Chili multi-branch gene CaBr1 linked KASP molecular marker as well as primer, kit and application of chilli multi-branch gene CaBr1 linked KASP molecular marker

By developing a KASP molecular marker linked to the branching gene CaBr1 in chili peppers, and designing primers using specific base substitutions on chili pepper chromosome 8, combined with a KASP kit for genotyping, the problem of low efficiency in chili pepper branching breeding was solved, enabling rapid and accurate identification of chili pepper branching traits and breeding assistance.

CN121249954AActive Publication Date: 2026-01-02HUNAN AGRI UNIV

Patent Information

Application Number
CN202511727127.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-24
Publication Date
2026-01-02
Estimated Expiration
2045-11-24

AI Technical Summary

Technical Problem

In existing technologies, the regulatory mechanisms of chili branching-related genes are unclear, resulting in low efficiency in chili branching breeding, long conventional breeding cycles, and susceptibility to environmental influences.

Method used

A KASP molecular marker linked to the branching gene CaBr1 in pepper was developed. Primers were designed using the G-to-A substitution at the 103175415th base on chromosome 8 of pepper. Combined with a KASP kit, the multi-branched phenotype of pepper was rapidly identified and assisted in breeding.

Benefits of technology

This study enabled rapid and accurate identification of branching traits in chili peppers, reduced the breeding cycle and workload, improved selection efficiency, and laid the foundation for research on the molecular mechanism of chili pepper plant type regulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121249954A_ABST
    Figure CN121249954A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of pepper planting, and discloses a pepper multi-branch gene CaBr1 linked KASP molecular marker as well as a primer, a kit and application thereof, the KASP molecular marker takes pepper S8 (zhangshuang) as a reference genome, and the single nucleotide polymorphism at the 103175415th basic group on the No.8 chromosome is subjected to basic group G-to-A replacement. A chromosome region closely linked with multiple branches of the pepper is obtained by using a BSA (Bovine Serum Albumin) population positioning method, a molecular marker is developed in a candidate region to determine a candidate gene CaBr1, a KASP molecular marker is screened according to base mutation of the candidate gene, and the marker is used for carrying out genotype identification on 90 randomly sampled single plants of an F2 population, and the coincidence rate reaches 100%. The result not only contributes to pepper branch phenotype identification and assistant breeding, but also lays a foundation for map-based cloning of the branch gene and analysis of a molecular mechanism of pepper plant type regulation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of pepper breeding and molecular biology, and particularly relates to a SNP molecular marker and primer (KASP) closely linked to the pepper branching gene CaBr1, as well as their application in predicting pepper plant architecture and molecular-assisted breeding. Background Technology

[0002] Chili pepper (Capsicum annuum L.) belongs to the genus Capsicum in the Solanaceae family and is one of the most important vegetable crops in China. Plant architecture is an important trait, playing a central role in plant growth and development. A good plant architecture can improve photosynthetic efficiency and increase yield. Branching, as an important component of plant architecture, not only affects fruit yield but also relates to field cultivation management (pruning, side-cutting, and mechanized harvesting). Therefore, it has become an important trait of concern to breeders, and research on the development mechanism of chili pepper branching has become a hot topic.

[0003] The development of gene sequencing technology and the publication of the pepper genome sequence have promoted the application of molecular breeding techniques in pepper, leading to the rapid development of pepper genomics. The localization and cloning of genes related to a series of important breeding traits have laid the foundation for the development and application of molecular markers in pepper breeding. Zhou Kunhua et al. established an interspecific mapping population containing 180 F2 individual plants using shrub pepper (C. frutescens) and annual pepper (C. annuum) as parents. This study detected two additive QTLs controlling the main stem height trait, which could explain 6.41%–19.08% of the phenotypic variation. Duan Mengmeng et al. constructed an intraspecific mapping population containing 128 recombinant inbred lines using two different varieties of annual pepper (C. annuum) as parents. This study detected three QTL loci controlling the plant height trait, with a contribution rate of 30.8%. Using chili inbred lines 'BB3' and 'G-1', as well as their F1 and F2 populations, Liu Xiadong conducted genetic analysis and QTL mapping studies on chili plant type-related traits (including main stem length, branch length, leaf size, petiole length, and branching angle). The length of the first branch was mapped to linkage group LG06, with a phenotypic contribution rate of 14.7%.

