Application of TaSnRK1alpha gene in regulating and controlling high-molecular-weight glutenin content of wheat

Abstract

The invention discloses an application of a TaSnRK1alpha gene in regulating and controlling the high-molecular-weight glutelin content of wheat. The high-molecular-weight glutelin content of the wheat is increased by increasing the TaSnRK1alpha gene in the wheat. In addition, the invention also discloses a TaSnRK1 alpha gene overexpression vector, the vector is obtained by introducing a pWMB110 recombinant vector containing a TaSnRK1 alpha-FLAG expression cassette driven by a Ubi promoter, the efficient expression of the TaSnRK1 alpha gene in wheat can be realized by utilizing the overexpression vector, and the high molecular weight glutelin content in mature grains of the TaSnRK1 alpha gene is obviously improved compared with that of a wild type. New germplasm resources and efficient technical path support are provided for breeding of the high-gluten wheat, the breeding period is shortened, and the method has important agricultural application value.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a TaSnRK1 alpha application of a gene in regulating high molecular weight glutenin content in wheat. BACKGROUND

[0002] High yield, high quality and disease resistance are important goals for breeding of wheat (Triticum aestivum L.). Triticum aestivum The dry matter components of wheat kernels mainly include protein, starch and lipid, etc., wherein the content of the protein accounts for only 8%-15% of the kernel components, but the protein has a very important influence on the quality of wheat flour. The storage proteins of wheat mainly consist of glutenin and gliadin, the glutenin controls the elasticity of dough, and the gliadin determines the extensibility of dough, and the two account for about 80% of the kernel protein, and the glutenin and gliadin not only affect the quality and strength of dough gluten, but also have a decisive role on the processing quality of flour.

[0003] The glutenin can be divided into two types, namely high molecular weight glutenin (HMW-GS) and low molecular weight glutenin (LMW-GS). The HMW-GS accounts for about 10% of the seed storage protein, and has a decisive role on the strength of dough gluten and the processing quality of wheat, and the HMW-GS forms a glutenin polymer through intermolecular disulfide bond covalent cross-linking, is the'skeleton' of the glutenin protein, and has a great influence on the structure and function of the glutenin. However, the genes for regulating the high molecular weight glutenin of wheat are limited at present, and the progress of high-gluten wheat breeding is limited. SUMMARY

[0004] The application provides a TaSnRK1 alpha application of a gene in regulating high molecular weight glutenin content in wheat, which provides a new germplasm resource and path support for high-gluten wheat breeding, provides a possibility for shortening of the breeding cycle, and has important agricultural application value.

[0005] In order to achieve the above object, the application provides a TaSnRK1 alpha application of a gene in regulating high molecular weight glutenin content in wheat. The SnRK family transcription factor TaSnRK1 alpha of the application has a nucleotide sequence as shown in SEQ ID No. 1 and an amino acid sequence as shown in SEQ ID No. 2.

[0006] The gene can regulate the synthesis of high molecular weight glutenin in wheat, and the high molecular weight glutenin content of mature kernels is significantly increased in the overexpression plant of the gene. TaSnRK1 alphaGenes can be used to increase the high molecular weight glutenin content in wheat.

[0007] The second aspect of the present invention provides a wheat TaSnRK1 alpha The gene overexpression vector uses pWMB110 as its core and also contains the Ubi promoter-driven gene expression vector. TaSnRK1 alpha Fusion gene expression cassette and terminator.

[0008] The third aspect of the present invention provides the above-described wheat TaSnRK1 alpha-FLAG Gene overexpression vectors improve wheat TaSnRK1 alpha α Applications in gene expression.

[0009] The fourth aspect of the present invention provides the above-described wheat TaSnRK1 Application of gene overexpression vectors in increasing the content of high molecular weight glutenin in wheat.

[0010] The fifth aspect of this invention provides a method for increasing the content of high molecular weight glutenin in wheat, by using the above-mentioned vector to overexpress wheat... TaSnRK1 alpha Gene.

