Application of fructus psoraleae vesicles in prevention and treatment of orthopedic diseases
By preparing and applying psoralen vesicles, the problems of large side effects and high costs in the treatment of osteoporosis have been solved, achieving safe and effective treatment of osteoporosis and promoting osteoblast differentiation and proliferation.
Patent Information
- Application Number
- CN202410904812.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-05
- Publication Date
- 2026-01-06
AI Technical Summary
Existing osteoporosis treatments suffer from significant side effects, high costs, and poor adherence, lacking safe, effective, and low-cost treatment options.
Psoralen vesicles are prepared through specific steps including washing, crushing, centrifugation, and separation with gradient sugar solutions to obtain psoralen vesicles with different sugar concentrations. These vesicles are used to prepare bone-targeting agents and osteoblast proliferation/differentiation promoters, in combination with other drugs such as bone resorption inhibitors and bone formation promoters.
Psoralen vesicles can safely and effectively promote osteoblast differentiation and proliferation, and are used to prevent and treat osteoporosis, reducing drug side effects and treatment costs.
Smart Images

Figure CN121265673A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of pharmaceutical technology, specifically to the use of psoralen vesicles in the prevention and treatment of orthopedic diseases. Background Technology
[0002] Osteoporosis (OP) is defined as a systemic skeletal disease that primarily affects postmenopausal women. It is characterized by deterioration of bone microstructure and low bone mass, leading to increased bone fragility and fracture risk, representing a new medical and socioeconomic burden. Globally, over 200 million people suffer from osteoporotic fractures. In Europe and the United States, 30% of women, 30% of men, and 40% of postmenopausal women have osteoporosis and are at high risk of osteoporotic fractures. Currently, the treatment of osteoporosis and its related complications is extremely expensive worldwide, placing a heavy economic burden on society and families. Therefore, finding safe, effective, low-toxicity, and cost-effective drugs for the prevention and treatment of osteoporosis has become a hot research topic.
[0003] Prevention and treatment of osteoporosis mainly include basic measures and drug therapy. Basic measures include lifestyle modifications, calcium supplementation, and vitamin D supplementation. Drug therapy mainly falls into two categories: one category promotes bone formation, such as parathyroid hormone, fluoride, steroids, and isoflavones, but long-term use of these drugs can lead to serious side effects such as stroke, hypercalcemia, hypercalciuria, and osteosarcoma; the other category inhibits bone resorption, such as estrogen and its analogues, bisphosphonates, and calcium supplements. While these drugs can significantly slow the decline in bone density, they also inhibit bone formation. Long-term use can excessively suppress bone remodeling, increasing the recurrence rate of fragility fractures and causing side effects such as breast cancer and thrombotic diseases, as well as rare complications such as esophageal irritation and osteonecrosis of the jaw. Therefore, the search for highly effective drugs with few side effects and good long-term tolerability, the development of standardized treatment strategies, and the improvement of adherence to osteoporosis drug therapy are important challenges for the future. Summary of the Invention
[0004] Based on this, the present invention provides the use of psoralen vesicles in the preparation of medicaments for the prevention and / or treatment of orthopedic diseases.
[0005] Furthermore, the preparation method of the psoralen vesicles includes the following steps:
[0006] (1) Weigh an appropriate amount of Psoralea corylifolia medicinal material, wash it clean with water, add an appropriate amount of buffer solution, crush it, filter it, centrifuge it once, take the first supernatant for a second centrifugation, take the second supernatant for a third centrifugation, and obtain the first precipitate; and
[0007] (2) The first precipitate was resuspended in buffer solution and filtered to obtain the psoralen vesicle.
[0008] Furthermore, the water is distilled water or purified water.
[0009] Furthermore, the weight of the psoralea corylifolia herb is 250–450g, for example, about 350g.
[0010] Furthermore, the buffer is selected from one or more of the following: phosphate buffer, citrate buffer, carbonate buffer, acetate buffer, barbiturate buffer, and tris(hydroxymethyl)aminomethane buffer (Tris).
[0011] Furthermore, the buffer is phosphate-buffered saline (PBS).
[0012] Furthermore, the volume of the buffer solution in step (1) is 500 to 1000 ml, for example, about 600 ml.
[0013] Furthermore, the mass / volume (g / ml) ratio between the psoralea corylifolia herb and the buffer solution in step (1) is 0.4 to 0.7, for example, about 0.583.
[0014] Furthermore, the volume of the buffer solution in step (2) is 1 to 5 ml, for example, about 2 ml.
[0015] Furthermore, the mass / volume (g / ml) ratio between the psoralea corylifolia herb and the buffer solution in step (1) is 150 to 200, for example, about 175.
[0016] Furthermore, the crushing is performed using a high-speed blender.
[0017] Furthermore, the filtration in step (1) is gauze filtration.
[0018] Furthermore, the filter membrane used in step (2) is a sterile water-based filter membrane.
[0019] Furthermore, the diameter of the sterile water filter membrane is 0.45 μm.
[0020] Furthermore, the centrifugation method is differential centrifugation.
[0021] Furthermore, the machine used for this first centrifugation was a refrigerated centrifuge.
[0022] Furthermore, the machine used for the second centrifugation was an ultracentrifuge.
[0023] Furthermore, the machine used for the third centrifugation was an ultracentrifuge.
[0024] Furthermore, the centrifugal force of this first centrifugation is 2000×g to 4000×g, for example, about 3000×g.
[0025] Furthermore, the centrifugal force of this second centrifugation is 14000×g to 16000×g, for example, about 15000×g.
[0026] Furthermore, the centrifugal force of this third centrifugation is 140,000 × g to 160,000 × g, for example, about 150,000 × g.
[0027] Furthermore, the first centrifugation time is 10–30 minutes, for example, about 20 minutes.
[0028] Furthermore, the second centrifugation time is 0.5 to 1.5 hours, for example, about 1 hour.
[0029] Furthermore, the third centrifugation takes 1.5 to 2.5 hours, for example, about 2 hours.
[0030] Furthermore, the preparation method further includes the following steps:
[0031] (3) Add the psoralen vesicles to sugar solutions of various concentrations. After the fourth centrifugation, dispense them into centrifuge bottles, add buffer solution, perform the fifth centrifugation, collect the second precipitate, and resuspend the second precipitate with buffer solution to obtain psoralen vesicle strip layers of different sugar concentrations.
