Non-antigen-dependent antibody rapid enhancement method and application

Abstract

The invention discloses a non-antigen-dependent antibody rapid enhancement method and application, and relates to the technical field of biology. The method comprises the following steps: applying a non-antigen-dependent antibody rapid enhancer to an organism containing a pre-stored antibody in vivo so as to increase the content of the pre-stored antibody; the non-antigen-dependent antibody rapid enhancer comprises lipid nanoparticles coated with single-stranded oligonucleotide, the nucleotide sequence of the single-stranded oligonucleotide is as shown in SEQ ID NO. 1. According to the method, the level of the pre-stored antibody can be rapidly and remarkably improved in the body with the established immune memory under the condition that the exogenous antigen is completely not required to be stimulated again. The limitation that an existing antibody enhancement strategy must depend on antigens is broken through, and a brand-new technical tool and solution with wide application prospects are provided for quick awakening of vaccine efficacy, emergency enhancement of immune defense and controllable adjustment of in-vivo antibody level in antibody preparation.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a non-antigen-dependent antibody rapid enhancement method and application. BACKGROUND

[0002] Antibodies are key immune molecules of the body against exogenous pathogens and abnormal endogenous substances (such as tumor-related antigens). Whether in natural immune response, protective immunity after vaccination, or in the process of immunotherapy and antibody drug production, improving the level of antibodies in the body is always of great significance. Therefore, developing an efficient antibody enhancement strategy in the body, especially a "universal pre-existing antibody activation" method that does not depend on antigen stimulation, has significant scientific significance and broad industrial prospects.

[0003] Currently, the strategies for improving the level of antibodies in the body mainly rely on the following methods:

[0004] Antigen repeated stimulation: reactivation of immune memory by repeated administration of antigens to induce differentiation of memory B cells into plasma cells and secretion of antibodies in the body. This strategy has been widely used in vaccination programs, such as booster injections of mRNA vaccines or inactivated vaccines. However, this strategy can only increase the content of antigen-specific antibodies and cannot widely increase the content of antibodies in the body.

[0005] Cytokine or adjuvant assisted activation: such as the combination of antigen local injection of interleukin-21, B cell activation factor, TLR agonists (such as CpG-ODN), etc., to activate local immune response activity and improve the activation ability of helper T cells to B cells, thereby increasing the content of antibodies. These means usually depend on the use of antigens in combination and need to enhance the primary or secondary immune response.

[0006] In vitro induction and passive transfer: obtaining antibodies by activating B cells in vitro and then inputting them into the body, or directly inputting exogenous antibody preparations (such as intravenous immunoglobulin IVIG or monoclonal antibodies). Such methods are mainly used for emergency immunization or special disease treatment, with high cost, short duration and dependence on exogenous donors.

[0007] The above methods rely on single antigen stimulation or combination with antigens, and there is currently no technology for rapidly increasing the level of existing antibodies in the body without exogenous antigen stimulation. Especially in vaccinated individuals or infected recovered individuals, how to quickly and safely reactivate the memory immune system is still a technical blank. SUMMARY

[0008] The present application aims to provide a non-antigen-dependent antibody rapid enhancement method and application to solve the problems of the prior art.

[0009] To achieve the above-mentioned purpose, the present application provides the following solutions.

[0010] The present application provides an application of a single-stranded oligonucleotide in the preparation of a non-antigen-dependent antibody rapid enhancement agent, wherein the nucleotide sequence of the single-stranded oligonucleotide is shown in SEQ ID NO. 1.

[0011] The present application also provides an application of a lipid nanoparticle coated with a single-stranded oligonucleotide in the preparation of a non-antigen-dependent antibody rapid enhancement agent, wherein the nucleotide sequence of the single-stranded oligonucleotide is shown in SEQ ID NO. 1.

[0012] Further, the lipid nanoparticle coated with the single-stranded oligonucleotide is prepared by coating the single-stranded oligonucleotide with a liposome.

[0013] Further, the liposome comprises an ionizable cationic liposome, a neutral phospholipid, cholesterol, and a PEGylated phospholipid.

[0014] Further, the ionizable cationic liposome is ALC-0315.

[0015] Further, the neutral phospholipid is dioleoylphosphatidylcholine.

[0016] Further, the PEGylated phospholipid is DMG-PEG 2000.