[0004] Although some QTLs related to chili pepper plant architecture have been identified, the mechanisms of action of these regulatory factors remain poorly understood, limiting their application and making them inefficient. Therefore, exploring the functions of key genes or QTLs for important agronomic traits such as branching in chili peppers, and developing branching-related molecular markers, is beneficial for breeding chili peppers with favorable plant architecture and lays the foundation for cloning branching regulatory genes and studying the molecular mechanisms of chili pepper plant architecture regulation. Summary of the Invention

[0005] The primary objective of this invention is to overcome the shortcomings and defects mentioned in the background art above and provide a SNP molecular marker (KASP marker) linked to the branching gene CaBr1 in chili peppers. This provides a new approach for screening, identifying, and assisting in the screening of multi-branched chili pepper plants, as well as for breeding chili peppers with good plant type.

[0006] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:

[0007] A KASP molecular marker linked to the chili pepper multibranching gene CaBr1 is a substitution of the base G to A at the 103175415th base on chromosome 8 of chili pepper S8 (zhangshugang) with reference to the chili pepper S8 (zhangshugang) genome (http: / / ted.bti.cornell.edu / cgi-bin / pepper / index).

[0008] A second objective of this invention is to provide a primer for identifying the KASP molecular marker, comprising:

[0009] Forward primer 1: GAAGGTGACCAAGTTCATGCTGCCTGACGGAGACCATAAAAGG;

[0010] Forward primer 2: GAAGGTCGGAGTCAACGGATTGCCTGACGGAGACCATAAAAGA;

[0011] Reverse primer: CATTGTGTCTAGTGTGTTTGGGTC.

[0012] Furthermore,

[0013] The two forward primers are connected to different fluorescent adapter sequences. The adapter sequence that matches FAM fluorescence in forward primer 1 is GAAGGTGACCAAGTTCATGCT, and the adapter sequence that matches HEX fluorescence in forward primer 2 is GAAGGTCGGAGTCAACGGATT.

[0014] A third objective of this invention is to provide a kit for identifying the multibranched phenotype of pepper, comprising reagents for detecting the KASP molecular marker linked to the pepper multibranched gene CaBr1.

[0015] The kit includes the primers.

[0016] A fourth objective of this invention is to provide the application of the aforementioned kit in identifying multibranched and upright plant types in peppers or in molecular-assisted breeding. This facilitates the identification of branching phenotypes in peppers and assists in breeding, and lays the foundation for map-based cloning of branching genes and elucidation of the molecular mechanisms regulating pepper plant type.

[0017] Specifically, the following steps are included:

[0018] S1: Extract DNA from the chili pepper sample to be tested as a template;

[0019] S2: Add the primers described in claim 2 or 3 for PCR amplification;

[0020] S3: Use KASP reagent for typing and read the typing results.

[0021] Furthermore,

[0022] When genotyping the amplification products, if only the blue fluorescent signal corresponding to the forward primer 1 connected to the fluorescent adapter sequence is detected in the amplification products, the detection site is the G:G genotype, and the pepper is determined to be a dominant erect plant. If only the green fluorescent signal corresponding to the forward primer 2 connected to the fluorescent adapter sequence is detected in the amplification products, the detection site is the A:A genotype, and the pepper is determined to be a recessive multibranched plant. If the fluorescent signals corresponding to both forward primers 1 and 2 connected to the fluorescent adapter sequences are detected in the amplification products, the detection site is the G:A genotype, and the pepper is determined to be a heterozygous plant.

[0023] Preferably, PARMS PCR amplification is performed using quantitative PCR equipment. When the fluorophore and its corresponding fluorescence quencher are close together, the fluorescence emitted by the fluorophore will be absorbed by the quencher, resulting in the emission of fluorescence at a longer wavelength or the release of heat. In this case, the fluorescence signal of the fluorophore cannot be detected within the wavelength corresponding to this fluorescence. Once the two are separated, the fluorescence signal can be detected. PARMS uses the FRET principle to detect the amplification signals of FAM and HEX fluorescent primers; when the corresponding allele is amplified, a corresponding fluorescence signal will appear.

[0024] Preferably, the PCR amplification program is as follows: Preincubation 94℃ 900S; 94℃ 20S, 78℃ 10S, TD 62℃, 0 Cyc->57 (-0℃), 10 cycles; 94℃ 20S, 57℃ 60S, 35 cycles; Cooling 37℃ 30S.

[0025] The KASP molecular marker screening method of the present invention includes the following steps:

[0026] (1) Resequencing of pepper materials was performed, and a genome-wide association analysis was conducted on the branching trait of pepper based on the resequencing results. On this basis, the high-generation inbred line of the upright plant type of pepper was used as the male parent and the high-generation inbred line of the multi-branched plant type of pepper was used as the female parent to construct the F2 population.