[0032] Furthermore, the sugar solution is a sucrose solution.
[0033] Furthermore, the sucrose solution has gradient concentrations of 5%–15%, 20%–40%, 35%–60%, and 50%–70%, for example, about 8%, about 30%, about 45%, and about 60%.
[0034] Furthermore, the buffer is selected from one or more of the following: phosphate buffer, citrate buffer, carbonate buffer, acetate buffer, barbiturate buffer, and tris(hydroxymethyl)aminomethane buffer (Tris).
[0035] Furthermore, the buffer is phosphate-buffered saline (PBS).
[0036] Furthermore, the centrifugal force of this fourth centrifugation is 50,000 × g to 250,000 × g, for example, about 150,000 × g.
[0037] Furthermore, the fourth centrifugation takes 1.5 to 2.5 hours, for example, about 2 hours.
[0038] Furthermore, the centrifugal force of this fifth centrifugation is 50,000 × g to 200,000 × g, for example, about 100,000 × g.
[0039] Furthermore, the fifth centrifugation takes 20–70 minutes, for example, about 45 minutes.
[0040] Furthermore, the method further includes the step of cryopreserving the psoralen vesicle strips with different sugar concentrations.
[0041] Furthermore, the cryopreservation temperature is -60°C to -100°C, for example, about -80°C.
[0042] Furthermore, the drug further comprises one or more drugs and / or extracts for the prevention and / or treatment of orthopedic diseases.
[0043] Furthermore, the drug includes bone resorption inhibitors, bone formation promoters, bone mineralization promoters, vitamin K2 derivatives, and / or strontium salts.
[0044] Furthermore, the bone resorption inhibitor is selected from one or more of the following: bisphosphonates, calcitonin, estrogen, selective estrogen receptor modulators (SERMs), and nuclear factor-κB receptor activator ligand (RANKL) formulations.
[0045] Furthermore, this bisphosphonate drug includes zoledronic acid.
[0046] Furthermore, the calcitonin class of drugs includes salmon calcitonin and / or eel calcitonin.
[0047] Furthermore, these selective estrogen receptor modulators (SERMs) include raloxifene.
[0048] Furthermore, the bone formation promoter includes a parathyroid hormone analog (PTHa).
[0049] Furthermore, this parathyroid hormone analog (PTHa) includes teriparatide [PTH(1-34)].
[0050] Furthermore, the bone mineralization promoter includes calcium preparations and / or active vitamin D and its analogues.
[0051] Furthermore, this vitamin K2 class of drugs includes tetraenenaphthoquinone.
[0052] Furthermore, this strontium salt drug includes strontium ranelate.
[0053] According to another aspect of the invention, there is a use of psoralen vesicles in the preparation of bone-targeting formulations.
[0054] Furthermore, the bone-targeting formulation further includes other drugs for the prevention and / or treatment of orthopedic diseases.
[0055] Furthermore, other drugs for the prevention and / or treatment of orthopedic diseases are loaded into psoralen vesicles.
[0056] Furthermore, this orthopedic disease is associated with the inhibition of osteoblast proliferation.
[0057] Furthermore, this orthopedic disease is associated with the inhibition of osteoblast differentiation.
[0058] Furthermore, the orthopedic condition is osteoporosis.
[0059] According to another aspect of the invention, there is provided the use of psoralen vesicles in the preparation of osteoblast proliferation promoters.
[0060] According to another aspect of the invention, there is provided the use of psoralen vesicles in the preparation of osteoblast differentiation promoters.
[0061] The beneficial effects of this invention are:
[0062] The psoralen vesicles of the present invention can promote osteoblast differentiation and proliferation, and can be used to prevent and / or treat orthopedic diseases such as osteoporosis. Attached Figure Description
[0063] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without exceeding the scope of protection claimed by the present invention.
[0064] Figure 1 This is a schematic diagram showing the results of psoralen vesicle strip layers with different sugar concentrations.
[0065] Figure 2 This is a schematic diagram of the NTA characterization results of psoralen vesicles.
[0066] Figure 3 This is a schematic diagram of the TEM characterization results of psoralen vesicles.
[0067] Figure 4 A schematic diagram of the results of LC-MS identification of the contents of psoralen vesicles.
[0068] Figure 5 A schematic diagram illustrating the effect of psoralen vesicles on promoting osteoblast differentiation.
[0069] Figure 6 A schematic diagram illustrating the effect of psoralen vesicles on promoting osteoblast proliferation. Detailed Implementation
[0070] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0071] Unless otherwise stated, all technical and scientific terms and abbreviations used herein have the meanings commonly understood by one of ordinary skill in the field of this invention or the field of application of such terms. While any methods, conditions, substances, or materials similar to or equivalent to those disclosed herein may be used in the practice of this invention, preferred methods, conditions, substances, or materials are described herein.
[0072] This invention is intended to cover all options, variations, and equivalents that may be included in the field of prior art as defined in the claims. Those skilled in the art will recognize many similar or equivalent methods and substances described herein that can be applied in the practice of this invention. This invention is by no means limited to the description of methods and substances.
[0073] The singular forms “a,” “an,” and “the” used in the specification and appended claims include plural indicators unless the context clearly specifies otherwise.
[0074] In this invention, the term "comprising" and "including" are synonymous. The terms "comprising," "including," "having," "containing," or any other variations thereof as used herein are intended to cover a non-exclusive inclusion. For example, a composition, step, method, article, or apparatus that includes the listed elements is not necessarily limited to those elements, but may include other elements not expressly listed or elements inherent to such a composition, step, method, article, or apparatus.
[0075] As described in the background section, there is a lack of safe, effective, low-toxicity, and cost-effective drugs for osteoporosis. To address these issues, the present invention provides the use of psoralen vesicles in the preparation of medicaments for the prevention and / or treatment of orthopedic diseases.
[0076] Furthermore, the preparation method of the psoralen vesicles includes the following steps:
[0077] (1) Weigh an appropriate amount of Psoralea corylifolia medicinal material, wash it clean with water, add an appropriate amount of buffer solution, crush it, filter it, centrifuge it once, take the first supernatant for a second centrifugation, take the second supernatant for a third centrifugation, and obtain the first precipitate; and
[0078] (2) The first precipitate was resuspended in buffer solution and filtered to obtain the psoralen vesicle.