[0017] The present application also provides a non-antigen-dependent antibody rapid enhancement agent, comprising a lipid nanoparticle coated with a single-stranded oligonucleotide, wherein the nucleotide sequence of the single-stranded oligonucleotide is shown in SEQ ID NO. 1.

[0018] Further, the lipid nanoparticle is prepared by coating the single-stranded oligonucleotide with a liposome.

[0019] The present application also provides a non-antigen-dependent antibody rapid enhancement method for non-disease diagnosis or treatment purposes, comprising the step of administering the above-mentioned non-antigen-dependent antibody rapid enhancement agent to a body containing pre-existing antibodies in the body to increase the content of the pre-existing antibodies.

[0020] The "non-antigen-dependent antibody rapid enhancer" of the present application refers to a preparation for an immunized individual. On the basis that the body has been immunized with an antigen at least once and pre-existing antibodies have been produced, the enhancer is administered alone (i.e. without the antigen being administered again), which can effectively and rapidly increase the concentration of pre-existing antibodies in the body.

[0021] The "non-antigen-dependent antibody rapid enhancement method" of the present application refers to a method for effectively and rapidly increasing the concentration of pre-existing antibodies in the body by administering a preparation without an antigen, on the basis that the body has been immunized with an antigen at least once and pre-existing antibodies have been produced.

[0022] The present application discloses the following technical effects:

[0023] The present application first discloses and verifies that a single-chain oligonucleotide (CGT-ODN) with a sequence as shown in SEQ ID NO. 1 and a lipid nanoparticle (LNP) preparation thereof can be used as a highly efficient non-antigen-dependent antibody rapid enhancer. The core technical advantage of the enhancer is that it can rapidly and significantly increase the level of pre-existing antibodies in the body without the need for external antigen re-stimulation. Animal experiment results show that by intravenous injection of CGT-ODN-LNP, the specific IgG antibody level in the serum of mice can be increased by more than 60% within 8 hours, and the enhancement effect is stable in individuals of different genders. More importantly, this method does not destroy the long-term homeostasis of the body's antibody level, indicating that it has good safety. This technology breaks through the limitation of existing antibody enhancement strategies which must rely on antigens, and provides a new and promising technical tool and solution for the rapid awakening of vaccine efficacy, the emergency strengthening of immune defense, and the controllable regulation of antibody levels in vivo in antibody preparation. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0025] Figure 1 A flowchart for studying the activation ability of CGT-ODN on mouse spleen immune cells;

[0026] Figure 2 A result graph of the classification of mouse spleen immune cells obtained by single-cell transcriptome test; wherein, A is a comparison of the change of spleen cell classification at different stimulation times by CGT-ODN; B is an annotation of the cell classification cell type;

[0027] Figure 3 Statistical graphs of specific expressed genes and expression levels for different cell subpopulations;

[0028] Figure 4 Graphs of percentage change in cell number for different B cell subpopulations at different times of CGT-ODN stimulation;

[0029] Figure 5 Schematic diagram of experimental design for intravenous injection of CGT-ODN-LNP to improve antibody levels in mice;

[0030] Figure 6 Statistical graphs of antibody concentration in serum determined by ELISA for male and female mice at different time points and under different stimulation; wherein, A is a graph of antibody content detection results for male mice at 7 days and 14 days after initial OVA antigen immunization; B is a graph of antibody content detection results for male mice at 0h and 8h after injection of CGT-ODN-LNP or PBS; C is a graph of antibody content detection results for male mice at 8h and 24h after injection of CGT-ODN-LNP or PBS; D is a graph of antibody content detection results for male mice at 16 days and 21 days after injection of CGT-ODN-LNP or PBS; E is a graph of antibody content detection results for female mice at 7 days and 14 days after initial OVA antigen immunization; F is a graph of antibody content detection results for female mice at 0h and 8h after injection of CGT-ODN-LNP or PBS; G is a graph of antibody content detection results for female mice at 8h and 24h after injection of CGT-ODN-LNP or PBS; H is a graph of antibody content detection results for female mice at 16 days and 21 days after injection of CGT-ODN-LNP or PBS;

[0031] Figure 7 Statistical graphs of percentage change in antibody levels in vivo within 24 hours after injection of CGT-ODN-LNP or PBS for male (A) and female (B) mice compared to before injection. DETAILED DESCRIPTION

[0032] A number of exemplary embodiments of the present application will now be described in detail with reference to the drawings, which are not to be construed as limiting the application. It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, the use of the term "about" in the description above and below means "approximately" or "around", and is intended to encompass the range of values plus or minus ten percent of the recited value. Furthermore, the use of the term "or" in the description above and below means "and / or", unless otherwise indicated. Additionally, for numerical ranges expressed in the format "from X to Y" in the description above and below, "X" and "Y" are both inclusive. The disclosure of numerical ranges including endpoints does not disclose ranges that include the endpoints, unless the statement "from X to Y" or "from X to Y, inclusive" is expressly recited.