[0011] The fifth aspect of the present invention provides the above-described wheat TaSnRK1 alpha The method for constructing a gene overexpression vector includes the following steps: (1) Using SEQ ID No. 3 and SEQ ID No. 4 as primers, and wheat Fielder line seed cDNA 10 days after pollination as template, amplification was performed with the stop codon removed. TaSnRK1 alpha The CDS region of the gene is used for gel recovery of the product; (2) Using SEQ ID No. 5 and SEQ ID No. 6 as primers and FLAG sequence tag as template, the FLAG tag sequence was amplified and the product was recovered by gel extraction. (3) Using SEQ ID No. 3 and SEQ ID No. 6 as primers, the two products from steps (1) and (2) were ligated by overlap extension PCR. TaSnRK1 alpha The fused fragments are then subjected to adhesive recovery treatment of the product; (4) Linearize the pWMB110 vector using the restriction endonuclease BamHI; (5) The splicing obtained in step (3) TaSnRK1 alpha-FLAG The fusion fragment was cloned into the linearized vector pWMB110; (6) The ligation system obtained in step (5) is transformed into Escherichia coli competent cells DH5α, positive clones are screened, the single clones with correct sequencing are propagated, plasmids are extracted, and transformed into EHA105 Agrobacterium competent cells.

[0012] By the technical scheme, the application has the following beneficial effects: 1. The application significantly improves the accumulation of high molecular weight glutenin in wheat grains by overexpressing the gene, and provides a new strategy and support for high gluten wheat breeding. TaSnRK1 alpha-FLAG

[0013] 2. The overexpression vector of the application can realize efficient expression of the gene in wheat, and significantly improve the content of high molecular weight glutenin in wheat. TaSnRK1 alpha BRIEF DESCRIPTION OF DRAWINGS

[0014] TaSnRK1 alpha is Figure 1 The overexpression vector construction positive colony detection diagram, lane M is Marker, and lanes 1-12 are PCR amplification products of E. coli liquid; TaSnRK1 alpha is Figure 2 The overexpression transgenic plant positive PCR identification electrophoresis diagram, lane 1 is a negative control, and the PCR product amplified by wild type Fielder DNA, lane 2 is a positive control, i.e. the PCR product of the recombinant plasmid, and lanes 3-20 are PCR amplification products of the transgenic plant lines; TaSnRK1 alpha is Figure 3 The transgenic plant RT-qPCR identification diagram; TaSnRK1 alpha is Figure 4 The high molecular weight glutenin content gel diagram of the overexpression transgenic line. DETAILED DESCRIPTION

[0015] The specific embodiments of the application will be described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to illustrate and explain the application, and are not used to limit the application. The various method steps not described in detail in the examples are all regarded as standard methods known to those skilled in the art. The materials and reagents used are commercially available through conventional commercial channels unless otherwise specified. The wheat germplasm resources used in the present application are provided by the College of Agriculture, Yangzhou University-Jiangsu Provincial Crop Germplasm Resource Library, and the above-mentioned materials can be publicly obtained and used by those skilled in the relevant art.

[0016] Example 1 Overexpression of wheat TaSnRK1 alpha Gene vector construction 1. Obtain the wheat TaSnRK1 alpha Gene nucleic acid sequence (SEQ ID No. 1 shown as follows) from Ensembl Plants (https: / / plants.ensembl.org / index.html). TaSnRK1 alpha ​​Based on the gene nucleotide sequence (the amino acid sequence is shown in SEQ ID No. 2), two sets of specific primers were designed: SEQ ID No. 3 and SEQ ID No. 4, and SEQ ID No. 5 and SEQ ID No. 6. Primers SEQ ID No. 3 and SEQ ID No. 4 were used to amplify wheat. TaSnRK1 alpha The CDS region of the gene (with the stop codon removed) was used as a template, with cDNA from wheat grains 10 days after pollination. Primers SEQ ID No. 5 and SEQ ID No. 6 were used to amplify the FLAG tag (SEQ ID No. 15). All PCR products obtained were gel-extracted. Using SEQ ID No. 3 and SEQ ID No. 6 as primers, and the purified products obtained above as a mixed template, the two product segments were ligated by overlap extension PCR. TaSnRK1 alpha The fused fragments were then subjected to gel extraction. The gel extraction kit used was an agarose gel DNA extraction kit (TIANGEN, DP219-03).

