Method for detecting unicellular neogenesis RNA and product thereof

Abstract

The invention discloses a method for detecting unicellular neogenesis RNA (Ribonucleic Acid) and a product thereof. Comprising the following steps: a) performing alkylation modification on 4sU-labeled new RNA by using iodoacetamide to obtain alkylation modified RNA; b) carrying out RNA reverse transcription reaction by using RNA reverse transcriptase by taking the alkylation modified RNA in the step a) as a template to obtain a reverse transcription reaction product; the RNA reverse transcriptase is at least one of the RNA reverse transcriptase of a single-cell RNA library building kit YeaCell < TM >; the step a) and the step b) are completed in the same reaction container. The method is simple and convenient to operate, small in sample loss, high in RNA capture efficiency, low in cross contamination risk, accurate in detection result and high in detection sensitivity, and can be widely applied to scientific research and medical detection.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological detection, and particularly relates to a method for detecting single-cell nascent RNA and a product thereof. BACKGROUND

[0002] Traditional RNA detection methods (such as conventional scRNA-seq) can only provide a static expression snapshot, and the time resolution is insufficient, so it is difficult to capture the dynamic process of gene expression. In contrast, nascent RNA detection can directly analyze the generation and degradation dynamics of RNA by labeling newly synthesized transcripts within a specific time window, thereby achieving more precise time scale analysis. Since 2019, a variety of single-cell level nascent RNA detection technologies (such as scSLAM-seq, scNT-seq, NASC-seq, Well-TEMP-seq, Dyna-vivo-seq, etc.) have been developed one after another, helping scientists to carry out biological research in the smallest functional unit, to clarify specific details, to understand the biological complexity of the sample, and to solve biological problems.

[0003] In the field of single-cell nascent RNA detection technology, the existing method is usually based on the base mutation of 4sU labeling to identify nascent transcripts, and the core library construction process includes three key steps: (1) alkylation modification: using alkylating reagents such as iodoacetamide to combine with the sulfhydryl group of 4sU, realizing the chemical conversion of 4sU to cytosine analog; (2) RNA reverse transcription: the modified 4sU is recognized as C base by reverse transcriptase, resulting in T→C mutation in the cDNA sequence; (3) cDNA full-length amplification: the cDNA library is enriched by template switching or PCR amplification. However, the existing technology has the following limitations: 1. Complex operation and serious sample loss: the alkylation system inhibits RNA reverse transcription and cDNA full-length amplification, so it is necessary to enrich RNA by magnetic beads and change the reaction system. However, the magnetic bead enrichment itself has limited efficiency and complex process, which easily leads to serious loss of precious single-cell RNA samples. The single-cell RNA content is extremely small (usually 10 pg / cell), and the sample loss is particularly significant in multiple transfers, making it difficult to effectively capture the information of low-abundance transcripts. 2. High risk of cross contamination: opening the cover operation easily introduces environmental nucleic acid contamination, and generates aerosol, causing cross contamination of amplification products, affecting the detection accuracy. 3. Limited sensitivity: sample loss and contamination risk further reduce the detection sensitivity, making it difficult to meet the precise quantification needs of nascent RNA dynamic changes at single-cell resolution.

[0004] Therefore, it is urgent to develop a new single-cell nascent RNA technology to solve the above technical problems. SUMMARY

[0005] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application provides a method for detecting single-cell nascent RNA and a product thereof, which integrates an alkylation modification reaction and an RNA reverse transcription reaction in the same reaction container and sequentially completes them, is simple to operate, has low sample loss, high RNA capture efficiency, low risk of cross contamination, accurate detection results, high detection sensitivity, and can be widely applied to scientific research and medical detection.

[0006] The present application is based on the findings and recognitions of the inventors on the following problems:

[0007] Currently commonly used single-cell nascent RNA sequencing technologies (such as scSLAM-seq, scNT-seq, etc.) have the core goal of specifically capturing and analyzing RNA molecules newly synthesized by cells within a specific time window at single-cell resolution, in order to study the dynamic process of gene expression (such as transcription rate changes). The key strategy of this technology is to use an analog of uridine (such as 4-thiouridine (4sU)) as a marker molecule. At the designed time point in the experiment, 4sU is added to the culture medium of living cells. Cells actively transcribing will take up 4sU and incorporate it into the RNA chains being newly synthesized at that time, just like natural uridine (Uridine). Therefore, the RNA produced in this period carries the "time stamp" marker of 4sU. The subsequent library construction process is specially designed to distinguish these newly synthesized RNA with 4sU markers from previously existing, unmarked RNA. The core steps include:

[0008] 1. Alkylation modification (key conversion step): After total RNA is extracted from cell lysis, a specific alkylation reagent (the most commonly used is Iodoacetamide, IAA) is used for treatment. The 4sU molecule contains a unique sulfhydryl (-SH) group, while natural uridine (U) does not have this group. Alkylation reagents (such as IAA) selectively covalently react with the sulfhydryl group of 4sU to form a stable modification group (for example, S-carboxamidomethyl-4-thiouridine is generated). This chemical reaction is the basis for subsequent differentiation. This step is often simply described as "4sU-C base conversion".

[0009] 2. RNA reverse transcription (realizing "misreading"): Alkylated RNA as template, using reverse transcriptase (RT) to synthesize the complementary first strand cDNA. Reverse transcriptase, when reading the template strand, encounters the 4sU site after alkylated modification. The modified 4sU has changed in spatial structure and hydrogen bonding ability (similar to Cytosine, C). This change "deceives" the reverse transcriptase, making it tend to insert the complementary deoxynucleotide dGTP (corresponding to C of the template strand) instead of dATP (corresponding to U / T of the template strand) into the cDNA strand being synthesized. Therefore, on the final cDNA sequence, the position originally corresponding to the 4sU (modified) on the template strand is recorded as a "G" (because dGTP is inserted into the cDNA strand). This is equivalent to recording the marker site (original 4sU position) on the template strand as a "C" (because G of the cDNA strand corresponds to C of the template strand) at the sequence level. This is the meaning of "4sU is recognized as C" (more accurately, the modified 4sU causes the corresponding position on the cDNA strand to be recorded as G, so that in sequence alignment it appears that the position on the template strand is C).

[0010] 3. Full-length amplification of cDNA and library construction. Similar to standard single-cell RNA sequencing (scRNA-seq) library construction, full-length amplification of cDNA is usually used to increase detection sensitivity and construct complete sequencing libraries, usually using template switching; the final constructed library contains cDNA fragments from all RNAs (labeled and unlabeled).

[0011] After that, the sequence data obtained by sequencing is analyzed by alignment. In the alignment process, if a "T->C" mutation is detected at a certain U position of the RNA sequence (which should be T in the cDNA / sequencing read), this position is likely to correspond to an alkylated 4sU site (because dGTP is inserted into the cDNA strand, resulting in C / G in the sequencing read, while the position on the reference genome is T / A (T in the sense strand, A in the anti-sense strand), which is recorded as corresponding G in the cDNA due to "misreading", and the newly synthesized RNA sequencing read is C / G). Statistics of reads containing this specific "T>C" mutation (which actually reflects the modification of 4sU on the template strand leading to A->G mutation in the cDNA sequence, which appears as T-> or A->G in the sequencing strand) can specifically identify those RNA molecules newly synthesized during the 4sU labeling period and distinguish them from unlabeled RNA in the background. The density of mutation sites (mutation rate) can also indirectly reflect the degree of RNA synthesis.

[0012] To overcome the cumbersome process, sample loss and contamination risk caused by the distribution of alkyl modification, RNA reverse transcription and cDNA full-length amplification operations in the prior art, the inventors propose an integrated solution: integrating the above key steps in whole or in part in the same reaction container (One-Tube) to construct a multi-system compatible one-tube (One-Tube Method) reaction process to simplify the operation, reduce nucleic acid loss and improve detection sensitivity Figure 1 ). To achieve the above goal, the first technical difficulty to be solved is the incompatibility of different operation steps: 1. Reverse transcription system and alkyl modification system are incompatible: alkyl modification reaction chemicals inhibit reverse transcriptase catalytic activity; 2. Full-length amplification system and alkyl modification system are incompatible: alkyl reaction chemicals inhibit DNA polymerase activity; 3. Full-length amplification system and reverse transcription system are incompatible: reverse transcriptase reaction system affects the extension ability of DNA polymerase.

[0013] First, unexpectedly, the inventors screened an RNA reverse transcriptase with good resistance to alkylating agents (such as IAA): SuperScript Hifair or single-cell RNA library construction kit YeaCell TM RNA reverse transcriptase. Thus, alkyl modification and RNA reverse transcription can be completed in the same reaction container, solving the problem of incompatibility between the reverse transcription system and the alkyl modification system.