[0079] Furthermore, the water is distilled water or purified water.
[0080] Furthermore, the weight of the psoralea corylifolia herb is 250–450g, for example, about 350g.
[0081] In this invention, when mass, volume, ratio, centrifugal force, concentration, temperature, or other values or parameters are expressed as a range, preferred range, or a range defined by a series of upper and lower preferred values, this should be understood as specifically disclosing all ranges formed by any pairing of any upper or preferred value with any lower or preferred value, regardless of whether the range is disclosed individually. For example, when the range “250–450” is disclosed, the described range should be interpreted as including ranges “250–450”, “250–400”, “250–350”, “250–300”, “300–450”, “300–400”, “300–350”, “350–450”, “350–400”, “400–450”, etc. When numerical ranges are described herein, unless otherwise stated, the range is intended to include its endpoints and all integers and fractions within that range.
[0082] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 350" includes ±5% of 350, or from 332.5 to 367.5.
[0083] In a preferred embodiment, the buffer is selected from one or more of the following: phosphate buffer, citrate buffer, carbonate buffer, acetate buffer, barbiturate buffer, and tris(hydroxymethyl)aminomethane buffer (Tris).
[0084] In a preferred embodiment, the buffer is phosphate-buffered saline (PBS).
[0085] In a preferred embodiment, the volume of the buffer solution in step (1) is 500 to 1000 ml, for example, about 600 ml.
[0086] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 600" includes ±5% of 600, or from 570 to 630.
[0087] In a preferred embodiment, the mass / volume (g / ml) ratio between the psoralea corylifolia herb and the buffer solution in step (1) is 0.4 to 0.7, for example, about 0.583.
[0088] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 0.583" includes ±5% of 0.583, or from 0.55385 to 0.61215.
[0089] In a preferred embodiment, the volume of the buffer solution in step (2) is 1 to 5 ml, for example, about 2 ml.
[0090] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 2" includes 2 ± 5%, or from 1.9 to 2.1.
[0091] In a preferred embodiment, the mass / volume (g / ml) ratio between the psoralea corylifolia herb and the buffer solution in step (1) is 150 to 200, for example, about 175.
[0092] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 175" includes ±5% of 175, or from 166.25 to 183.75.
[0093] In a preferred embodiment, the crushing is performed using a high-speed blender.
[0094] In a preferred embodiment, the filtration in step (1) is gauze filtration.
[0095] In a preferred embodiment, the filter membrane used in step (2) is a sterile aqueous filter membrane.
[0096] In a preferred embodiment, the diameter of the sterile aqueous filter membrane is 0.45 μm.
[0097] In a preferred embodiment, the centrifugation method is differential centrifugation.
[0098] In a preferred embodiment, the machine used for the first centrifugation is a refrigerated centrifuge.
[0099] In a preferred embodiment, the machine for the second centrifugation is an ultracentrifuge.
[0100] In a preferred embodiment, the machine for the third centrifugation is an ultracentrifuge.
[0101] In a preferred embodiment, the centrifugal force of the first centrifugation is 2000×g to 4000×g, for example, about 3000×g.
[0102] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 3000" includes ±5% of 3000, or from 2850 to 3150.
[0103] In a preferred embodiment, the centrifugal force of the second centrifugation is 14000×g to 16000×g, for example, about 15000×g.
[0104] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 15000" includes ±5% of 15000, or from 14250 to 15750.
[0105] In a preferred embodiment, the centrifugal force of the third centrifugation is 140,000 × g to 160,000 × g, for example, about 150,000 × g.
[0106] In this invention, “about” refers to a value within a range of ±5% of a specific value. For example, “about 150,000” includes ±5% of 150,000, or from 142,500 to 157,500.
[0107] In a preferred embodiment, the first centrifugation time is 10 to 30 minutes, for example, about 20 minutes.
[0108] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 20" includes ±5% of 20, or from 19 to 21.
[0109] In a preferred embodiment, the second centrifugation takes 0.5 to 1.5 hours, for example, about 1 hour.
[0110] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 1" includes ±5% of 1, or from 0.95 to 1.05.
[0111] In a preferred embodiment, the third centrifugation takes 1.5 to 2.5 hours, for example, about 2 hours.
[0112] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 2" includes 2 ± 5%, or from 1.9 to 2.1.
[0113] In a preferred embodiment, the preparation method further includes the following steps:
[0114] (3) Add the psoralen vesicles to sugar solutions of various concentrations. After the fourth centrifugation, dispense them into centrifuge bottles, add buffer solution, perform the fifth centrifugation, collect the second precipitate, and resuspend the second precipitate with buffer solution to obtain psoralen vesicle strip layers of different sugar concentrations.
[0115] In a preferred embodiment, the sugar solution is a sucrose solution.
[0116] In a preferred embodiment, the sucrose solution has gradient concentrations of 5%–15%, 20%–40%, 35%–60%, and 50%–70%, for example, about 8%, about 30%, about 45%, and about 60%.
[0117] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 8%" includes 8% ± 5%, or from 7.6% to 8.4%; "about 30%" includes 30% ± 5%, or from 28.5% to 31.5%; "about 45%" includes 45% ± 5%, or from 42.75% to 47.25%; and "about 60%" includes 60% ± 5%, or from 57% to 63%.
[0118] In a preferred embodiment, the buffer is selected from one or more of the following: phosphate buffer, citrate buffer, carbonate buffer, acetate buffer, barbiturate buffer, and tris(hydroxymethyl)aminomethane buffer (Tris).
[0119] In a preferred embodiment, the buffer is phosphate-buffered saline (PBS).
[0120] In a preferred embodiment, the centrifugal force of the fourth centrifugation is 50,000 × g to 250,000 × g, for example, about 150,000 × g.
[0121] In this invention, “about” refers to a value within a range of ±5% of a specific value. For example, “about 150,000” includes ±5% of 150,000, or from 142,500 to 157,500.
[0122] In a preferred embodiment, the fourth centrifugation takes 1.5 to 2.5 hours, for example, about 2 hours.
