. The remaining piglets showed no obvious diarrhea symptoms. Anal swab tests revealed only two piglets with severe viral shedding, while the other eight showed low-level viral shedding. In the unimmunized control group, sows consistently tested negative for PEDV antibodies. 10 out of 10 piglets in the control group developed the disease after challenge, with persistent diarrhea throughout the observation period and high viral shedding. Four piglets died 5 days after challenge. Specific results are shown in Tables 6, 7, and 8.

[0077] Table 6. Results of serum neutralizing antibody detection in PEDV JLSY 2023 immunized pregnant sows

[0078]

[0079] Table 7 Results of sIgA antibody detection in milk of PEDV JLSY 2023 immunized pregnant sows

[0080]

[0081] Table 8 Results of PEDV JLSY 2023 Passive Immunization Challenge Trial

[0082] Group Number of piglets Infectious drug dosage Incidence rate mortality rate Protection rate Immunogroup 10 <![CDATA[10 4 TCID 50 ]]> 2 / 10 0％ 80％ Comparison 10 <![CDATA[10 4 TCID 50 ]]> 10 / 10 40％ /

[0083] The results showed that oral immunization of weaned piglets and pregnant sows with the attenuated strain of PEDV JLSY 2023 had good immunogenicity and could activate the mucosal immune system to produce sIgA antibodies, which could protect piglets from the attack of the virulent variant of PEDV.

[0084] SEQ ID NO: 1 S gene sequence 4158bp

[0085]

[0086] SEQ ID NO: 2 ORF3 gene sequence 574 bp

[0087] ATGTTTCTTGGACTTTTTCAATACACGATTGACACAGTCGTCAAAGATGTCTCTAAGTCTGCCAACTTGTCTTCGGACGCTGTCCAAGAGTTGGAGCTCAATGTAGTTCCAATTAGACAAGCTTCAAATGTGACTGGTTTTCTTTTCACCAGTGTTTTTATTTACTTCTTTGCACTGTTTAAAGCTTCTTCTTTGAGGCACACTTATTGGCAGGCTCTTTTTAGTCTGCTTTTATTCCTGGCGCTATAAAAATGCGCTCTTTATTATCTTTAATACTACTACACTTTCTTTTCTCAATGGTAAAGCAGCTTATTATGACGGCAAATCCATTGTGATTCTAGAAGGTGGTGATCATTACATCACTTTTGGCAACTCTTTCGTTGCTTTCGTTAGTAGCATTAACTTGTATCTAGCTATACGTGGGCGGCAAGAAGCTGACCTACATCTGTTGCGAACTGTTGAGCTTCTTGATGGCAAGAAGCTTTATGTCTTTTCGCAACATCAAATTGTTGGCATTACTAATGCTGCATTTGACTCAATTCAACTAGACGAGTATGCTACAATTAGTGAATGA。

Claims

1. A strain of Porcine epidemic diarrhea virus characterized in that, The microbial preservation number is CGMCC No. 46471.

2. The porcine epidemic diarrhea virus strain of claim 1, characterized in that, The nucleotide sequence of the S gene encoding the viral spike protein of the strain is shown as SEQ ID NO:

1.

3. The porcine epidemic diarrhea virus according to claim 1, characterized in that, The nucleotide sequence of the ORF3 gene of the strain is shown as SEQ ID NO:

2.

4. A vaccine containing the porcine epidemic diarrhea virus strain according to any one of claims 1-3.

5. The vaccine of claim 4, characterized in that, The vaccine is an oral live vaccine.

6. The vaccine of claim 5, characterized in that, The oral live vaccine comprises the porcine epidemic diarrhea virus antigen stock and a vaccine protective agent.

7. The vaccine of claim 6, characterized in that, The volume ratio of the vaccine protective agent to the antigen stock is (5:1) to (15:1).

8. The vaccine of claim 7, characterized in that, The volume ratio of the vaccine protective agent to the antigen stock is 10:

1.

9. Use of the porcine epidemic diarrhea virus strain according to any one of claims 1-3 in the preparation of a medicament for preventing and / or treating porcine epidemic diarrhea.

10. Use according to claim 9, characterized in that, The medicament is a vaccine.

Images