[0014] However, based on the reverse transcription reaction product, cDNA full-length amplification was performed in the same reaction container, and the experimental results showed that the amplification product was less (such as SuperScript Hifair ) or almost undetectable (such as ), and subsequent library construction experiments could not be performed. The residual iodine acetamide (IAA) and DMSO in the reverse transcription reaction buffer significantly inhibited the activity of the subsequent DNA polymerase, resulting in a significant decrease in cDNA amplification efficiency. This inhibitory effect makes the alkyl system, reverse transcription system and cDNA amplification system inherently chemically incompatible, hindering their continuous performance in the same reaction container. Experimental results also show that the reverse transcriptase with the best IAA resistance Its commercial reaction system seriously affects the extension ability of DNA polymerase, making the above system incompatibility worse. The inventors found that replacing the reverse transcriptase reaction buffer (such as After replacing the RT Reaction Buffer with the following components: 50 mM Tris-HCl pH 8.0, 50–100 mM KCl, 3–6 mM MgCl2, and 5–20 mM DTT, the inhibition of DNA polymerase activity was significantly alleviated, and the cDNA product yield could be maintained at a high level. This cleverly solves the incompatibility problem between the alkylation modification system, the RNA reverse transcription system, and the full-length cDNA amplification system, allowing these three reactions to be carried out in the same reaction vessel.

[0015] Therefore, in a first aspect, the present invention provides a method for detecting RNA in newly formed single cells. According to an embodiment of the present invention, the method includes the following steps: a) alkylating 4sU-labeled newly formed RNA with iodoacetamide to obtain alkylated RNA; b) using the alkylated RNA obtained in step a) as a template, performing reverse transcription of RNA using an RNA reverse transcriptase to obtain a reverse transcription product; wherein the RNA reverse transcriptase is SuperScript. Hifair Or YeaCell single-cell RNA library preparation kit TM At least one of the RNA reverse transcriptases; steps a) and b) are performed in the same reaction vessel. According to the method of the present invention, the core steps of alkylation modification reaction and RNA reverse transcription reaction are integrated into the same reaction vessel and performed sequentially or in sequence. This method is simple to operate, results in minimal sample loss, has high RNA capture efficiency, low risk of cross-contamination, accurate detection results, and high detection sensitivity, and can be widely applied in scientific research and medical testing.

[0016] According to an embodiment of the present invention, based on the total reaction volume of the alkylation modification described in step a), the concentration of the iodoacetamide is 5–20 mM. Exemplarily, the concentration of the iodoacetamide can be 5 mM, 10 mM, 15 mM, or 20 mM.

[0017] According to an embodiment of the present invention, based on the total reaction volume of the RNA reverse transcription reaction described in step b), the concentration of iodoacetamide is 0.5–2 mM. Exemplarily, the concentration of iodoacetamide can be: 0.5 mM, 1 mM, 1.5 mM, or 2.0 mM.

[0018] According to an embodiment of the present invention, based on the total reaction volume of the alkylation modification in step a), the concentration of iodoacetamide is 5-20 mM; based on the total reaction volume of the RNA reverse transcription reaction in step b), the concentration of iodoacetamide is 0.5-2 mM.

[0019] According to an embodiment of the present invention, RNA reverse transcriptase SuperScript Hifair and single-cell RNA library construction kit YeaCell TM The RNA reverse transcriptase has good tolerance to the above-mentioned concentration of iodacetamide. Thus, the alkylation modification reaction and the RNA reverse transcription reaction can be integrated in the same reaction container, avoiding sample purification, transfer and other links, thereby reducing the loss and cross contamination risk of the RNA sample, improving the reverse transcription capture efficiency, and improving the sensitivity and reliability of the detection.

[0020] In some embodiments, the solvent of iodacetamide is DMSO.

[0021] The volume percentage concentration of the DMSO is 40-50% based on the total reaction volume of the alkylation modification of step a). Illustratively, the volume percentage concentration of the DMSO is 40%, 42%, 44%, 46%, 48%, or 50%.

[0022] The volume percentage concentration of the DMSO is 2.5-3.5% based on the total reaction volume of the RNA reverse transcription reaction of step b). Illustratively, the volume percentage concentration of the DMSO is 2.5%, 2.75%, 3%, 3.25%, or 3.5%.

[0023] In some specific embodiments, the volume percentage concentration of the DMSO is 40-50% based on the total reaction volume of the alkylation modification of step a), and the volume percentage concentration of the DMSO is 2.5-3.5% based on the total reaction volume of the RNA reverse transcription reaction of step b).

[0024] According to an embodiment of the present application, the RNA reverse transcriptase Superscript Hifair and single-cell RNA library construction kit YeaCell TM The RNA reverse transcriptase has good tolerance to the above-mentioned concentration of iodacetamide. Thus, the alkylation modification reaction and the RNA reverse transcription reaction can be integrated in the same reaction container, avoiding sample purification, transfer and other links, thereby reducing the loss and cross contamination risk of the RNA sample, improving the reverse transcription capture efficiency, and improving the sensitivity and reliability of the detection.

[0025] Thus, the method of the present application does not need to purify or dilute the RNA after alkylation modification to remove iodacetamide and DMSO, and the reverse transcription reaction can be directly started by adding the reverse transcriptase and other reagents into the same reaction tube, avoiding sample transfer, adsorption and loss caused by replacement of the reaction system, and significantly simplifying the operation process. This is crucial for improving the capture efficiency of precious clinical samples or high-throughput single-cell sequencing.

[0026] According to the embodiment of the present application, the RNA reverse transcriptase reaction buffer is composed of 50mM Tris-HCl pH 8.0, 70-80mM KCl, 4-6mM MgCl2, 8-12mM DTT.

[0027] According to the embodiment of the present application, the RNA reverse transcriptase reaction buffer is composed of 50mM Tris-HCl pH 8.0, 70-80mM KCl, 4-6mM MgCl2, 8-12mM DTT.

[0028] According to the embodiment of the present application, the RNA reverse transcriptase reaction buffer is composed of 50mM Tris-HCl pH 8.0, 70-80mM KCl, 4-6mM MgCl2, 8-12mM DTT. X-100), (NH4)2SO4, etc., unexpectedly obtained a buffer with good compatibility for multiple commercially available reverse transcriptases (including Hifair and SuperScript YeaCell TM RNA reverse transcriptase, etc.), and high cDNA yield. Further experiments found that the reverse transcription reaction system containing the above-mentioned reverse transcriptase reaction buffer and the alkylating agent significantly alleviated the inhibition of DNA polymerase activity. Thus, the present application further integrates the three key reactions of alkyl modification, RNA reverse transcription, and cDNA full-length amplification into the same reaction vessel, and sequentially completes RNA alkyl modification, cDNA synthesis, and cDNA full-length amplification without changing the reaction system. This multi-system compatible one-tube reaction process design effectively eliminates the sample loss and contamination risk caused by intermediate purification and transfer steps, significantly improves the reaction efficiency and the integrity and uniformity of cDNA output, and is particularly suitable for ultra-low starting amount samples (such as rare cells or puncture samples) and high-throughput single-cell sequencing applications.

[0029] In some specific embodiments, the concentration of KCl is 75mM.

[0030] In some specific embodiments, the concentration of MgCl2 is 6 mM.

[0031] In some specific embodiments, the concentration of DTT is 10 mM.

[0032] Preferably, the RNA reverse transcriptase is

[0033] In some embodiments, the cDNA full-length amplification is achieved by TSO (oligonucleotide) mediated template strand displacement.

[0034] In some specific embodiments, the reverse transcription reaction of step b) is based on a first reverse transcription primer and a TSO primer, the nucleotide sequence of the first reverse transcription primer is as shown in SEQ ID NO: 1, and the nucleotide sequence of the TSO primer is as shown in SEQ ID NO: 2. Exemplarily, the conditions of the reverse transcription reaction can be selected as: 42°C for 90 min; 50°C for 2 min, 42°C for 2 min, for a total of 10 cycles; 85°C for 5 min.

[0035] In some specific embodiments, step c) further comprises a PCR amplification step. The PCR amplification is based on an ISPCR primer and a DNA polymerase; the nucleotide sequence of the ISPCR primer is as shown in SEQ ID NO: 3. Exemplarily, the DNA polymerase can be selected as The DNA polymerase, and the conditions of the PCR reaction can be selected as: 98°C for 30 s; 98°C for 10 s, 67°C for 30 s, 72°C for 6 min, for a total of 14 cycles; 72°C for 5 min.

[0036] In other embodiments, the cDNA full-length amplification is selected as MALBAC linear amplification, and the DNA polymerase of the MALBAC linear amplification has 3’-5’ exonuclease activity. Thus, the base mutation rate of the traditional MALBAC linear amplification is reduced.

[0037] In some specific embodiments, the DNA polymerase is Deep The Deep The reaction buffer of the Deep 2+ The reaction system of the MALBAC linear amplification does not additionally add Mg 2+ The Deep has the characteristics of strand displacement, high temperature resistance, high fidelity, and 3’-5’ exonuclease activity. According to the embodiments of the present application, after removing MgSO4 in the reaction system of the traditional MALBAC linear amplification, the Deep The application shows excellent amplification effect. Thus, by optimizing the traditional MALBAC linear amplification system, the application can significantly improve the application performance of the technology in single-cell new RNA detection, accurately maintain the original sequence information of the new RNA chain, and effectively overcome the problems of extremely low starting amount and easy introduction of amplification bias in single-cell samples. Compared with the traditional MALBAC linear amplification method, the application significantly reduces the base error rate in the linear amplification link, and provides a reliable technical basis for high-sensitivity and high-accuracy single-cell new transcript quantitative analysis and mutation detection.