[0123] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 2" includes 2 ± 5%, or from 1.9 to 2.1.
[0124] In a preferred embodiment, the centrifugal force of the fifth centrifugation is 50,000 × g to 200,000 × g, for example, about 100,000 × g.
[0125] In this invention, “about” refers to a value within a range of ±5% of a specific value. For example, “about 100,000” includes ±5% of 100,000, or from 95,000 to 105,000.
[0126] In a preferred embodiment, the fifth centrifugation takes 20 to 70 minutes, for example, about 45 minutes.
[0127] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 45" includes ±5% of 45, or from 42.75 to 47.25.
[0128] In a preferred embodiment, the method further includes the step of cryopreserving the psoralen vesicle strips with different sugar concentrations.
[0129] In a preferred embodiment, the cryopreservation temperature is -60°C to -100°C, for example, about -80°C.
[0130] In this invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about -80" includes ±5% of -80, or from -84 to -76.
[0131] In a preferred embodiment, the medicament further comprises one or more drugs and / or extracts for the prevention and / or treatment of orthopedic diseases.
[0132] In a preferred embodiment, the drug includes bone resorption inhibitors, bone formation promoters, bone mineralization promoters, vitamin K2 drugs, and / or strontium salt drugs.
[0133] In a preferred embodiment, the bone resorption inhibitor is selected from one or more of the following: bisphosphonates, calcitonin, estrogen, selective estrogen receptor modulators (SERMs), and nuclear factor-κB receptor activator ligand (RANKL) formulations.
[0134] In a preferred embodiment, the bisphosphonate drug includes zoledronic acid.
[0135] In a preferred embodiment, the calcitonin drug includes salmon calcitonin and / or eel calcitonin.
[0136] In a preferred embodiment, the selective estrogen receptor modulator (SERM) includes raloxifene.
[0137] In a preferred embodiment, the bone formation promoter includes a parathyroid hormone analog (PTHa).
[0138] In a preferred embodiment, the parathyroid hormone analog (PTHa) comprises teriparatide [PTH(1-34)].
[0139] In a preferred embodiment, the bone mineralization promoter includes calcium and / or active vitamin D and its analogues.
[0140] In a preferred embodiment, the vitamin K2 drug includes tetraene-naphthoquinone.
[0141] In a preferred embodiment, the strontium salt drug includes strontium ranelate.
[0142] According to another aspect of the invention, there is a use of psoralen vesicles in the preparation of bone-targeting formulations.
[0143] In a preferred embodiment, the bone-targeting formulation further includes other drugs for the prevention and / or treatment of orthopedic diseases.
[0144] In a preferred embodiment, the other drug for the prevention and / or treatment of orthopedic diseases is loaded into psoralen vesicles.
[0145] In a preferred embodiment, the orthopedic disease is one associated with inhibition of osteoblast proliferation.
[0146] In a preferred embodiment, the orthopedic disease is a disease associated with inhibition of osteoblast differentiation.
[0147] In a preferred embodiment, the orthopedic disease is osteoporosis.
[0148] According to another aspect of the invention, there is provided the use of psoralen vesicles in the preparation of osteoblast proliferation promoters.
[0149] According to another aspect of the invention, there is provided the use of psoralen vesicles in the preparation of osteoblast differentiation promoters.
[0150] According to another aspect of the invention, the above-described psoralen vesicles are provided for the prevention and / or treatment of orthopedic diseases.
[0151] According to another aspect of the invention, a method for preventing and / or treating orthopedic diseases is provided, comprising administering an effective amount of the aforementioned psoralen vesicles to the subject.
[0152] In this invention, the term "subject" refers to a mammal. A mammal can be a human, a non-human primate, a mouse, a rat, a dog, a cat, a horse, or a cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects representing orthopedic disease models. Preferably, the subject is a human.
[0153] The “effective amount” of the composition or formulation used in this invention can achieve the desired therapeutic and / or preventative effects. The effective amount for this purpose will depend on factors such as the pharmaceutical composition, the route of administration, the stage and severity of the disease being treated, the individual’s weight and overall health, and the judgment of the prescribing physician. Dosage may be administered once a week, every two days, or daily, or even several times a day. Dosage units may be administered over a short period (e.g., weeks to months) or a longer period (months to years).
[0154] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or conditions recommended by the manufacturer.
[0155] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the methods of this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0156] The features mentioned above in this invention, or the features mentioned in the embodiments, can be combined arbitrarily. All features disclosed in this patent specification can be used in any compositional form, and each feature disclosed in the specification can be replaced by any alternative feature that provides the same, equivalent, or similar purpose. Therefore, unless otherwise specified, the disclosed features are merely general examples of equivalent or similar features.
[0157] Example
[0158] 1. Isolation and characterization of psoralen vesicles
[0159] 1.1 Experimental Instruments and Materials
[0160] Blender / High-Speed Blender (MJ-PB80 Easy215; Midea); Ultracentrifuge (optima XPN-100; BECKMAN); Rotor (Type 70Ti, 19u7454; BECKMAN); PC Centrifuge Bottle (355618, BECKMAN COULTER); Nanoparticle Tracking Analysis System (NTA) (Nanosight, Ns300, GD201901477); Transmission Electron Microscope (TEM, Talos L120C, Thermo Fisher Scientific, USA); Waters High Performance Liquid Chromatography System (Waters Corporation, USA), 2998PDA Detector, Manager-R Infusion Pump, FTN-R Injector; Q-TOF Liquid Chromatography-Mass Spectrometry System (Agilent Technologies G650 Series Quadrupole-Time-of-Flight Mass Spectrometer); Agilent InfinityLab Poroshell 120SB-AQ column (100×4.6mm, 2.7μm); ACQUITYUPLC BEH C18 (2.1×100mm, 1.7μm) electronic analytical balance (BSA223S, Sartorius); ultrasonic cleaner (5800, Branson, China); pure water system (Milli-Q Reference, Merck, Germany); electric thermostatic drying oven (DHG-9623A, Shanghai Jinghong Experimental Equipment Co., Ltd., China); thin-layer chromatography digital imager (TLC Visualizer, CAMAG, Switzerland); thin-layer scanner (TLCScanner 3, CAMAG, Switzerland).