[0017] The components, amounts, and specific amplification procedures for the above PCR amplification reaction system are as follows: 2×Phanta mix reaction system

[0018] 2×Phanta mix amplification program

[0019] 2. Vector digestion: Linearization of the pWMB110 vector: The restriction endonuclease BamHI (ThermoFisher, FD0055) was used to linearize the vector according to the following system. The process was carried out in a 37℃ water bath for 2 hours.

[0020] Vector enzyme digestion system

[0021] 3. Homologous recombination: This invention uses homologous recombination technology (Novizan brand, product number C112-01) to clone the spliced ​​fragment into the linearized pWMB110 vector. The system is shown in the table below, and the reaction conditions are 37℃ water bath reaction for 30 min.

[0022] Homologous recombination system

[0023] 4. Transformation of E. coli: The above-mentioned recombination system was added to 50 μL of DH5α E. coli competent cells, placed on ice for 30 min, heated at 42 °C for 90 s, cooled on ice for 2 min, added with 500 μL of LB without resistance, shaken on a shaker at 37 °C for 45 min, coated on a LB plate with resistance, cultured and picked a colony for expansion.

[0024] 5. Screening of positive clones and sequencing: The target fragment was amplified using the vector primer SEQ ID No. 7 Ubi and SEQ ID No. 8 Nos as shown above, and after agarose gel electrophoresis, colonies with the size of the target fragment were identified. Electrophoresis identification is shown as follows: TaSnRK1 alpha-FLAG The positive bacterial liquid screened was sent to Nanjing Qikai Company for sequencing, and sequence alignment was performed using DNAMAN, and the bacterial liquid with the same sequence as the target sequence was selected, expanded and cultured, and the plasmid was extracted using the plasmid extraction kit (DP103-03) of Tiangen Company.

[0025] 6. Transformation of Agrobacterium (EHA105): 1 μg of plasmid was added to 100 μL of EHA105 E. coli competent cells, mixed, placed on ice for 30 min, frozen in liquid nitrogen for 5 min, heated at 37 °C for 5 min, cooled on ice for 2 min, added with 500 μL of LB without resistance, shaken on a shaker at 28 °C for 2-3 h, centrifuged in a 3500 rpm centrifuge for 5 min, and the remaining supernatant and precipitate were mixed and coated on a LB plate with resistance, cultured for about 2 d, picked a colony and expanded.

[0026] 7. Screening of positive clones and sequencing: consistent with step (5), a Figure 1 gene overexpression vector was obtained.

[0027] Example 2 TaSnRK1 alpha Overexpression plant identification 1. PCR identification of positive plants of transgenic materials: DNA was extracted from transgenic wheat leaves, the DNA concentration was diluted to about 200 ng / μL, and primers Ubipro-OF (SEQ ID No. 9) and Ubipro-OR (SEQ ID No. 10) were used for PCR verification, and the electrophoresis result is shown as follows: TaSnRK1 alpha Lane 1 is wild type (negative control, no band), lane 2 is recombinant plasmid (positive control, band), and lanes 3-20 are transgenic lines, and 18 Figure 2 overexpression positive single plants were obtained.

[0028] The reaction system components, amount and specific amplification procedure of the above-mentioned PCR amplification are as follows: 2x Taq mix reaction system

[0029] 2x Taq mix amplification procedure

[0030] 2. Transgenic material positive plants TaSnRK1 alpha Identification of gene expression level: RNA was extracted from T1 generation transgenic plants and wild type leaves, and reverse transcribed into cDNA using Vazyme reverse transcription kit (R223-01). The reverse transcribed cDNA was diluted 3 times and stored at -20°C.