[0038] In some specific embodiments, the Deep In some specific embodiments, the Mg 2+ has a concentration of 0.8-1.2 mM.

[0039] In some specific embodiments, the Mg 2+ is from MgSO4.

[0040] In some specific embodiments, the Deep The reaction buffer of the Deep

[0041] In some specific embodiments, the reverse transcription reaction of step b) is based on a second reverse transcription primer, and the nucleotide sequence of the second reverse transcription primer is shown in SEQ ID NO: 7.

[0042] In some specific embodiments, the MALBAC linear amplification of step c) is based on a random primer and a co-primer, and the nucleotide sequence of the random primer is shown in SEQ ID NO: 6, and the nucleotide sequence of the co-primer is shown in SEQ ID NO: 8. For example, the MALBAC cDNA linear amplification based on Deep The reaction conditions of the MALBAC cDNA linear amplification based on Deep

[0043] In some specific embodiments, the method further comprises the following steps: Tn5 fragmentation: adding library construction PCR primers to the cDNA full-length amplification product by Tn5 fragmentation; library construction PCR; fragment sorting; end product sequencing.

[0044] The library construction PCR primers are added to the amplification fragments by Tn5 fragmentation, and P7 and P5 sequencing indexes are further added to both ends of the fragments. Illustratively, the library construction PCR is divided into the following two steps:

[0045] 1) RNA 3' end amplification: simultaneously adding RNA 3' end primers and P5 index primers; the number of amplification cycles is 4-6 cycles. The sequence of the RNA 3' end primers is shown in SEQ ID NO: 9.

[0046] 2) Sequencing adapter amplification: continuing to add P7 index primers to the RNA 3' end amplification system; the number of amplification cycles is 6 cycles.

[0047] In the fragment sorting step, the volume of the DNA purification magnetic beads used is 0.8-1.2x.

[0048] Generally, the end product sequencing is implemented by using second-generation sequencing.

[0049] In some specific embodiments, further comprising the following steps: identification of nascent RNA fragments with T-C conversion; based on the results of the identification of the nascent RNA fragments, evaluating the RNA generation and degradation dynamics within the 4sU labeling time. The identification of nascent RNA fragments with T-C conversion is identified by bioinformatics methods, and the amount of RNA generation and degradation within the 4sU labeling time is calculated. Based on the identification and calculation results, the RNA generation and degradation dynamics within the 4sU labeling time are evaluated, and further analysis on a more precise time scale is realized.

[0050] Compared with the published single-cell nascent RNA detection technologies such as scSLAM, NASC-seq, scNT-seq, sci-Fate, Well-TEMP-seq, Dyna-vivo-seq and the like, the method for detecting single-cell nascent RNA (i.e., the scTT-seq detection method of the application) according to the embodiments of the application has the largest number of genes that can be detected in a single cell, the largest number of UMIs that can be detected in each cell, the total RNA expression of single cells consistent with the total RNA expression of population cells, the conversion efficiency of T->C higher than the current 2% recognized standard, the nascent RNA accounting for up to 20% of the total RNA, far higher than the current highest detection ratio of 12.5%, and the transcription level of specific genes Actb and Gapdh consistent with the known conclusion. Therefore, the scTT-seq detection method of the application has at least one of the following advantages: high sensitivity in capturing RNA, high capture efficiency, high detection data quality, accurate and reliable detection results, especially for low expression peak degree gene detection, and for early embryo and adult stem cell and the like precious clinical sample detection, and can be widely used in scientific research and medical detection.

[0051] In the second aspect of the application, a reverse transcriptase product is provided. According to the embodiments of the application, the reverse transcriptase product comprises: The RNA reverse transcriptase and the reaction buffer thereof; the reaction buffer of the RNA reverse transcriptase is composed of 50mM Tris-HCl pH 8.0, 50-100mM KCl, 3-6mM MgCl2, 5-20mM DTT. The reverse transcriptase product according to the application is used for reverse transcription reaction, has high cDNA yield, good alkylating reagent resistance, and can integrate alkylating modification, reverse transcription and cDNA full-length amplification in the same reaction container. The reverse transcriptase product according to the embodiments of the application also has TSO template displacement activity, and the displacement effect is better than that of Discovery-sc. Exemplarily, the reverse transcriptase product of the application can be further used for Smart-seq2 library construction and single-cell nascent RNA detection.

[0052] In some embodiments, the reaction buffer of the RNA reverse transcriptase is composed of 50mM Tris-HCl pH 8.0, 70-80mM KCl, 4-6mM MgCl2, 8-12mM DTT.

[0053] In some specific embodiments, the concentration of KCl is 75mM.

[0054] In some specific embodiments, the concentration of MgCl2 is 6mM.

[0055] In some specific embodiments, the concentration of DTT is 10mM.

[0056] In a third aspect, the present application provides a kit for detecting single-cell nascent RNA. According to embodiments of the present application, the kit comprises the reagents used in the aforementioned method.

[0057] It is understood by those skilled in the art that the features and advantages described above for the method, composition for detecting single-cell nascent RNA also apply to the kit, which will not be repeated here.

[0058] In some embodiments, the kit further comprises an instruction manual, which contains the steps of the aforementioned method. The provision of the instruction manual can effectively ensure the standardized implementation of the aforementioned method, reduce the risk of experimental failure caused by improper operation procedures, enable even untrained operators to efficiently and accurately complete the whole process of labeling, capturing and detecting single-cell nascent RNA, improve the reliability and repeatability of the detection results, and facilitate the widespread application of the kit of the present application in scientific research and clinical environments.

[0059] In some embodiments, the reagents comprise the aforementioned reverse transcriptase product.

[0060] In a fourth aspect, the present application provides a system or device for detecting single-cell nascent RNA. According to embodiments of the present application, the system or device is operated based on the aforementioned method; or the system or device comprises the aforementioned kit.

[0061] In this document, the term "system" or the term "device" refers not only to a system or device that has multiple computers, pieces of hardware, devices, etc. connected via a communication unit such as a network (including a communication connection established in a one-to-one manner) to each other, but also to a system or device implemented by one computer, one piece of hardware, one device, etc. The terms "device" and "system" are used as terms having the same meaning.

[0062] It is understood by those skilled in the art that the features and advantages described above for the method, composition, kit for detecting single-cell nascent RNA also apply to the system or device, which will not be repeated here.

[0063] Additional aspects and advantages of the present application will be in part apparent and in part pointed out hereinafter. BRIEF DESCRIPTION OF DRAWINGS

[0064] The above and / or additional aspects and advantages of the present application will become apparent and be readily appreciated from the following description, including the appended drawings, wherein:

[0065] Figure 1The technical concept of the method for detecting single-cell nascent RNA of the application;

[0066] Figure 2 The screening of RNA reverse transcriptase compatible with the alkylating system in embodiment 1 of the application and the optimization results of the reaction buffer, wherein (A) is the investigation results of the resistance of reverse transcriptase to alkylating agent IAA; (B) is the investigation results of the sequential completion of the integration of the alkylating reaction, reverse transcription reaction and cDNA full-length amplification reaction in the same PCR tube; the positive control group is the positive control group, and compared with the Induro buffer group, the amplification system of the DNA polymerase of the positive control group does not contain and the reaction buffer thereof; the reverse transcriptase of the Superscript IV buffer group, the Induro buffer group, the Discovery-sc buffer group and the Hifair V buffer group respectively adopts Superscript IV reverse transcriptase, Induro reverse transcriptase, Discovery-sc reverse transcriptase and Hifair V reverse transcriptase; Hifair The reverse transcription reaction buffer respectively adopts the commercial reverse transcription reaction buffer of the reverse transcriptase; (C) is the influence of different reverse transcription reaction buffers on the yield of reverse transcription products; (D) is the investigation results of the universality of the transcription reaction buffer (Buffer 1) of the application;

[0067] Figure 3 The compatibility verification results of the reverse transcription system of the application and the commonly used library construction and amplification method (TSO template strand displacement), wherein (A) is a comparison chart of the product concentration of the Induro reverse transcription system of the application and the commonly used reverse transcription system of Smart-seq2; after the integration of the alkylating reaction and the reverse transcription reaction in the same PCR tube, (B) is an investigation chart of the amplification product concentration of the Induro reverse transcription system of the application; (C) is an investigation chart of the electrophoretic distribution of the product of the Induro reverse transcription system of the application;

[0068] Figure 4 The DNA polymerase Deep Vent exo- and the DNA polymerase Deep with linear amplification function not disclosed in the prior art under the traditional MALBAC linear amplification system; (B) is an investigation chart of the activity of Deep Vent exo- and Deep Vent exo- and Deep the activity of Deep the reaction buffer concentration of Deep the activity of Deep

[0069] Figure 5 Figure 1 is a schematic diagram of a multi-system compatible one-tube reaction process for the method of detecting single-cell nascent RNA according to the present application;

[0070] Figure 6 Figure 2 is a diagram of a specific embodiment of the method of detecting single-cell nascent RNA according to the present application;

[0071] Figure 7 Figure 3 is a diagram of the results of single-cell total RNA quality detection of the method of detecting single-cell nascent RNA according to the present application; wherein, (A) is a diagram of the results of the number of detectable genes in a single cell; (B) is a diagram of the results of the number of UMIs detectable in each cell; (C) is an expression peak diagram of specific genes Pou5f1 and Gapdh;

[0072] Figure 8 Figure 4 is a diagram of the results of nascent RNA data quality analysis of the method of detecting single-cell nascent RNA according to the present application; wherein, (A) is a diagram of the results of T->C conversion efficiency analysis; (B) is a diagram of the results of nascent RNA proportion in total RNA analysis; (C) is an expression peak diagram of specific genes Actb and Gapdh. DETAILED DESCRIPTION

[0073] Embodiments of the present application are described in detail below. The embodiments described below are exemplary only and are not intended to limit the present application, which can be embodied in various ways.