[0161] Phosphate buffer saline (PBS) (1×) (meilunbio, MA0015); sucrose (AR, Sinopharm Chemical Reagent Co., Ltd.); analytical grade methanol, ethyl acetate, chloroform, acetic acid, etc., were purchased from Shanghai Sinopharm Chemical Reagent Co., Ltd. Chromatographic grade methanol, acetonitrile, ammonium acetate, and isopropanol were purchased from Thermo Fisher Scientific. Formic acid (HPLC) was purchased from DIKMA. Water was ultrapure water.
[0162] 1.2 Preparation of Psoralea vesicles
[0163] 1.2.1 Experimental Methods
[0164] Weigh approximately 350g of Psoralea corylifolia herb, wash it thoroughly with water, add an appropriate amount of PBS, and crush it using a high-speed blender. Filter the mixture through gauze to remove a large amount of solid impurities. Centrifuge the filtrate sequentially at 3000×g for 20 minutes using a refrigerated centrifuge. Collect the supernatant and centrifuge it at 15000×g for 1 hour. Centrifuge the supernatant at 150000×g for 2 hours. Resuspend the precipitate in 2mL of PBS, filter it through a 0.45μm sterile aqueous filter membrane, and aliquot 600μL into 1.5mL containers. The EP tubes contained total psoralen vesicles. The remaining portion was centrifuged using density gradient centrifugation. The sample was added to 8%, 30%, 45%, and 60% sucrose solutions (with the layers between each gradient clearly marked), and centrifuged at 150,000 × g for 2 h. Each layer was aliquoted into four centrifuge bottles according to the pre-marked labels. The bottles were filled with PBS and centrifuged at 100,000 × g for 45 min. The precipitates were collected and resuspended in PBS to obtain extracellular vesicles (EVs) of different components. These EVs were aliquoted into 1.5 mL EP tubes and named band 1 (8% sucrose gradient), band 2 (30% sucrose gradient), band 3 (45% sucrose gradient), and band 4 (60% sucrose gradient), respectively, and stored at -80°C.
[0165] 1.2.1 Experimental Results
[0166] Experimental results are as follows Figure 1 As shown.
[0167] 1.3 NTA characterization of psoralen vesicles
[0168] 1.3.1 Experimental Methods
[0169] The isolated vesicle samples were diluted 500–1000 times with 1×PBS buffer, and the particle size and concentration of the vesicles were measured using nanoparticle tracking analysis (NTA). The NTA parameters were set as follows: SYRINGELOAD 100; DELAY 5; SYRINGELOAD 50; DELAY 30; REPEATSTART CAPTURE 30; DELAY 1; REPEAT 2.
[0170] 1.3.2 Experimental Results
[0171] The isolated vesicle samples were diluted 500–1000 times with 1×PBS buffer. Nanoparticle tracking analysis (NTA) was used to measure the vesicle size and concentration. The average vesicle size in each density layer was found to be between 100 and 200 nm, with an average concentration of 10. 11 ~10 12 The particle size distribution was measured in particles / mL, and all peaks were singlets, indicating high particle size uniformity. The experimental results are shown in Table 1 and... Figure 2 As shown.
[0172] Table 1 shows the concentration and error of vesicles measured using nanoparticle tracking analysis (NTA).
[0173] Concentration (particles / ml) Error (+ / - particles / m) Strip 1 1.29e+11 2.57e+10 Strip 2 9.90e+11 1.31e+11 Strip 3 1.32e+12 5.34e+10 Strip 4 1.25e+12 2.61e+10 Total strip 3.28e+12 3.54e+10
[0174] 1.4 TEM characterization of psoralen vesicles
[0175] 1.4.1 Experimental Methods
[0176] The obtained psoralen vesicles (EVs) were diluted to 10 μL. 10 Particles / mL, prepare 20 μL to 1.5 mL EP tubes. Fix the copper mesh with tweezers, add 10 μL of PBS to the surface of the copper mesh with the supporting membrane to rinse the copper mesh, blot dry with the edge of filter paper, add 10 μL of pre-diluted psoralen vesicle sample to the surface of the copper mesh with the supporting membrane, let stand for 3-5 min, blot off excess droplets with the edge of filter paper strips, and let dry slightly. Add 10 μL of 4% uranium acetate to the surface of the copper mesh with the supporting membrane, and let dry. Observe under a transmission electron microscope.
[0177] 1.4.2 Experimental Results
[0178] Transmission electron microscopy (TEM) was used to examine the morphology and structure of EVs. Cup-shaped or saucer-shaped structures are important hallmarks of EVs and can be observed using TEM. TEM imaging revealed that psoralen vesicles possess a double-membrane structure with intact membranes. Results are as follows: Figure 3 As shown.
[0179] 1.5 Identification of the contents of psoralen vesicles (LC-MS)
[0180] 1.5.1 Experimental Methods
[0181] Total psoralen vesicles were diluted to a uniform concentration. 5 μL of each vesicle was transferred to a 1.5 mL EP tube, and 200 μL of chloroform:methanol (1:1) was added. The mixture was stirred and centrifuged at 10000 rcf for 5 min at 4°C. 180 μL of the supernatant was collected, purged with nitrogen, and reconstituted with 100 μL of methanol. Using H₂O:MeOH:ACN = 3:1:1 (5 mM NH₄Ac) as mobile phase A and IPA:ACN = 2:5 (5 mM NH₄Ac) as mobile phase B, gradient elution was performed on an Agilent Q-Tof LC-MS / MS system according to the gradient shown in the table below. The obtained mass spectrometry data were imported into the MSAIDL database for analysis, and the results were classified according to the PubChem classification system.
[0182] Column: ACQUITYUPLC HSS T3 (2.1×100mm, 1.8μm)
[0183] Sample injection: 10g total vesicle extract 12 pcs / ml 2μl
[0184] Flow rate: 0.3 ml / min
[0185] The mobile phase gradient is shown in Table 2.
[0186] Table 2 Mobile phase gradient
[0187] time B% 0.5 25 1.5 40 3 60 13 98 13.1 20 17 20
[0188] 1.5.2 Experimental Results
[0189] To further understand the components of Psoralea corylifolia, mass spectrometry analysis was performed. The obtained mass spectrometry data was imported into the MSAIDL database for analysis, revealing that the total vesicles contain many different types of components, which were then classified and statistically analyzed as follows: Figure 4 As shown.