[0033] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, for numerical ranges expressed in the format "from X to Y" in the description above and below, "X" and "Y" are both inclusive. The disclosure of numerical ranges including endpoints does not disclose ranges that include the endpoints, unless the statement "from X to Y" or "from X to Y, inclusive" is expressly recited.

[0034] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as those of ordinary skill in the art to which the application relates. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All documents mentioned herein are incorporated by reference to disclose and describe in full the methods and / or materials which are described therein. In case of conflict between the content of the specification and that of any document incorporated herein by reference, the content of the specification prevails.

[0035] Many modifications and variations of the present application described in the specification are possible without departing from the scope or spirit of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is intended to include all such modifications and variations in the scope of the present application.

[0036] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed material or step.

[0037] The single-stranded oligonucleotide (CGT-ODN) involved in the present application has the nucleotide sequence of CACGAAGAGGGCTCGTTGTAGGG (SEQ ID NO. 1).

[0038] Example 1 CGT-ODN can effectively stimulate immune cells

[0039] I. Experimental Methods

[0040] As shown in the flow chart of Figure 1 The present application first verifies the ability of CGT-ODN to activate spleen immune cells in vitro. The specific steps are as follows:

[0041] 1. Spleen cell separation:

[0042] 1) Take the spleen of 8-week-old male C57BL / 6 mice and wash it in PBS;

[0043] 2) Put the spleen into a culture dish containing 2 mL of mouse lymphocyte separation medium, grind the spleen until it is completely broken;

[0044] 3) Transfer the spleen grinding liquid through a 40 μm filter into a 15 mL tube, wash the culture dish with another 2 mL of mouse lymphocyte separation medium and continue to filter;

[0045] 4) Slowly add 2 mL of RPMI-1640 serum-free medium on top of the spleen grinding liquid, and a clear layer is visible. Centrifuge at 800 g for 30 min at room temperature;

[0046] 5) The tube bottom can see red blood cell sedimentation, RPMI-1640 and lymphocyte separation medium between the obvious white blood cell layer;

[0047] 6) Take all cells except red blood cells to another new centrifuge tube, about 6 mL, add RPMI-1640 medium to 15 mL system, shake gently, room temperature 250 g, centrifuge for 10 min;

[0048] 7) Discard the liquid, obtain the cell sediment, PBS gently resuspended, count, room temperature 250 g, centrifuge for 10 min, resuspended with RPMI-1640 medium and plated.

[0049] 2. CGT-ODN immune stimulation of spleen cells:

[0050] 1) Add 2 μL Lipofectamine 3000 transfection reagent and 1 μg CGT-ODN to two EP tubes containing 50 μL OPTI-MEM medium (pH 8.0) respectively, mix and incubate at room temperature for 5 min, then quickly combine the two EP tubes, stand at room temperature for 30 min, and obtain the transfection solution containing CGT-ODN;

[0051] 2) Seed the spleen mononuclear cells into a 12-well plate, then add the transfection solution containing CGT-ODN (100 μL / well), and stimulate for 4 h, 8 h and 12 h respectively. The control group (UT group) is added with the same volume of OPTI-MEM medium (pH 8.0) as the 4 h group, and the sample is collected at the same time. After the treatment, 10,000 cells of each sample are used to construct a library using 10x Chromium single cell 3' kit V3 (PN-1000077, PN-1000078, PN-1000076).

[0052] 3) The constructed single cell transcriptome library is sequenced on the Illumina NovaSeq6000 platform, and the sequencing mode is PE150. The sequencing results are analyzed by bioinformatics using the Seurat R package.