[0074] It should be noted that the terms "first", "second" are used only for the purpose of description, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the technical features indicated. Therefore, the features defined with "first", "second" can explicitly or implicitly include one or more of the features. Further, in the description of the present application, unless otherwise specified, the meaning of "a plurality of" is two or more.

[0075] The endpoints of the ranges and any values disclosed herein are not limited to the precise values stated. The ranges or values should be construed to be approximations that allow for significant variation. Various ranges of values that resolve from the disclosure encompass one or more of the recited endpoint values, between the recited endpoint values, and between adjacent values. The disclosure of a single value of a parameter or characteristic can be taken as a disclosure of a range of values of that parameter or characteristic, whether or not explicitly stated.

[0076] In this text, the term "comprising" or "including" is an open expression, i.e. including the indicated content, but not excluding other aspects.

[0077] In this text, the term "optionally", "optional" or "optional" generally means that the event or circumstance subsequently described can or can not occur, and that the description includes situations where the event or circumstance occurs and situations where it does not.

[0078] Terms and definitions

[0079] In order to facilitate the understanding of the present application, certain technical and scientific terms are defined below. Unless otherwise apparent from context, all other technical and scientific terms used herein have the meanings typically understood by one of ordinary skill in the art to which this application belongs.

[0080] In this text, the term "4sU" is equivalent to "4-thiouridine", "4-thiouracil", which is a uracil analogue. In the field of nascent RNA labeling and sequencing technology, by temporarily treating cells with 4sU or EU (5-Ethynyluridine), RNA newly transcribed in this period can be specifically "captured", and then through high-throughput sequencing analysis, the real-time changes in transcription, synthesis rate and degradation rate can be accurately revealed.

[0081] In this text, the term "IAA" is equivalent to "iodoacetamide", which is an alkylating agent. The base conversion reaction of 4sU (4-thiouracil) to cytosine analogue mediated by IAA is a core chemical step in nascent RNA labeling and sequencing technology (such as SLAM-seq, TimeLapse-seq, etc.).

[0082] The schemes of the present application will be explained below in conjunction with examples. Those skilled in the art will understand that the following examples are only for illustration of the present application, and should not be regarded as limiting the scope of the present application. If the specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in the art or according to the product instructions are used. If the reagents or instruments used are not specified by the manufacturer, they are all conventional products that can be obtained commercially.

[0083] Example 1: Discovery of RNA reverse transcriptase compatible with alkylating system and optimization of its reaction buffer

[0084] Improving the catalytic activity of reverse transcriptase in the alkylating system is the first step in the optimization of single-cell nascent RNA technology.

[0085] Based on the previous pre-experiment, the inventors screened and compared the activities of four commonly used single-cell RNA reverse transcriptases in the presence of alkylating agent IAA (0.7 mM, solvent: 3% DMSO). The four RNA reverse transcriptases are: SuperScript (invitrogen, 1890050), (NEB, M0681L), (Vazyme, SC401-02) and Hifair (Yeason, 11300ES92). Among them, in the alkylating system, the concentration of DMSO is 45% (v / v), and the concentration of IAA is 10 mM; after adding the reverse transcription reaction system, the concentration of DMSO is further diluted to 3% (v / v), and the concentration of IAA is further diluted to 0.7 mM.

[0086] The specific test scheme is as follows:

[0087] Reagent consumables: 1 μg / μL RNA, 200 mM IAA, DMSO, 1 M DTT, four RNA reverse transcriptases SuperScript and Hifair and their matching commercial reaction buffers, 10 mM dNTP mix, 10 μM reverse transcription primer, sterile enzyme-free water, DNA purification magnetic beads, RNase A, etc.

[0088] Experimental steps:

[0089] (1) Take out the RNA, RNA reverse transcriptase matching reaction buffer, dNTP mix and reverse transcription primer, and thaw on ice; take out 200 mM IAA and thaw at room temperature in the dark;

[0090] (2) Prepare 20 mM IAA solution: add 4.5 μL DMSO and 0.5 μL 200 mM IAA to a 0.2 mL sterile enzyme-free PCR tube, mix well and wait for use;

[0091] (3) Alkylation reaction: prepare four 0.2 mL sterile enzyme-free PCR tubes, add 1 μL of 1 μg / μL RNA and 1 μL of 20 mM IAA solution in turn, so that the final concentration of reagents is consistent with the single-cell alkylation system, vortex mix, centrifuge, and incubate at 50°C for 15 min;

[0092] (4) Alkylation reaction termination: add 1.4 μL 1 M DTT to each tube, vortex mix, centrifuge, and stand at room temperature for 5 min;

[0093] (5) Reverse transcription primer annealing: Add 4.2 μL sterile water, 2 μL reverse transcription primer and 1 μL dNTP mix to each tube, vortex mix, centrifuge, incubate at 65°C for 5 min, then quickly place on ice for at least 2 min;

[0094] (6) Reverse transcription reaction: Add 2.8 μL RNA reverse transcription enzyme buffer and 0.6 μL (120 IU) RNA reverse transcription enzyme to each of the four PCR tubes, gently vortex mix and centrifuge, and incubate at 55°C for 15 min. This step simulates a single cell experiment, and the following reverse transcription system is used: 1 μg RNA, 120 U reverse transcription enzyme, 20 pmol primer, 55°C incubation for 15 min;

[0095] (7) Prepare 10 μL of 800 μg / mL RNase A solution: Add 9.2 μL sterile water and 0.8 μL 10 mg / mL RNase A to the PCR tube and mix well for later use;

[0096] (8) RNase A digestion: Add 2 μL of 800 μg / mL RNase A solution to the four reverse transcription systems to a final concentration of 100 μg / mL, and incubate at 37°C for 30 min;

[0097] (9) cDNA purification: Take out the DNA purification magnetic beads in advance and restore to room temperature, add 28.8 μL magnetic beads to each tube (cDNA to magnetic bead volume ratio = 1:1.8 for all cDNA in the purification system), gently blow and mix with the gun head; incubate at room temperature for 10 min; place in the magnetic stand for 5 min, discard the supernatant; keep the tube on the magnetic stand, wash twice with 200 μL of 80% ethanol; open the cap for 3-5 min, dry the ethanol, add 21 μL of ddH2O to elute the DNA, vortex mix; incubate at room temperature for 5 min, place in the magnetic stand for 5 min; take 20 μL of the supernatant to a 1.5 mL DNALoBind tube, label it;

[0098] (10) Qubit detects cDNA concentration: According to the Equalbit dsDNA BR Assay Kit instruction manual, first draw the concentration curve by detecting the standard, then detect the cDNA concentration of the sample in turn and record the Figure 2 (A))。

[0099] At the same time, step (8) is used to perform cDNA full-length amplification reaction in the same PCR tube with the same DNA polymerase (Deep vent polymerase, NEB, item number: M0258), and it is found that the reverse transcription reaction buffer RTReaction Buffer, component number: B0681AVIAL, concentration: 5×, severely inhibits DNA polymerase-mediated amplification reactions. Figure 2 (B)).

[0100] The experimental results showed that: (1) when alkylation and reverse transcription were performed in the same PCR tube, compared with other commonly used reverse transcriptases, Reverse transcriptase produces the most reverse transcription products. Figure 2 (A)); (2) When alkylation, reverse transcription, and full-length cDNA amplification are performed in the same PCR tube. The full-length cDNA amplification product of reverse transcriptase was almost undetectable. Figure 2 (B)). This result is not conducive to subsequent library construction experiments.

[0101] The above results show that Although reverse transcriptase has good resistance to the alkylating agent IAA, its commercial reaction system is incompatible with the full-length cDNA amplification system, which is not conducive to realizing the technical concept of carrying out alkylation modification, RNA reverse transcription and full-length cDNA amplification in the same reaction vessel.

[0102] To this end, the inventors made extensive creative efforts to specifically optimize the reverse transcriptase reaction buffer, ultimately overcoming this challenge.

[0103] By reviewing and comparing commonly used reverse transcriptase reaction buffers, it was preliminarily determined that they should contain at least the following components: MgCl2 (a cofactor for reverse transcriptase catalysis), KCl (to promote the binding of primers to RNA templates), DTT (as a reducing agent to stabilize the reverse transcriptase structure), and Tris-HCl 8.0 (to stabilize the pH of the system).