[0190] 2. Targeting study of psoralen vesicles
[0191] 2.1 Experimental Instruments and Materials
[0192] Small animal live fluorescence imaging system (PE IVIS SPECTRUM, USA); laboratory animal electric shaver (FS600, Beyotime); exosome red fluorescent labeling dye (PKH26) (Umibio, UR52302); 1× phosphate buffer (Phosphate Buffer Saline, 1×PBS) (meilunbio, MA0015).
[0193] 2.2 In vivo tissue distribution of psoralen vesicles (in vivo tracing experiment in mice)
[0194] 2.2.1 Experimental Methods
[0195] Vesicles and fluorescent labeling:
[0196] ①The DIR dye was diluted to 20mM with DMSO in the original tube, and then further diluted to 5mM with DMSO (it did not dissolve well in PBS later).
[0197] ② Dilute the DIR dye to 10 μM with PBS, then add 1996 μl PBS + 4 μl DIR dye (protect from light during the process and wrap with aluminum foil).
[0198] ③ Take 1 ml of 5*10¹¹ vesicles and 1 ml of 10 μM DIR dye and mix them to a final concentration of 5 μM. Vortex the mixture for 1 min and then incubate for 20 min.
[0199] ④ Take a 15ml centrifuge tube, add the incubated vesicle-dye complex and 10mL of 1xPBS, and mix well;
[0200] ⑤ Balance the solution using PC tubes, ultracentrifuge at 100,000g for 1.5 hours at 4°C, and resuspend the precipitate in 1 ml of PBS. Take 1 μl and dilute it 1000 times with 1xPBS, then determine the NTA concentration. Centrifuge the dye simultaneously.
[0201] ⑥ Dilute the concentration of the vesicle-dye complex to 5*10¹⁰ vesicles and set aside for later use. Dilute the dye by the same factor.
[0202] Mice shed their hair one day in advance
[0203] Injection method and dosage: gavage, intraorbital injection. The dosage was 100 μL per mouse.
[0204] Observation intervals after injection: 1h, 4h, 8h, 24h, 48h.
[0205] Gavage (8 animals per group): 3 animals were dissected at 24 hours (numbered 6, 7, and 8), and 3 animals (1, 2, and 3) were dissected at 48 hours. The dissections mainly observed the bones and other organs.
[0206] Orbital injection (n=9 per group): 24 hours later, mice 7 and 8 in the PBS group died, so PBS (mice 3, 6, and 9), DIR (mice 7, 8, and 9), and DIR+FPEVS (mice 7, 8, and 9) were dissected.
[0207] 48 hours later, mice in the DIR group (1, 2, 4) and mice in the DIR+FPEVS group (1) died. Therefore, mice in the PBS group (1, 2, 4), DIR group (3, 5, 6), and DIR+FPEVS group (2, 3, 4) were dissected.
[0208] 2.2.2 Experimental Results
[0209] In in vivo imaging, mice in the psoralen vesicle group and the dye group were compared. Significant differences were found between 1 and 8 hours after gavage and between 4 and 24 hours after orbital injection. This indicates that psoralen vesicles can better bind to substances in the body and exert their effects. The difference in time may be due to the different administration methods affecting the speed at which they enter the systemic circulation.
[0210] After oral administration of samples to mice, there were no significant changes in organ fluorescence. After orbital injection, the heart, liver, spleen, lungs, forelegs, and hind legs all showed a certain degree of fluorescence enhancement, which rapidly decreased over time, demonstrating the organ targeting of psoralen vesicles.
[0211] 3. Study on the effects and mechanisms of psoralen vesicles on osteoblasts
[0212] 3.1 Experimental Instruments and Materials
[0213] -80℃ refrigerator (MDF-U73V, Sanyo Electric Co., Ltd., Japan); CO2 incubator (Thermo Fisher Scientific, USA); BioTek Power Wave XS microplate reader (Bio-Tek Biotechnology, USA); inverted microscope (Olympus Corporation); electric thermostatic water bath (HWS-26, Shanghai Yiheng Scientific Instruments Co., Ltd.); biosafety cabinet (Thermo Fisher Scientific, USA); shaker (TS-8, Kylin-Bell Lab Instruments, China); low-speed centrifuge (Genespeed 416, Gene Company, Korea); electric thermostatic water bath (HWS-26, Shanghai Yiheng Scientific Instruments Co., Ltd., China); liquid nitrogen tank (UN 1977, CHART / GOLDEN PHOENIX Ball Ground, GA 30107USA).
[0214] α-MEM medium (MA0216, meilunbio); 0.25% Trypsin-EDTA; penicillin / streptomycin solution (MA0110, meilunbio); Fetal Bovine Serum, Qualified (FBS) (10091-148, Gibco); DMEM medium (11995081, Gibco); Alkaline phosphatase (ALP / AKP) test kit (microplate method) (A0529-2-2, Nanjing Jiancheng Bioengineering Research); Cell proliferation and toxicity assay kit (CCK8) (MA0218, meilunbio); Shanghai Yishan Bio RNA rapid extraction kit (RN001); 1.8mL cell cryopreservation tubes (377267, Nunc, Tatin, China); ultrapure water.
[0215] 3.2 The role and mechanism of psoralen vesicles in promoting osteoblast differentiation (ALP)
[0216] 3.2.1 CCK8 Experimental Method
[0217] MG-63 cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C, 5% CO2, and relative humidity. When the MG-63 cells reached approximately 70% of the culture dish area, they were digested with 0.25% trypsin and collected in centrifuge tubes. The cells were centrifuged to obtain a cell pellet. The pellet was thoroughly mixed and seeded into 96-well plates at a density of 8,000 cells / well (100 μl per well). After cell attachment, the cells were drugged. Three control groups were established: a solvent control group, an estradiol positive control group, and five strip-treated groups, with six replicates per group. After drug addition, the cells were cultured for 24 hours. The 96-well plates were then removed, and 10 μl of CCK8 reagent was added to each well. The cells were incubated for approximately 20 minutes, and the absorbance was measured at 480 nm. The OD value was directly proportional to the number of viable cells. The experiment was repeated independently in two separate experiments.