[0053] II. Experimental results

[0054] As shown in Figure 2 , after single cell sequencing analysis of spleen cells, it is shown that spleen cells mainly contain T cells, B cells, antigen presenting cells, macrophages, granulocytes and hematopoietic stem cells, etc. Among them, T cells and B cells are the most important cell components of spleen cells. Each type of cell corresponds to the expression of its classic characteristic gene (Fig. 1). Figure 3), indicating the accuracy of cell classification. After 4 hours of CGT-ODN stimulation, the subgroups of T cells and B cells were significantly migrated on the cell grouping, and slightly recovered at 8 hours and 12 hours, indicating that the subgroups of T cells and B cells generally responded positively to CGT-ODN stimulation. The results of the differential gene comparison of B cells at different time points after stimulation further supported this conclusion. Most of the differentially expressed genes belong to interferon-activated genes (ISG). Figure 4 The B cell subgroup cell quantity statistics shown indicate that mature B cells, IgIc1 high expression mature B cells, and MZ B cells will transform into ISG high expression cell groups under the stimulation of CGT-ODN, suggesting that CGT-ODN can effectively activate B cell function.

[0055] Example 2 Preparation of CGT-ODN coated lipid nanoparticles (CGT-ODN-LNP)

[0056] Preparation of CGT-ODN-LNP:

[0057] 1) According to the formulation shown in Table 1, ALC-0315, DOPC, Cholesterol and DMG-PEG 2000 were dissolved in anhydrous ethanol according to the molar ratio of 50:10:38.5:1.5 to form a liposome ethanol solution (organic phase);

[0058] Table 1 LNP formulation

[0059]

[0060] 2) CGT-ODN was dissolved in 25 mM sodium acetate buffer (pH 4.0) to obtain a CGT-ODN solution, and the final concentration of CGT-ODN was 1.0 mg / mL;

[0061] 3) The liposome ethanol solution and CGT-ODN solution were mixed uniformly according to the volume ratio of 1:3, and the mass ratio of lipid to nucleotide was 40:1. After mixing, it was placed at room temperature for 15 min; then it was diluted with PBS and ultrafiltered with a 30 kD ultrafiltration tube to achieve a 30-fold dilution, thereby removing ethanol and acidic solution in the LNP solution to avoid affecting subsequent animal experiments. Finally, it was diluted with PBS to obtain a CGT-ODN-LNP solution with a CGT-ODN concentration of 300 μg / mL.

[0062] Example 3 Rapid increase in pre-existing antibody content in vivo by in vivo injection of CGT-ODN-LNP

[0063] I. Experimental methods

[0064] As Figure 5As shown in the experimental flowchart, the present application provides a non-antigen-dependent antibody rapid enhancement method, comprising the following steps:

[0065] 1. Primary immunization of mice against OVA antigen

[0066] SPF-level mice raised in animal houses lack pathogenic microorganisms for their immunity, and thus have a low content of pre-existing IgG antibodies in the body. The ovalbumin (OVA) immunized mouse model is a classic tool in immunological research and is widely used in the exploration of mechanisms and drug evaluation in the fields of immune response, immune tolerance, tumor immunity, and autoimmune diseases. In order to study whether CGT-ODN can increase the content of pre-existing antibodies in the body, the inventors first immunized mice against OVA.

[0067] 1) Endotoxin-free OVA protein powder (purchased from InvivoGen company) was dissolved in PBS solution to obtain an OVA solution with a concentration of 1 μg / μL;

[0068] 2) The method of Example 2 was used to configure empty lipid nanoparticles (LNP) without CGT-ODN as an adjuvant for OVA inoculation. The adjuvant effect of LNP has been fully verified in the mRNA vaccine of the new coronavirus.

[0069] 3) The OVA solution was mixed with the empty LNP solution to obtain an OVA-LNP solution, and diluted with PBS to 100 μg / mL;

[0070] 4) Wild-type C57BL / 6 male and female mice were inoculated with OVA. 100 μL of the OVA-LNP solution prepared in the previous step was injected subcutaneously into the back of the mice to complete the inoculation;

[0071] 5) On the 7th and 14th days after inoculation, the mice were subjected to tail vein blood collection, and the serum was collected and frozen at -80℃ for subsequent ELISA detection.

[0072] 2. CGT-ODN-LNP booster injection

[0073] 1) After collecting the serum samples from the OVA subcutaneously immunized mice on the 14th day, 4 mg / kg of the CGT-ODN-LNP solution prepared in Example 2 was injected into the tail vein of each mouse; a control group was set up, and an equal amount of PBS was used instead of the CGT-ODN-LNP solution;

[0074] 2) Eight hours and 24 hours after the CGT-ODN-LNP or PBS intravenous injection, the mice were subjected to tail vein blood collection, and the serum was collected.