[0104] Furthermore, the inventors boldly designed and compared the Buffer1 reverse transcription reaction buffer (Buffer1: 50mM Tris-HCl pH 8.0, 75mM KCl, 6mM MgCl2, 10mM DTT). Reverse transcription reaction buffer ( RT Reaction Buffer, component catalog number: B0681AVIAL, concentration: 5×), commercially available reverse transcriptase reaction buffer (Buffer 2: 20mM Tris-HCl pH 8.0, 10mM (NH4)2SO4, 10mM KCl, 2mM MgSO4, 0.1%). (X-100). The specific plan is as follows:

[0105] Reagent consumables: 1 μg / μL RNA, 200 mM IAA, DMSO, 1 M DTT, Reverse transcriptase and its reverse transcription reaction buffer, Buffer1, Buffer2, 10 mM dNTP mix, 10 μM reverse transcription primer, sterile enzyme-free water, DNA purification magnetic beads, RNase A, etc.

[0106] Experimental steps: same as steps (1)-(10) as described above.

[0107] Test results show that: (1) when the alkylation reaction and the reverse transcription reaction are integrated in the same PCR tube, the reverse transcription product is the least when using the reaction buffer commonly used for commercial reverse transcriptase, and the reverse transcription product is significantly increased when using the reverse transcription reaction buffer (Buffer1) and RT Reaction Buffer of the application. The reverse transcription effect of the reverse transcription reaction buffer of the application is equivalent to that of Figure 2 (C).

[0108] Further, the inventors also tested the universality of the reverse transcription reaction buffer (Buffer1) of the application. Four RNA reverse transcriptases Hifair SuperScript YeaCell TM in Buffer1 and its commercial reverse transcription reaction buffer. Among them, YeaCell represents the RNA reverse transcriptase in the single cell RNA library construction kit YeaCell TM 1st Strand Synthesis kit for Single Cell 3′RNA-seq (Yeason, 13594ES04).

[0109] The specific test scheme is as follows:

[0110] Reagent consumables: 1 μg / μL RNA, 200 mM IAA, DMSO, 1 M DTT, 4 kinds of RNA reverse transcriptases and matching reaction buffers, Buffer1, 10 mM dNTP mix, 10 μM reverse transcription primer, sterile enzyme-free water, DNA purification magnetic beads, RNase A, etc.

[0111] Experimental steps:

[0112] Steps (1)-(10): same as above. Among them, in step (6) reverse transcription reaction, RNA reverse transcriptase Hifair SuperScript YeaCell TM The amount added was 0.6 μL, corresponding to 2.8 μL of commercial reverse transcription reaction buffer and the reverse transcription reaction buffer (Buffer 1) of this invention.

[0113] Test results show that in the reverse transcription reaction buffer (Buffer1) of this invention, (1) Hifair Reverse transcriptase has excellent reverse transcription efficiency, and the concentration of cDNA product is comparable to that of its proprietary commercial reverse transcription reaction buffer. (2) SuperScript YeaCell TM Several commercial reverse transcriptases maintained high cDNA yields, with significantly better results than the commonly used reaction buffer (Buffer 2) for commercial reverse transcriptases. Figure 2 (D)).

[0114] The above results demonstrate that the reverse transcription reaction buffer of this invention exhibits a clear advantage in versatility, supporting a variety of commercially available reverse transcriptases (including...). Hifair and SuperScript YeaCell et al. showed good compatibility, with no significant difference in cDNA yield compared to their proprietary commercial buffers.

[0115] Example 2: Compatibility verification of the reverse transcription system with commonly used library construction and amplification methods (TSO template strand substitution)

[0116] This example verifies the Induro reverse transcription system identified in Example 1. The compatibility of the enzyme and Buffer1 combination with the Smart-seq2 TSO template substitution system is demonstrated. This illustrates the good compatibility of the reverse transcription system of this invention with commonly used library construction and amplification methods (TSO template strand substitution).

[0117] First, referring to the experimental steps (1), (5) to (10) of this embodiment, the Induro reverse transcription system ( The combination of enzyme and Buffer 1) and the reverse transcriptase reaction system commonly used in Smart-seq2 ( The TSO template replacement activities of reverse transcriptase and its accompanying commercial reaction buffer were compared. Results are as follows: Figure 3 As shown in (A).

[0118] Secondly, referring to the experimental steps (1)-(10) of this embodiment, the concentration of the amplification product and the distribution of the nucleic acid electrophoretogram after the alkylating reaction and the reverse transcription reaction were integrated in the same PCR tube using the Induro reverse transcription system of the present application were investigated. The results are shown in Figure 3 (B) and (C) are shown. Figure 3 (C) are shown.

[0119] The specific test scheme is as follows:

[0120] Reagent consumables: 20 ng / μL RNA, 200 mM IAA, DMSO, 1 M DTT, Reverse transcriptase and matching commercial reaction buffer, Reverse transcriptase, Buffer 1, 10 mM dNTP mix, 10 μM reverse transcription primer

[0121] (5 'AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT XN -3 ') (SEQ ID NO: 1, wherein 'X' represents any one of ACG three bases, and 'N' represents any one of ATCG four bases),

[0122] 10 μM TSO primer (5 '-AAGCAGTGGTATCAACGCAGAGTACAT XX Y-3 ') (SEQ ID NO: 2, wherein 'X' represents the base G corresponding to ribonucleotide; and 'Y' represents the base G in the form of locked nucleotide),

[0123] Sterile enzyme-free water, DNA purification magnetic beads, RNase A, 10 μM ISPCR primer (5 '-AAGCAGTGGTATCAACGCAGAGT-3 ') (SEQ ID NO: 3), Q5 Mix (NEB, M0492), 0.5 mL PCR tube (Vazyme, PCR00105), Equalbit dsDNA BR Assay Kit (Vazyme, EQ122-02), 0.2 mL sterile enzyme-free PCR tube, ice box, centrifuge tube rack.

[0124] Instruments: PCR instrument, vortex, centrifuge, pipette, Qubit nucleic acid quantifier (Invitrogen, Q33238), fully automatic microprotein nucleic acid electrophoresis instrument.

[0125] Experimental steps:

[0126] (1) Take out 20 ng / μL RNA, Thaw reverse transcriptase, Buffer 1, 10 mM dNTP mix, reverse transcription primers, and TSO primers on ice; remove 200 mM IAA and thaw at room temperature in the dark.

[0127] (2) Prepare 20mM IAA solution: Add 4.5μL DMSO and 0.5μL 200mM IAA to a 0.2mL sterile enzyme-free PCR tube, mix thoroughly and set aside.

[0128] (3) Alkylation reaction: Add 1 μL of 20 μg / μL RNA and 1 μL of 20 mM IAA solution to two 0.2 mL sterile enzyme-free PCR tubes in sequence, so that the final concentration of the reagents is consistent with the single-cell alkylation system. Vortex to mix, centrifuge, and incubate at 50 °C for 15 min.

[0129] (4) Termination of alkylation reaction: Add 1.4 μL of 1M DTT to each tube, vortex to mix, centrifuge, and let stand at room temperature for 5 min;

[0130] (5) Reverse transcription primer annealing: Add 5.2 μL of sterile enzyme-free water, 1 μL of reverse transcription primer and 1 μL of dNTPmix to each tube, vortex to mix, centrifuge, incubate at 65°C for 5 min and then quickly place on ice for at least 2 min;

[0131] (6) Reverse transcription reaction: Add 3.4 μL of sterile enzyme-free water and 0.6 μL of [unspecified substance] to two PCR tubes respectively. Reverse transcriptase and 2.8 μL Buffer 1 were added, followed by 1 μL of TSO primer. The mixture was gently vortexed and centrifuged. The reaction conditions were 42℃ for 90 min; 50℃ for 2 min, 42℃ for 2 min, for a total of 10 cycles; 85℃ for 5 min.

[0132] (7) PCR amplification: Add 1 μL of ISPCR primers and 15 μL of [unclear text] to 3 reverse transcription systems. DNA polymerase ( High-Fidelity 2×Master Mix (NEB, M0492L), reaction conditions: 98℃ for 30s; 98℃ for 10s, 67℃ for 30s, 72℃ for 6min, for a total of 14 cycles; 72℃ for 5min.

[0133] (8) DNA purification: add 45 μL of DNA purification magnetic beads, gently blow the head of the gun to mix; incubate at room temperature for 10 min; place in the magnetic stand for 5 min, discard the supernatant; keep the tube in the magnetic stand, wash twice with 200 μL of 80% ethanol; open the cover for 3-5 min, dry the ethanol, add 21 μL of ddH2O to elute the DNA, vortex to mix; incubate at room temperature for 5 min, place in the magnetic stand for 5 min; take 20 μL of the supernatant to a 1.5 mL DNA LoBind tube, label well;

[0134] (9) Qubit detects cDNA concentration: according to the Equalbit dsDNA BR Assay Kit instruction manual, first draw the concentration curve by detecting the standard, then detect the cDNA concentration of the sample in turn and record;

[0135] (10) Use the full-automatic micro nucleic acid electrophoresis to identify the peak shape of the transcript pre-amplification library.