[0218] 3.2.2 Determination of alkaline phosphatase activity (ALP)
[0219] MG-63 cells were pipetted evenly at a concentration of 2×10⁻⁶. 5 Cells were seeded at a density of 2 mL per well in 6-well plates. After cell adhesion, the drug was administered at the concentration determined according to CCK8-related experimental results, with a blank control group and a positive control group (estradiol, final concentration 10). 8 mol / L), drug group (vesicles with different bands 10 7 (cells / mL). Forty-eight hours after drug administration, the 6-well plate was removed, the culture medium was aspirated, and 200 μL of 1×Triton lysis buffer was added to each well. After shaking on a shaker for 30 min, the lysis buffer was collected into centrifuge tubes for use as samples for protein content determination and ALP activity determination. Protein content was determined by BCA method, and ALP activity of the cell lysis buffer was determined according to the ALP assay kit instructions (as shown in Table 3).
[0220] Table 3 ALP Activity Assay Table
[0221]
[0222] BCA method for determining protein content:
[0223] The preparation of the BSA protein standard curve (stock solution 2 mg / mL) is shown in Table 4.
[0224] Table 4. Standard Curve for BSA Protein
[0225]
[0226]
[0227] (1) Preparation of working solution: Solution A: Solution B = 50:1
[0228] (2) Cell samples: After diluting the cell lysate 5 times with ddH2O, add 5 μL of sample, 5 μL of standard diluent, and 100 μL of working solution to each well. Incubate at 37℃ for 30 min and measure the absorbance at 562 nm.
[0229] Calculate the ALP activity of the sample according to the formula in the alkaline phosphatase test kit instructions:
[0230]
[0231] C 标准 Phenol standard solution concentration: 0.02 mg / mL; Cpr: Sample protein concentration: gprot / mL (prot refers to protein).
[0232] 3.2.3 Experimental Results
[0233] The results are as follows Figure 5 As shown, the ALP activity of the psoralen vesicles in band 2 and the total bands was increased to varying degrees compared with the blank group, and all of them showed significant differences, indicating that they all had a certain effect on promoting osteoblast differentiation. Bands 1 and 3 had no related effect, and the increase in ALP activity in band 4 may be related to the increase in cell number.
[0234] 3.3 The role and mechanism of psoralen vesicles in promoting osteoblast proliferation
[0235] 3.3.1 Experimental Methods
[0236] (1) RNA extraction (using Shanghai Yishan Biotechnology RNA Rapid Extraction Kit RN001)
[0237] ① After culturing the cells to a suitable density, digest them with trypsin and collect the cells. After uniformly dispersing the cells, count them at a density of 2 × 10⁻⁶. 5 Cells were seeded at a density of 2 mL per well in 6-well plates. After cell adhesion, the drug was administered at the concentration determined according to CCK8-related experimental results, with a blank control group and a positive control group (estradiol, final concentration 10). 8 mol / L), drug group (vesicles with different bands 10 7 cells / mL, 10 8 cells / mL, 10 9 (cells / mL). Forty-eight hours after drug administration, total RNA was extracted from the cultured cells using an RNA extraction kit. Cells were removed from the incubator, the culture medium was aspirated, and the cells were washed 2–3 times with 2 mL PBS.
[0238] ② Add 400 μL of Lysis Buffer to each well and pipette vigorously 10 times. Transfer to a 1.5 mL EP tube and swirl for 10 seconds to fully lyse the cells;
[0239] ③ Add an equal volume of anhydrous ethanol to the lysed cells and mix thoroughly. Then add the liquid to the centrifuge column; centrifuge at 7000 rpm for 1 min and discard the waste liquid; add 500 μL of Wash Buffer to the RNA column, centrifuge at 15000 rpm for 1 min and discard the waste liquid. Transfer the RNA column back to the collection tube, centrifuge the empty tube once to completely remove any remaining Wash Buffer. Place the column on a clean, RNase-free 1.5 mL centrifuge tube, open the cap and let it air dry for 2 minutes.
[0240] ⑦ Add 25 μL of Elution Buffer to the center of the RNA column membrane and let stand at room temperature for 2 minutes.
[0241] ⑧ Centrifuge at 15000 rpm for 1 minute (add the eluted RNA solution back into the column, let stand for 5 minutes, and centrifuge again to improve elution efficiency and obtain more RNA).
[0242] 9. Determine the concentration of the eluted RNA for use in subsequent experiments. Store the extracted RNA at -80℃ for later use.
[0243] (2) RNA reverse transcription
[0244] The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara, RR037A).
[0245] (3) qRT-RCR reaction (as shown in Figure 5)
[0246] Table 5 Primers and Sequences
[0247] Primers Sequence (5'to3') CDK2 (forward) TGATCCAGCCAAACGAATTTC CDK2 (Reverse) GCTACATCTTCTTAATCTGATTGTCCAA GAPDH (positive) CTGCACCACCAACTGCTTAG GAPDH (Reverse) AGGTCCACCACTGACACGTT
[0248] Prepare the reaction solution on ice as shown in Table 6.
[0249] Table 6. Preparation method of reaction solution
[0250]
[0251]
[0252] The PCR reaction conditions are shown in Table 7.
[0253] Table 7 PCR reaction conditions
[0254]
[0255] (4) Statistical analysis
[0256] Using GAPDH as an internal parameter, according to 2 -ΔΔCt Method (△Ct=Ct) 目的基因 -Ct 内参基因; -△△Ct=Control group△Ct-Experimental group△Ct) calculate the expression level of the target gene mRNA and compare the expression differences between the groups.
[0257] 3.3.2 Experimental Results
[0258] The results are as follows Figure 6 As shown, bands 2 and 3 of psoralen vesicles, as well as the total band, can promote the upregulation of the osteogenic-related gene CDK2, while bands 1 and 4 of psoralen vesicles have no effect.
[0259] The embodiments of the present invention have been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present invention. The descriptions of the embodiments above are only for the purpose of helping to understand the method and core ideas of the present invention. Furthermore, any changes or modifications made by those skilled in the art based on the ideas of the present invention, its specific implementation methods, and its application scope, are all within the scope of protection of the present invention. Therefore, the content of this specification should not be construed as a limitation of the present invention.