[0075] 3) Blood was collected from the tail vein of mice on day 21 after the initial OVA vaccination (i.e. day 7 after the CGT-ODN-LNP booster injection) and serum was collected.

[0076] 3. ELISA detection of antibody levels in serum

[0077] The titer of OVA-specific IgG1 antibody in serum samples from immunized or untreated mice was determined using an indirect enzyme-linked immunosorbent assay (ELISA). ELISA plates were purchased from Thermo Fisher Scientific (catalog number 439454), and the mouse anti-OVA IgG1 antibody standard was Sigma-Aldrich's monoclonal anti-OVA (Chicken eggalbumin) antibody produced in mouse, clone OVA-14 (catalog number A6075).

[0078] II. Experimental Results

[0079] like Figure 6 As shown, on day 7 after the initial immunization with OVA antigen, the level of specific IgG antibody in mice was below the detection limit, but on day 14, all mice showed a high level of OVA IgG1 antibody, with 12 / 17 male mice and 14 / 17 female mice having antibody levels higher than 1 μg / mL.

[0080] In this invention, 12 mice of each sex were randomly selected from 17 mice to be injected with CGT-ODN-LNP, and the other 5 mice were injected with PBS. Compared to before injection, the OVA antibody levels in the CGT-ODN-LNP-injected group mice were increased at hour 8. Figure 7 As shown, the antibody levels in male mice increased by an average of 63.7%, and in female mice by an average of 76.2%. No rapid increase in antibody levels was observed in the PBS injection group. When antibody levels were measured 24 hours after injection, this invention found that the antibody levels in male mice were slightly lower than 8 hours after injection, but still 42% higher than before injection on average. The antibody levels in female mice remained stable, still 75.6% higher than after injection. This invention continued to monitor antibody levels in the CGT-ODN-LNP injection group mice on day 21; CGT-ODN-LNP injection did not disrupt the persistence of antibody levels.

[0081] According to the above experimental results, the application provides a non-antigen-dependent antibody rapid enhancement method, and the pre-existing antibody content in the body can be rapidly increased by injecting CGT-ODN-LNP alone. The main role of CGT-ODN is to directly stimulate immune cells, and other administration modes and delivery modes capable of realizing the stimulation of immune cells by CGT-ODN are also applicable in addition to intravenous injection.

[0082] The above-described embodiments are only used to describe the preferred modes of the application, and are not used to limit the scope of the application. Without departing from the design spirit of the application, various modifications and improvements to the technical solutions of the application made by those skilled in the art shall fall within the protection scope of the claims of the application.

Claims

1. The application of a single-chain oligonucleotide in the preparation of a non-antigen-dependent antibody rapid enhancer, characterized in that, The nucleotide sequence of the single-stranded oligonucleotide is shown in SEQ ID NO.

1.

2. The application of lipid nanoparticles coated with single-chain oligonucleotides in the preparation of antigen-independent antibody rapid enhancers, characterized in that, The nucleotide sequence of the single-stranded oligonucleotide is shown in SEQ ID NO.

1.

3. The application according to claim 2, characterized in that, The lipid nanoparticles coated with single-chain oligonucleotides are prepared by coating the single-chain oligonucleotides with liposomes.

4. The application according to claim 3, characterized in that, The liposomes include ionizable cationic liposomes, neutral phospholipids, cholesterol, and PEGylated phospholipids.

5. The application according to claim 4, characterized in that, The ionizable cationic liposome is ALC-0315.

6. The application according to claim 4, characterized in that, The neutral phospholipid is dioleoylphosphatidylcholine.

7. The application according to claim 4, characterized in that, The PEGylated phospholipid is DMG-PEG 2000.

8. A non-antigen-dependent rapid antibody enhancer, characterized in that, The invention includes lipid nanoparticles coated with single-chain oligonucleotides; the nucleotide sequence of the single-chain oligonucleotides is shown in SEQ ID NO.

1.

9. The non-antigen-dependent antibody rapid enhancer according to claim 8, characterized in that, The lipid nanoparticles are prepared by coating the single-chain oligonucleotides with liposomes.

10. A method for rapid, non-antigen-dependent antibody enhancement for purposes other than disease diagnosis or treatment, characterized in that, The method includes the step of administering the non-antigen-dependent antibody rapid enhancer of claim 8 or 9 to an organism containing pre-existing antibodies to increase the content of said pre-existing antibodies.

Images