[0136] The test results show that: (1) Discovery-sc is a commonly used reverse transcriptase in Smart-seq2. Replace the reverse transcriptase with Induro, and replace the reverse transcription buffer with Buffer1, and after full-length amplification, more than twice the original DNA amplification product can be obtained. Unexpectedly, The reverse transcriptase in Buffer1 shows good TSO template displacement activity, and the displacement effect is higher than that of Discovery-sc Figure 3 (A)). (2) After the alkylation reaction, the product concentration of the Induro reverse transcription system of the application The enzyme combined with Buffer1 is more than 10 ng / μL. After aligning the peak distribution of micro nucleic acid electrophoresis with Marker (DL5000 DNA Marker, Jinsha Biological, item number: SM812-100), the product is mainly distributed between 500 bp-5 kb, which basically meets the mRNA length Figure 3 (B), Figure 3 (C)).

[0137] The above results show that the Induro new reverse transcription system of the application is also suitable for Smart-seq2 library construction, and the key steps such as alkylation modification, RNA reverse transcription and cDNA full-length amplification can be integrated in the same reaction container (One-Tube) or partially integrated.

[0138] Example 3: Improvement of cDNA full-length amplification system

[0139] The full-length amplification method commonly used is TSO (oligonucleotide) mediated template strand displacement, which is based on PCR exponential amplification and is prone to bias. To reduce bias, we plan to use the MALBAC linear amplification method, but the amplification enzyme Deep Vent exo- used in this method is prone to mutation due to the lack of 3'-5' exonuclease activity, which is not conducive to the identification of nascent RNA Figure 4 (A)). Therefore, it is necessary to first reduce the base mutation rate of MALBAC linear amplification.

[0140] Through information research, we found a DNA polymerase Deep (NEB, M0258S). This DNA polymerase has the characteristics of strand displacement, high temperature resistance and high fidelity, and may be suitable for MALBAC linear amplification. Further literature search found that the linear amplification function of this enzyme has not been disclosed, and the inventors further verified it under the traditional MALBAC linear amplification system. The specific verification scheme is as follows:

[0141] Reagent consumables: Deep DNA polymerase (NEB, M0258S), Deep (exo-) DNA polymerase (NEB, M0259S), 10x ThermoPol reaction buffer (NEB, B9004S), 100 mM MgSO4(B1003S), 2x TaqMix (Genstar, A012), 10 mM EGFP gene fragment upstream primer EGFP-F: ATGGTGAGCAAGGGCGAGGAGCTG (SEQ ID NO: 4), 10 mM EGFP gene fragment downstream primer EGFP-R: CTTGTACAGCTCGTCCATGCCGAGAGTGATC (SEQ ID NO: 5), template plasmid (containing EGFP), 10 mM dNTP mix, sterile enzyme-free water, agarose powder, TAE solution, nucleic acid dye, 6x purple gel loading dye (NEB, B7024A), DNA Marker (Jinsha Biological, SM812), sterile enzyme-free water, 0.2 mL sterile enzyme-free PCR tube, ice box, centrifuge tube rack; instrument: DNA electrophoresis instrument, Tanon exposure instrument.

[0142] Experimental steps:

[0143] (1) Take out the template plasmid, primer EGFP-F, primer EGFP-R, and 2x Taq Mix and thaw on ice;

[0144] (2) PCR system preparation. Take out 3 0.2 mL sterile and enzyme-free PCR tubes, tube 1 add 20 μL sterile and enzyme-free water, 1 μL of 100 ng / μL template plasmid, 2 μL EGFP-F, 2 μL EGFP-F and 25 μL 2×Taq Mix, vortex mix and instant off; tube 2 add 35 μL sterile and enzyme-free water, 5 μL 10×ThermoPol reaction buffer, 3 μL MgSO4, 1 μL dNTP mix, 1 μL of 100 ng / μL template plasmid, 2 μL EGFP-F, 2 μL EGFP-F and 1 μL Deep (exo-) DNA polymerase; tube 3 add 35 μL sterile and enzyme-free water, 5 μL 10×ThermoPol reaction buffer, 3 μL MgSO4, 1 μL dNTP mix, 1 μL of 100 ng / μL template plasmid, 2 μL EGFP-F, 2 μL EGFP-F and 1 μL Deep DNA polymerase;

[0145] (3) Set the PCR reaction process.

[0146] Tube 1 reaction as follows:

[0147]

[0148]

[0149] Tube 2, 3 reaction as follows:

[0150]

[0151] (4) DNA agarose gel electrophoresis to identify PCR products.

[0152] (5) UV exposure and take pictures of the DNA band for preservation.

[0153] Results show that: Deep There is no activity in the traditional amplification system of MALBAC Figure 4 (B)).

[0154] The inventors speculate that Deep May need special reaction system, in order to play the activity in MALBAC linear amplification. Considering Mg 2+ Is an important cofactor of DNA polymerase catalysis, we assume that the appropriate adjustment of Mg 2+ Concentration may increase Deep Vent activity, and the experiment is designed to verify. The specific verification scheme is as follows:

[0155] Reagent consumables: same as above; instrument: same as above.

[0156] Experimental steps:

[0157] (1) Take out the template plasmid, primer EGFP-F, primer EGFP-R, 10x ThermoPol reaction buffer and 100 mM MgSO4, and thaw on ice;

[0158] (2) Preparation of PCR system. Take out 6 0.2 mL sterile and enzyme-free PCR tubes, tube 1 add 35 μL sterile and enzyme-free water, 5 μL 10x ThermoPol reaction buffer, 3 μL MgSO4, 1 μL dNTP mix, 1 μL of 100 ng / μL template plasmid, 2 μL EGFP-F, 2 μL EGFP-F and 1 μL Deep (exo-) DNA polymerase; tube 2 add 36 μL sterile and enzyme-free water, 5 μL 10x ThermoPol reaction buffer, 3 μL MgSO4, 1 μL dNTP mix, 1 μL of 100 ng / μL template plasmid, 2 μL EGFP-F and 2 μL EGFP-F; tube 3 add 35 μL sterile and enzyme-free water, 5 μL 10x ThermoPol reaction buffer, 3 μL MgSO4, 1 μL dNTP mix, 1 μL of 100 ng / μL template plasmid, 2 μL EGFP-F, 2 μL EGFP-F and 1 μL Deep DNA polymerase; tube 4, 5, 6 replace 3 μL MgSO4 with 3 μL sterile and enzyme-free water, and the rest are the same as tube 1, 2, 3 respectively;

[0159] (3) Set the PCR reaction process.

[0160] The reactions of all PCR tubes are as follows:

[0161]

[0162] (4) DNA agarose gel electrophoresis to identify PCR products.

[0163] (5) UV exposure and taking pictures of DNA bands for preservation.

[0164] The results show that after removing MgSO4 in the traditional MALBAC amplification system, it is surprisingly found that Deep Deep Figure 4 (C) shows excellent amplification effect.

[0165] Based on the reverse transcription reaction product in the above step, Deep The cDNA linear amplification was performed, and the effect of the alkylating agent on the experimental results was not re-investigated in the corresponding amplification system. Because the concentrations of IAA and DMSO have been diluted very low at this step, they have almost no effect on the experimental results.

[0166] Further reduce the reaction buffer concentration of Deep and perform MALBAC amplification. In a 40 μL Deep Vent linear amplification reaction system (0.5x / 1x product matching reaction buffer 1 μL Deep DNA polymerase, 1 μL 10 mM dNTP mix, 2 μL GAT-7N random primer), 0.35x RT buffer was additionally added to simulate the RNA reverse transcription reaction system of the previous step. The sequence of GAT-7N is:

[0167] GTAGGTGTGAGTGATGGTTGAGGTAGTNNNNNNN (SEQ ID NO: 6, wherein "N" represents any one of the four bases ATCG).

[0168] The results show that after further reducing the reaction buffer concentration of Deep Vent to half of the normal concentration (0.5x buffer composition and concentration: 10 mM Tris-HCl 8.0, 1 mM MgSO4, 5 mM KCl, 5 mM (NH4)2SO4, 0.05% Triton X-100, see NEB official specification for details), the amplification product of Deep Vent in the MALBAC amplification system is significantly increased Figure 4 (D)).

[0169] Therefore, the inventors integrated the optimized reverse transcription and full-length amplification system of Example 1 and Example 3 into single-cell nascent RNA detection, and proposed a multi-system compatible single-cell nascent RNA detection "one-pot reaction" process Figure 5 ). This detection method is based on whole transcriptome linear amplification, and the inventors named it: scTT-seq (Transient Transcriptome Sequencing in Single Cells) single-cell nascent RNA detection method, and evaluated and verified the methodological performance such as detection accuracy, sensitivity, detection limit, and result reliability.

[0170] Experimental effect verification example of scTT-seq single-cell nascent RNA detection method:

[0171] Due to the fact that only a few picograms of total RNA are contained in a single cell, the expression data obtained by single-cell RNA technology is often very sparse. Therefore, comparing the capture efficiency of RNA is the key to measure the effectiveness of such technology, and the two important indicators for evaluating the capture efficiency are the average number of genes and the average number of UMIs (Unique Molecular Identifier) that can be detected in a single cell. Among them, UMI is a short sequence random barcode used to label a single mRNA molecule, and the number of UMIs per cell represents the total number of mRNA molecules per cell. By UMI correction, it can reduce the repeated data introduced in the amplification process and improve the accuracy of data.