Claims
1. Use of Psoralea corylifolia vesicles in the preparation of a medicament for preventing and / or treating orthopedic diseases.
2. Use according to claim 1, characterized in that, The preparation method of the Psoralea corylifolia vesicles comprises the following steps: (1) weighing an appropriate amount of Psoralea corylifolia medicinal materials, cleaning them with water, adding an appropriate amount of buffer, crushing, filtering, centrifuging for the first time, centrifuging for the second time with the first supernatant, centrifuging for the third time with the second supernatant, and obtaining a first precipitate; and (2) resuspending the first precipitate with buffer, filtering, and obtaining the Psoralea corylifolia vesicles.
3. Use according to claim 2, characterized in that, The water is distilled water or pure water; Preferably, the mass of the Psoralea corylifolia medicinal materials is 250-450 g, for example, about 350 g; Preferably, the buffer is selected from one or more of the following: phosphate buffer, citrate buffer, carbonate buffer, acetate buffer, barbiturate buffer, and Tris buffer; Preferably, the buffer is phosphate buffer (PBS); More preferably, the volume of the buffer in step (1) is 500-1000 ml, for example, about 600 ml; Preferably, the ratio of mass / volume (g / ml) between the Psoralea corylifolia medicinal materials and the buffer in step (1) is 0.4-0.7, for example, about 0.583; More preferably, the volume of the buffer in step (2) is 1-5 ml, for example, about 2 ml; Preferably, the ratio of mass / volume (g / ml) between the Psoralea corylifolia medicinal materials and the buffer in step (1) is 150-200, for example, about 175; More preferably, the crushing is performed using a cell crusher; Further preferably, the filtering in step (1) is gauze filtering; Further preferably, the filter membrane for filtering in step (2) is a sterile water system filter membrane; Further preferably, the diameter of the sterile water system filter membrane is 0.45 μm; Especially preferably, the method of centrifugation is differential centrifugation; Especially preferably, the machine for the first centrifugation is a refrigerated centrifuge; Especially preferably, the machine for the second centrifugation is an ultracentrifuge; Especially preferably, the machine for the third centrifugation is an ultracentrifuge; Especially preferably, the centrifugal force for the first centrifugation is 2000 x g-4000 x g, for example, about 3000 x g; Especially preferably, the centrifugal force for the second centrifugation is 14000 x g-16000 x g, for example, about 15000 x g; Especially preferably, the centrifugal force for the third centrifugation is 140000 x g-160000 x g, for example, about 150000 x g; Especially preferably, the time for the first centrifugation is 10-30 min, for example, about 20 min; Especially preferably, the time for the second centrifugation is 0.5-1.5 h, for example, about 1 h; Especially preferably, the time for the third centrifugation is 1.5-2.5 h, for example, about 2 h.
4. Use according to claim 2, characterized in that, The preparation method further comprises the following steps: (3) adding the psoralen vesicles into each gradient concentration of sugar solution, after the fourth centrifugation, dispensing into centrifuge bottles, adding buffer, performing the fifth centrifugation, collecting the second precipitate, resuspending the second precipitate with buffer, to obtain different sugar concentration psoralen vesicle banding layers.
5. Use according to claim 4, characterized in that, The sugar solution is a sucrose solution; Preferably, the gradient concentrations of the sucrose solution are 5% to 15%, 20% to 40%, 35% to 60% and 50% to 70%, for example, about 8%, about 30%, about 45% and about 60%, respectively; Preferably, the buffer is one or more selected from the group consisting of phosphate buffer, citrate buffer, carbonate buffer, acetate buffer, barbiturate buffer, Tris buffer; Preferably, the buffer is phosphate buffer (PBS); More preferably, the centrifugal force of the fourth centrifugation is 50000xg to 250000xg, for example, about 150000xg; More preferably, the time of the fourth centrifugation is 1.5 to 2.5h, for example, about 2h; More preferably, the centrifugal force of the fifth centrifugation is 50000xg to 200000xg, for example, about 100000xg; More preferably, the time of the fifth centrifugation is 20 to 70min, for example, about 45min; Especially preferably, the method further comprises the step of cryopreserving the different sugar concentration psoralen vesicle banding layers; Especially preferably, the temperature of the cryopreservation is -60℃ to -100℃, for example, about -80℃.
6. Use according to any one of claims 1 to 5, characterized in that, The medicine further comprises one or more drugs and / or extracts for preventing and / or treating orthopedic diseases; Preferably, the medicine comprises bone resorption inhibitors, bone formation promoters, bone mineralization promoters, vitamin K2 drugs and / or strontium salt drugs; More preferably, the bone resorption inhibitors are one or more selected from the group consisting of bisphosphonate drugs, calcitonin drugs, estrogen drugs, selective estrogen receptor modulators (SERMs), and RANKL preparations; More preferably, the bisphosphonate drugs comprise zoledronic acid; More preferably, the calcitonin drugs comprise salmon calcitonin and / or eel calcitonin; More preferably, the selective estrogen receptor modulators (SERMs) comprise raloxifene; More preferably, the bone formation promoters comprise parathyroid hormone analogs (PTHa); More preferably, the parathyroid hormone analogs (PTHa) comprise teriparatide [PTH(1-34)]; More preferably, the bone mineralization promoters comprise calcium agents and / or active vitamin D and its analogs; Especially preferably, the vitamin K2 drugs comprise menatetrenone; Especially preferably, the strontium salt drugs comprise strontium ranelate.
7. Use of psoralen vesicles in the preparation of bone-targeting preparations; Preferably, the bone-targeting preparations further comprise other drugs for preventing and / or treating orthopedic diseases; Preferably, the other drugs for preventing and / or treating orthopedic diseases are loaded into the psoralen vesicles.
8. Use according to any one of claims 1 to 7, characterized in that, The bone disease is a disease associated with suppression of osteoblast proliferation; Preferably, the bone disease is a disease associated with suppression of osteoblast differentiation. Preferably, the bone disease is osteoporosis.
9. Use of psoralea vesicles for the manufacture of an agent for promoting osteoblast proliferation.
10. Use of psoralea vesicles for the manufacture of an agent for promoting osteoblast differentiation.