[0027] (2) Branching phenotype identification was performed on the F2 population. The mixed pool segregation analysis population localization method was used to obtain mixed pools of multi-branched plant types and upright plant types, respectively. BSA-seq sequencing was performed, and the sequencing results were analyzed by bioinformatics to obtain candidate chromosome regions linked to pepper branching.

[0028] (3) Molecular marker technology was developed to narrow down the candidate regions by substitution / insertion / deletion of single bases in the candidate regions of the chromosome, and finally KASP molecular markers closely linked to the pepper branching gene CaBr1 were obtained.

[0029] This invention provides a chili branching gene CaBr1, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0030] The KASP molecular marker linked to the chili branching gene CaBr1 described above preferably has the nucleotide sequence shown in SEQ ID NO: 2.

[0031] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0032] 1. This invention screened a KASP molecular marker that can be directly used to identify pepper branching, and then used for assisted breeding based on this molecular marker. This can effectively solve the problems of long breeding cycles and susceptibility to environmental influences in conventional breeding, and has important significance in pepper branching breeding practice and plant type regulation mechanism research. Using this marker, genotype identification of 90 randomly sampled individual plants in the F2 population was carried out, and the concordance rate reached 100%. This result not only helps in the identification of pepper branching phenotype and assisted breeding, but also lays the foundation for map-based cloning of branching genes and analysis of the molecular mechanism of pepper plant type regulation.

[0033] 2. By utilizing this molecular marker early on, satisfactory plants can be quickly screened, effectively reducing the planting scale, decreasing the workload of later identification, and improving the efficiency and accuracy of selection. This is of great significance for studying the mechanism of branching regulation in peppers. Attached Figure Description

[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0035] Figure 1 The parental phenotypes for upright and multi-branched chili pepper plants.

[0036] Figure 2 Location of the CaBr1 gene. Detailed Implementation

[0037] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0038] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0039] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0040] Example:

[0041] This invention utilizes two highly homozygous materials to construct an F2 population. Mixed-pool segregation analysis (BSA) was used to locate chromosomal regions closely linked to the branching trait in peppers. Molecular markers were developed within candidate regions to identify the candidate gene CaBr1, whose coding nucleotide sequence is shown in SEQ ID NO: 1. A KASP molecular marker was screened based on base mutations in the candidate gene and can be directly used to identify the branching trait in peppers. This marker-assisted breeding effectively addresses the problems of long conventional breeding cycles and susceptibility to environmental influences. Early use of this molecular marker allows for rapid screening of satisfactory plants, effectively reducing planting scale, decreasing the workload of later identification, and improving selection efficiency and accuracy.

[0042] The method for obtaining the KASP molecular marker linked to the CaBr1 multibranching gene in chili pepper is as follows:

[0043] 1. Construction of genetic populations

[0044] In the early stages of this invention, a mutant resource "LY119" with a significantly increased number of branches in peppers was screened from the '19CL148' mutant library. Phenotypic observation and physicochemical index determination revealed that, except for a significantly higher number of branches compared to the wild type, other traits of the mutant were essentially the same. F1 and F2 populations were constructed and planted using the mutant and its wild type as parents. The number of lateral branches in the parents, F1, and F2 was statistically analyzed. Plants with fewer than 10 lateral branches were classified as upright, while those with more than 30 were classified as multi-branched. Genetic analysis showed that the F1 population exhibited no phenotypic segregation, had fewer branches, and was an upright plant type. The F2 population contained 397 upright plants and 122 multi-branched plants, with a segregation ratio of 3.25:1. A chi-square test (χ² test) confirmed this segregation. 2 =0.617, which meets the 3:1 (χ²) 2 The segregation ratio was <3.86). The above genetic analysis results indicate that the multibranching mutant phenotype is controlled by a single recessive gene pair.

[0045] 2. Identification of branching characteristics in chili peppers

[0046] The number of lateral branches in mature plants of mutant “LY119” and wild-type “19CL148” was determined.

[0047] 3. Branching gene localization

[0048] Twenty-five individual plants from each of the upright and multi-branched plant types in the F2 population were selected, and leaf DNA was extracted from each. After quality control, the DNA samples were mixed in equal amounts to construct the upright and multi-branched plant type pools. Whole-genome resequencing was performed on the Illumina sequencing platform for the two pools (sequencing depth of 30×) and the two parents (sequencing depth of 10×). Based on the SNP information within the initially located regions, KASP marker primers were developed using Geneious software. Linkage analysis was performed using join map 4.0 along with the genotyping results. QTL prediction was performed using map-QTL software in conjunction with the genetic map to finely locate CaBr1.