[0172] According to the experimental steps of Reference Example 1 and Example 3, the total RNA quality of the scTT-seq single-cell nascent RNA detection method of the application was investigated according to the experimental scheme shown in Figure 5 , and the specific implementation scheme shown in Figure 6 . Among them, the reverse transcription reaction used reverse transcriptase, the reverse transcription reaction buffer Buffer1 of the application; the full-length amplification of cDNA used MALBAC linear amplification, and the amplification enzyme used DNA polymerase Deep amplification enzyme reaction system did not contain Mg 2+ , and the amplification reaction buffer of Deep was composed of the following formula: 10mM Tris-HCl 8.0, 1mM MgSO4, 5mM KCl, 5mM(NH4)2SO4, 0.05% Triton X-100. The specific scheme is as follows:

[0173] 1. Label the nascent RNA of the cultured cells with 4sU; generally, the treatment concentration of 4sU is 100-500μM, and low concentration has poor labeling efficiency, while high concentration will be toxic to cells.

[0174] 2. After collecting the cells, perform whole cell lysis and nuclear-cytoplasmic separation, and after centrifugation, obtain the supernatant (containing RNA cells, used for detecting single-cell nascent RNA) and the precipitate (nuclei, which can be used for detecting other omics, such as single-cell genome, Hi-C, ATAC-seq, CUT&Tag).

[0175] 3. Take the supernatant and perform IAA-mediated 4sU-C base conversion reaction. The treatment concentration of IAA is 5-20mM.

[0176] 4. RNA reverse transcription. The concentration of each component of Buffer1 is: 50mM Tris-HCl 8.0, 50-100mM KCl, 3-6mM MgCl2, 25-100mM DTT; the reverse transcription primer sequence is:

[0177] GTAGGTGTGAGTGATGGTTGAGGTAGTATTGCGCAATG NNNNNNNN TTTTTTTTTTTTTTT XN (SEQ ID NO: 7, where “X” represents any one of the three bases A, C, and G, and “N” represents any one of the four bases A, C, and G).

[0178] 5. Based on Deep Linear amplification of cDNA by DNA polymerase. The actual concentration of the reaction buffer should be controlled at 0.4–0.6× (i.e., diluted to 16–25 times the original concentration), and no additional MgSO4 should be added. Two primer sequences are required: the random primer sequence is GTAGGTGTGAGTGATGGTTGAGGTAGTNNNNNNN (SEQ ID NO: 6), and the co-primer sequence is GTAGGTGTGAGTGATGGTTGAGGTAGT (SEQ ID NO: 8). The linear amplification reaction conditions are as follows: 1) 95℃ for 5 min; 2) 4℃ for 50 s; 3) 10℃ for 50 s; 4) 20℃ for 50 s; 5) 30℃ for 50 s; 6) 40℃ for 45 s; 7) 50℃ for 45 s; 8) 65℃ for 4 min; 9) 95℃ for 20 s; 10) 58℃ for 20 s; 11) Go to step 2) for 9 cycles; 12) 95℃ for 1 min; 13) 95℃ for 20 s; 14) 58℃ for 30 s; 15) 72℃ for 3 min; 16) Go to step 13) for 14 cycles; 17) 72℃ for 5 min; 18) 4℃ for ∞.

[0179] 6. Tn5 fragmentation. Primers for library construction PCR are added to the amplified fragment by Tn5 fragmentation.

[0180] 7. Library construction PCR: Further add P7 and P5 sequencing indexes to both ends of the fragment; this is done in two steps:

[0181] 1) RNA 3' end amplification: Simultaneously add the RNA 3' end primer and the P5 index primer; amplification cycle number 4-6. The RNA 3' end primer sequence is as follows:

[0182] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGTTGAGGTAGTATTGCGCAA TG (SEQ ID NO: 9).

[0183] 2) Sequencing adapter amplification: P7 index primers were added to the RNA 3' end amplification system; the amplification cycle was 6 cycles.

[0184] 8. Fragment sorting. The volume used for DNA purification magnetic beads is 0.8-1.2x.

[0185] 9. The final product is used for second-generation sequencing.

[0186] 10. The newly generated RNA fragments with T-C conversion are identified by bioinformatics methods, and the RNA generation and degradation dynamics within the 4sU labeling time are evaluated.

[0187] The single-cell total RNA quality detection results of the scTT-seq single-cell newly generated RNA detection method of the application are shown in Figure 7 .

[0188] Among them, the original sequencing data of the related comparative data of scSLAM, NASC-seq, scNT-seq, sci-Fate, Well-TEMP-seq, and Dyna-vivo-seq are from the following documents:

[0189] scSLAM: Erhard F, Baptista MAP, Krammer T, Hennig T, Lange M, Arampatzi P, Jürges CS, Theis FJ, Saliba AE, L.scSLAM-seq reveals core features of transcription dynamics in single cells. Nature. 2019 Jul; 571 (7765): 419-423. doi: 10.1038 / s41586-019-1369-y. Epub 2019 Jul 10. PMID: 31292545.

[0190] NASC-seq: Hendriks GJ, Jung LA, Larsson AJM, Lidschreiber M, Andersson Forsman O, Lidschreiber K, Cramer P, Sandberg R. NASC-seq monitors RNA synthesis in single cells. Nat Commun. 2019 Jul 17; 10 (1): 3138. doi: 10.1038 / s41467-019-11028-9. PMID: 31316066; PMCID: PMC6637240.

[0191] scNT-seq: Qiu Q, Hu P, Qiu X, Govek KW, Cámara PG, Wu H. Massively parallel and time-resolved RNA sequencing in single cells with scNT-seq. Nat Methods. 2020 Oct; 17(10): 991-1001. doi: 10.1038 / s41592-020-0935-4. Epub 2020 Aug 31. PMID: 32868927; PMCID: PMC8103797.

[0192] sci-Fate: Cao J, Zhou W, Steemers F, Trapnell C, Shendure J. Sci-fate characterizes the dynamics of gene expression in single cells. Nat Biotechnol. 2020 Aug; 38(8): 980-988. doi: 10.1038 / s41587-020-0480-9. Epub 2020 Apr 13. PMID: 32284584; PMCID: PMC7416490.

[0193] Well-TEMP-seq: Lin S, Yin K, Zhang Y, Lin F, Chen X, Zeng X, Guo X, Zhang H, Song J, Yang C. Well-TEMP-seq as a microwell-based strategy for massively parallel profiling of single-cell temporal RNA dynamics. Nat Commun. 2023 Mar 7; 14(1): 1272. doi: 10.1038 / s41467-023-36902-5. PMID: 36882403; PMCID: PMC9992361.

[0194] Dyna-vivo-seq: Yin K, Xu Y, Guo Y, Zheng Z, Lin X, Zhao M, Dong H, Liang D, Zhu Z, Zheng J, Lin S, Song J, Yang C. Dyna-vivo-seq unveils cellular RNA dynamics during acute kidney injury via in vivo metabolic RNA labeling-based scRNA-seq. Nat Commun. 2024 Nov 14;15(1):9866. doi: 10.1038 / s41467-024-54202-4. PMID: 39543112; PMCID: PMC11564529.

[0195] Compared with the published single-cell nascent RNA detection technologies scSLAM, NASC-seq, scNT-seq, sci-Fate, Well-TEMP-seq, Dyna-vivo-seq, etc.:

[0196] (1) The scTT-seq detection method of the present application can detect the most genes in a single cell( Figure 7 (A)). This shows that the scTT-seq method of the present application has high sensitivity in capturing RNA, which is conducive to detecting genes with low expression peak.

[0197] (2) The number of UMIs that can be detected in each cell is the most( Figure 7 (B)). This shows that the scTT-seq method of the present application has high efficiency in capturing RNA, which is suitable for detecting trace amounts of cells, such as early embryos and adult stem cells.

[0198] (3) The expression peak plot of a specific gene shows that the total RNA expression of single cells (8 cell data integrated) is consistent with the total RNA expression of population cells( Figure 7 (C)). This shows that the scTT-seq method of the present application has accurate and reliable detection data, which can be widely used in scientific research and medical detection.

[0199] The quality analysis results of the nascent RNA data of the scTT-seq single-cell nascent RNA detection method of the present application are shown in Figure 8 .

[0200] The results show that: (1) The scTT-seq detection method of the present application has a higher conversion efficiency of T->C than the currently recognized standard of 2%( Figure 8(A)). (2) The proportion of nascent RNA in total RNA is as high as 20%, which is much higher than the highest detection proportion of 12.5% at present Figure 8 (B)). (3) The specific gene peak diagram shows that the gene Actb is actively transcribed, while the Gapdh is relatively inactive, which is consistent with the known conclusion Figure 8 (C)). This shows that the scTT-seq method of the application is accurate and reliable.

[0201] The recognized standard of 2% for T->C conversion efficiency is as follows:

[0202] https: / / www.nature.com / articles / nmeth.4435.

[0203] The highest detection proportion of nascent RNA in total RNA is 12.5% according to the NASC-seq2 technology:

[0204] https: / / www.nature.com / articles / s41556-024-01486-9. The NASC-seq2 technology is the most optimal detection effect in the field of single-cell nascent RNA detection at present.