[0049] 4. Development of molecular markers linked to multi-branched plant types

[0050] Annotation information of genes within fine-mapping regions was analyzed to identify functionally relevant genes. Total RNA was extracted from different tissues of mutants and wild-type individuals, and the RNA was mixed separately and reverse transcribed into cDNA. Based on candidate gene sequences in the reference genome, primers were designed using Geneious, and PCR amplification was performed using parental cDNA as templates. The amplified products were purified and then TA cloned and sequenced. The sequencing alignment was correct, completing the full-length CDS cloning of the candidate genes. The nucleotide sequence of the CaBr1 coding region is shown in SEQ ID NO: 1. The sequence of this gene was further cloned, and sequencing revealed a one-base variation at position 638, a G-to-A substitution. KASP marker primers were designed for this variation site, and they were found to effectively distinguish between the multibranched plant type, the upright plant type, and the F1 generation. Genotyping was performed on 90 random individuals from the F2 population, and the phenotypic concordance rate was 100%. The KASP molecular marker is a single nucleotide polymorphism at the 103175415th base on chromosome 8 of pepper, where a G-to-A substitution occurs. The nucleotide sequence of the KASP marker is shown in SEQ ID NO: 2, where the 22nd base of SEQ ID NO: 2 undergoes a G-to-A substitution.

[0051] SEQ ID NO: 1:

[0052]

[0053] SEQ ID NO: 2:

[0054] GCCTGACGGAGACCATAAAAG G CTTCAATTGTGATTGACCCAAACACACTAGACACAATG

[0055] 5. Application of molecular markers linked to multi-branched plant types

[0056] (1) DNA was extracted from 90 individual plants in the F2 population using the CTAB method.

[0057] a. Add dithiothreitol (DTT, 0.2%) to the CTAB extract.

[0058] b. Add two fresh leaves (the size of the centrifuge tube cap) to a 2.0 ml centrifuge tube; grind them thoroughly into powder with liquid nitrogen, add 800-900 µL of LCTAB buffer, and mix well;

[0059] c. Incubate in a 65℃ water bath for 30 minutes to 1 hour, gently inverting and shaking 1-3 times during the bath. After the water bath, cool to 4℃ or room temperature to below 15℃.

[0060] d. Add 500 chloroform / isoamyl alcohol (24:1) and mix thoroughly for 2-5 minutes to ensure that the sample is fully mixed with chloroform;

[0061] e. Centrifuge at 12,000 rpm for 10 min. Take 500 µL of the supernatant and add it to a 1.5 ml centrifuge tube containing 500 µL of isopropanol. Gently invert the tube to mix. Let stand in a refrigerator at 4 °C or -20 °C for at least 30 min.

[0062] f. Centrifuge at 12,000 rpm for 10-20 min and discard the supernatant; wash the precipitate with 500 μL of 75% alcohol, centrifuge at 12,000 rpm for 5 min and discard the supernatant;

[0063] g. Air-dry the DNA thoroughly to allow the alcohol to evaporate completely; add 100µL of pure water (containing 1% RNase to a final concentration) to dissolve the DNA;

[0064] h. Remove RNA by incubating in a 37℃ water bath or at room temperature for 1 hour; collect DNA for electrophoresis detection. After confirming the integrity of the bands, determine the DNA concentration using a micro spectrophotometer. The ratio of 260 / 280 and 260 / 230 should be greater than 1.8. Dilute the DNA to 100 ng and store at -20℃ for later use.

[0065] (2) KASP marker typing of F2 population single plants

[0066] a. KASP primers typically consist of three primers: two allele-specific forward primers and one universal reverse primer. The two allele-specific forward primers differ only in their 3' ends, corresponding to different alleles. The allele-specific forward primers produce different fluorescent signals in a competitive PCR reaction. The adapter sequence matching FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the adapter sequence matching HEX fluorescence is GAAGGTCGGAGTCAACGGATT.

[0067] KASP primers were designed by SNPWay (http: / / www.snpway.com / ):

[0068] CaBr1-F1: 5'-GAAGGTGACCAAGTTCATGCTGCCTGACGGAGACCATAAAAGG-3';

[0069] CaBr1-F2: 5'-GAAGGTCGGAGTCAACGGATTGCCTGACGGAGACCATAAAAGA-3';

[0070] CaBr1-R: 5'-CATTGTGTCTAGTGTGTTTGGGTC-3';

[0071] b. KASP primers were synthesized from Qingke Biotechnology (PAGE purified);

[0072] c. The classification system is shown in Table 1 below:

[0073]

[0074] Amplification procedure:

[0075] Preincubation: 94℃ 900s; 94℃ 20s, 78℃ 10s, TD 62℃, 0 Cyc->57 (-0℃), 10 cycles; 94℃ 20s, 57℃ 60s, 35 cycles; Cooling: 37℃ 30s.