[0205] In summary, the scTT-seq single-cell nascent RNA detection method of the application realizes the three-system compatibility of alkyl modification, RNA reverse transcription and cDNA full-length amplification, and integrates the three reaction steps in the same reaction container (One-Tube). A multi-system compatible one-tube (One-Tube Method) reaction process is determined. The method of the application simplifies the operation steps, while the RNA loss is significantly reduced, the RNA capture sensitivity and capture efficiency are obviously improved, the detection sensitivity and accuracy are high, and the detection result is reliable.

[0206] The inventors screened several RNA reverse transcriptases SuperScript Hifair Single-cell RNA library construction kit YeaCell TM RNA reverse transcriptase) which has good alkylating agent IAA performance. At the same time, the inventors creatively developed a reaction buffer which does not affect the subsequent DNA polymerase activity and can maintain a high yield of cDNA products in reverse transcription reaction, and ingeniously solved the problem of incompatibility of alkyl modification system, RNA reverse transcription system and cDNA full-length amplification system.

[0207] Further, the inventors daringly introduced the MALBAC linear amplification method into the detection of single-cell nascent RNA for full-length cDNA amplification. In order to solve the technical problem that the linear amplification of MALBAC is easy to cause mutation and is not conducive to the identification of nascent RNA, the inventors screened and determined a DNA polymerase Deep and solved the technical problem that Deep is not active in the traditional amplification system of MALBAC. Thus, the present application first applies the linear amplification method to the detection of single-cell nascent RNA, and optimizes to obtain a method for detecting single-cell nascent RNA based on MALBAC linear amplification. Compared with the published single-cell nascent RNA detection technologies such as scSLAM, NASC-seq, scNT-seq, sci-Fate, Well-TEMP-seq, and Dyna-vivo-seq, the method of the present application has the highest detection data quality, and the accuracy and reliability of the detection results are further improved, and can be widely used in scientific research and medical detection.

[0208] For example, the method for detecting single-cell nascent RNA of the present application can be used for: 1. Studying the mechanism of transcription activation. For example, scTT-seq can more truly reflect the transcription dynamics of genes in a short time, thereby identifying genes with different transcription activities and revealing the potential mode or mechanism of gene expression regulation; 2. More quickly identifying the occurrence of cell stress response. Total RNA has time lag, and cannot directly and timely reflect the transcription dynamics of genes, while high-quality scTT-seq can detect the RNA generation and degradation dynamics of various types of cells in a short time under specific stimulation (virus infection, drug treatment, etc.), which is of great significance for understanding the effect of stimulation on cells; 3. More sensitively identifying different cell states, thereby discovering new cell subgroups. Cells in different states may have similar total RNA expression, but there are differences in RNA dynamics. scTT-seq can further reveal single-cell heterogeneity through different RNA dynamics; 4. Predicting cell fate. Based on a large amount of scTT-seq data, artificial intelligence algorithms can be established to predict the developmental trajectory of stem cells and the like; 5. Mapping of in vivo transcription dynamics. 4sU short-time labeling has low toxicity and can be used for labeling live mice, thereby obtaining real in vivo RNA transcription dynamics. Integrating scTT-seq data of various tissues in vivo may be an important step towards realizing "digital life" in the future.

[0209] The method for detecting single-cell nascent RNA of the present application can further reduce the library construction cost, and is conducive to the popularization and dissemination of single-cell nascent RNA detection technology; and can be integrated with other omics technologies, such as single-cell ATAC-seq, single-cell Hi-C, single-cell genome sequencing, and the like, which is conducive to the development of precious clinical samples or high-throughput single-cell sequencing related scientific research and medical detection.

[0210] Although the embodiments of the present application have been shown and described above, it is understood that the above-described embodiments are exemplary and are not to be construed as limiting the present application, and that variations, modifications, substitutions and changes can be made by those skilled in the art without departing from the scope of the present application.

Claims

1. A method for detecting RNA in newly formed single cells, characterized in that, Includes the following steps: a) Alkylation modification of 4sU-labeled nascent RNA was performed using iodoacetamide to obtain alkylated RNA; b) Using the alkylated RNA described in step a) as a template, reverse transcription of RNA is performed using RNA reverse transcriptase to obtain the reverse transcription product; the RNA reverse transcriptase is SuperScript. Discovery Hifair Or YeaCell single-cell RNA library preparation kit TM At least one of the RNA reverse transcriptases; Steps a) and b) are performed in the same reaction vessel.

2. The method according to claim 1, characterized in that, Based on the total reaction volume of the alkylation modification described in step a), the concentration of the iodoacetamide is 5–20 mM; and / or, Based on the total reaction volume of the RNA reverse transcription reaction described in step b), the concentration of the iodoacetamide is 0.5–2 mM; Furthermore, the solvent for the iodoacetamide is DMSO; Furthermore, based on the total reaction volume of the alkylation modification described in step a), the volume percentage concentration of the DMSO is 40–50%; and / or, Based on the total reaction volume of the RNA reverse transcription reaction described in step b), the volume percentage concentration of DMSO is 2.5% to 3.5%.

3. The method according to claim 1, characterized in that, It also includes the following steps: c) Based on the reverse transcription reaction product described in step b), perform full-length cDNA amplification to obtain the full-length cDNA amplification product. Steps a), b), and c) are performed in the same reaction vessel, and the reaction buffer for the RNA reverse transcriptase is composed of the following formulation: 50mM Tris-HCl pH 8.0, 50~100mM KCl, 3~6mM MgCl2, 5~20mM DTT; Furthermore, the reaction buffer for the RNA reverse transcriptase is composed of the following formula: 50 mM Tris-HCl pH 8.0, 70–80 mM KCl, 4–6 mM MgCl2, and 8–12 mM DTT; Optionally, the concentration of KCl is 75 mM; Optionally, the concentration of the MgCl2 is 6 mM; Optionally, the concentration of DTT is 10 mM; Preferably, the RNA reverse transcriptase is 4. The method according to claim 3, characterized in that, Step c) The full-length amplification of cDNA is achieved through TSO-mediated template strand substitution; Further, the reverse transcription reaction in step b) is performed based on a first reverse transcription primer and a TSO primer, the nucleotide sequence of the first reverse transcription primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the TSO primer is shown in SEQ ID NO: 2; Further, step c) also includes PCR amplification, which is performed based on ISPCR primers and DNA polymerase; the nucleotide sequence of the ISPCR primers is shown in SEQ ID NO: 3; Optionally, the DNA polymerase is DNA polymerase; Alternatively, in step c), the full-length cDNA amplification is performed using MALBAC linear amplification, wherein the DNA polymerase used in MALBAC linear amplification has 3'-5' exonuclease activity. Furthermore, the DNA polymerase is Deep... The Deep The reaction buffer contains Mg 2+ The MALBAC linear amplification reaction system does not contain additional Mg. 2+ ; Furthermore, the Deep In the reaction buffer, the Mg 2+ The concentration is 0.8–1.2 mM; Optionally, the Mg 2+ From MgSO4; Optionally, the Deep The reaction buffer is formulated as follows Composition: 8-12 mM Tris-HCl 8.0, 0.8-1.2 mM MgSO4, 4-6 mM KCl, 4-6 mM (NH4)2SO4, 0.04-0.06% Triton X-100; Further, the reverse transcription reaction in step b) is performed based on a second reverse transcription primer, the nucleotide sequence of which is shown in SEQ ID NO: 7; Further, the MALBAC linear amplification in step c) is performed based on random primers and coprimes, the nucleotide sequences of the random primers are shown in SEQ ID NO: 6, and the nucleotide sequences of the coprimes are shown in SEQ ID NO:

8.

5. The method according to claim 4, characterized in that, The method further includes the following steps: Tn5 fragmentation: Library construction PCR primers were added to the full-length cDNA amplification product by Tn5 fragmentation; Library construction PCR; Segment sorting; Sequencing of the final product; Furthermore, it also includes the following steps: Identification of newly generated RNA fragments with TC conversion; based on the results of the identification of the newly generated RNA fragments, assessment of RNA generation and degradation dynamics within the 4sU labeling time.

6. A reverse transcriptase product, characterized in that, include: RNA reverse transcriptase and its reaction buffer; The reaction buffer for the RNA reverse transcriptase is composed of the following formula: 50mM Tris-HCl pH 8.0, 50~100mM KCl, 3~6mM MgCl2, 5~20mM DTT.

7. The reverse transcriptase product according to claim 6, characterized in that, The reaction buffer for the RNA reverse transcriptase is composed of the following formula: 50mM Tris-HCl pH 8.0, 70~80mM KCl, 4~6mM MgCl2, 8~12mM DTT. Optionally, the concentration of KCl is 75 mM; Optionally, the concentration of the MgCl2 is 6 mM; Optionally, the concentration of DTT is 10 mM.

8. A kit for detecting RNA in newly formed single cells, characterized in that, include: The reagent used in the method according to any one of claims 1 to 5.

9. The reagent kit according to claim 8, characterized in that, The kit also includes an instruction manual, which contains the steps of the method according to any one of claims 1 to 5; Optionally, the reagent comprises the reverse transcriptase product according to any one of claims 6 to 7.

10. A system or apparatus for detecting RNA in newly formed single cells, characterized in that, The system or apparatus is operated based on the method described in any one of claims 1 to 5; or the system or apparatus comprises the kit described in any one of claims 8 to 9.

Images