[0076] (3) Classification results

[0077] When genotyping the amplification products, if only the blue fluorescent signal corresponding to the forward primer 1 connected to the fluorescent adapter sequence is detected in the amplification products, the detection site is the G:G genotype, and the pepper is determined to be a dominant erect plant. If only the green fluorescent signal corresponding to the forward primer 2 connected to the fluorescent adapter sequence is detected in the amplification products, the detection site is the A:A genotype, and the pepper is determined to be a recessive multibranched plant. If the fluorescent signals corresponding to both forward primers 1 and 2 connected to the fluorescent adapter sequences are detected in the amplification products, the detection site is the G:A genotype, and the pepper is determined to be a heterozygous plant.

[0078] The branching pattern of individual plants in the F2 population was identified using KASP markers. The branching phenotypes and genotypes of 90 individual plants in the F2 population constructed from 19CL148 and LY119 are shown in Table 2. The genotype identification results were 100% consistent with the phenotypic identification results.

[0079]

[0080]

[0081]

Claims

1. A KASP molecular marker that is linked to the Capsicum baccatum branching gene CaBrl, characterized in that, is a substitution of base G to A at the 103175415th base on chromosome 8 of Capsicum annuum.

2. A primer for identifying the KASP molecular marker of claim 1, characterized in that, comprises: forward primer 1: GAAGGTGACCAAGTTCATGCTGCCTGACGGAGACCATAAAAGG; forward primer 2: GAAGGTCGGAGTCAACGGATTGCCTGACGGAGACCATAAAAGA; reverse primer: CATTGTGTCTAGTGTGTTTGGGTC.

3. The primer of claim 2, wherein, The two forward primers are respectively connected with different fluorescent linker sequences, and the linker sequence matched with FAM fluorescence in the forward primer 1 is GAAGGTGACCAAGTTCATGCT, and the linker sequence matched with HEX fluorescence in the forward primer 2 is GAAGGTCGGAGTCAACGGATT.

4. A kit for identifying the bushy phenotype of pepper plants, characterized in that, The reagent for detecting the KASP molecular marker linked to the CaBr1 gene of Capsicum annuum according to claim 1.

5. The kit of claim 4, wherein The primer according to claim 2 or 3.

6. The use of the kit according to claim 4 or 5 in identifying the multi-branching and erect plant type of Capsicum annuum or in molecular assisted breeding.

7. Use according to claim 6, characterized in that, comprises the following steps: S1: extracting DNA of the Capsicum annuum sample to be tested as a template; S2: adding the primer according to claim 2 or 3 to perform PCR amplification; S3: performing typing by using the KASP reagent and reading the typing results.

8. Use according to claim 7, characterized in that, When the amplified product is genotyped, if only the blue fluorescence signal corresponding to the forward primer 1 connected with the fluorescent linker sequence is detected in the amplified product, the detection site is G:G genotype, and it is determined that the Capsicum annuum is a dominant erect plant; if only the green fluorescence signal corresponding to the forward primer 2 connected with the fluorescent linker sequence is detected in the amplified product, the detection site is A:A genotype, and it is determined that the Capsicum annuum is a recessive multi-branching plant; if the fluorescence signals corresponding to the forward primers 1 and 2 connected with the fluorescent linker sequences are simultaneously detected in the amplified product, the detection site is G:A genotype, and it is determined that the Capsicum annuum is a hybrid plant.

Citation Information

Patent Citations

  • Chili maturity SNP (Single Nucleotide Polymorphism) molecular marker and application thereof

    CN108486276A

  • SNP loci and primer groups for identifying purity of pepper hybrids and application

    CN112195265A

  • Pepper CaLS1 gene and protein and application thereof

    CN117051005A

  • KASP molecular marker closely linked with capsicum fruit color gene CaCHL1 as well as primer, kit, obtaining method and application of KASP molecular marker closely linked with capsicum fruit color gene CaCHL1

    CN119553004A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to capsicum fruit branch single clustered growth and application of SNP molecular marker

    CN120249553A

Cited By

  • KASP molecular marker closely linked with pepper leaf curl, primer, kit and application

    CN121780768A

  • KASP molecular markers, primers, kits and applications closely linked to pepper leaf curling

    CN121780768B

  • Molecular marker located in chromosome 5 and related to soybean branch number and application of molecular marker

    CN121874398A