[0031] RT-qPCR was performed using SEQ ID No. 11 and SEQ ID No. 12 (target gene), SEQ ID No. 13 and SEQ ID No. 14 (internal reference gene TaActin). The kit was AceQ Universal SYBR qPCR MasterMix kit from Vazyme Company. The instrument was real-time fluorescent quantitative PCR instrument from Hangzhou Bolai Science and Technology Co., Ltd.

[0032] The results are shown in TaSnRK1 alpha : The expression of the transgenic lines (OE-10, OE-11) was significantly higher than that of the wild type Fielder. Figure 3 Reaction system and reaction procedure as follows: Reaction system

[0033] Reaction procedure

[0034] The results were analyzed by comparative threshold method. The C value was calculated according to the Ct value measured by the instrument. C = 2 -△Ct , △Ct = Ct target gene - Ct internal reference gene. The average of three repeated C values was used as the relative expression of the target gene. The significance analysis method was F test (variance analysis) first, then t test. P < 0.05 indicates significant difference, P < 0.01 indicates extremely significant difference.

[0035] Example 3 TaSnRK1 alpha Detection of high molecular weight glutenin content in overexpressing wheat positive plants 1. Wheat gluten extraction (refined extraction) involves the preparation of experimental reagents as follows: Gluten extraction solution A: 7.5 mL isopropyl alcohol, 4.5 g sodium iodide, ddH2O to 100 mL; Gluten extract B (freshly prepared): 25 mL isopropanol, 4 mL Tris-HCl (1 M, pH 8.0), 10 g SDS, 2 g DTT, ddH2O to 100 mL; Gluten extract C (freshly prepared): 25 mL isopropanol, 4 mL Tris-HCl (1 M, pH 8.0), 10 g SDS, 1.4 mL VP, ddH2O to 100 mL; Gluten extract D: 62.5 mL Tris-HCl (1 M, pH 6.8), 5 mL β-mercaptoethanol, 20 mL glycerol, 2 g SDS, 0.2 g bromophenol blue, ddH2O to 100 mL.

[0036] 2. Extraction of gluten from wild type (WT), OE-10, OE-11 lines of grain (1) Grind the wheat grain, take one seed, cut off 1 / 3 or 1 / 4 of the endosperm and crush it, weigh 0.05 g of the wheat grain powder and transfer it to a 2.0 mL centrifuge tube. Add 800 μL of extract A, shake well and make a suspension. Place the centrifuge tube at 65 °C and extract for 1 h. Shake every 10 min using a shaker. At the end of the extraction process, centrifuge at 10000 rpm for 3 min and discard the supernatant; (2) Repeat step (1); (3) Add 200 μL of extract B to the above precipitate and vortex well. Then place the centrifuge tube at 65 °C and extract for 1 h, vortexing every 10 min; (4) Add 200 μL of extract C and vortex well. Place the centrifuge tube at 65 °C and let it stand for 30 min, then centrifuge at 10000 rpm for 5 min; (5) From the above extraction process, take 400 μL of the supernatant and transfer it to another clean centrifuge tube; (6) Add 200 μL of extract D and vortex well. Then let it stand for 30 min and heat treat in boiling water at 100 °C for 5 min; (7) After natural cooling, the solution is the HMW-GS and LMW-GS extract, which can be analyzed by electrophoresis.

[0037] 3. SDS-PAGE electrophoresis detection: Results are shown in TaSnRK1 alphaAs shown: Compared with wild-type WT, the HMW-GS (Dx2, Bx14, Bx15, Dy12) bands of transgenic lines OE-10 and OE-11 were significantly darker, and the content of high molecular weight glutenin was significantly increased, confirming... Figure 4 TaSnRK1 alpha Overexpression can effectively increase the content of high molecular weight glutenin in wheat grains.

[0038] The specific sequence is as follows: SEQ ID No. 1: SEQ ID No.2: MDAAGRDANPLAGYRIGKTLGIGSFGKVKIAEHIITGHKVAIKILNRRKIKSMEMEEKVKREIKILRLFMHPHIIRLYEVIDTPADIYVVMEYVKSGELFDYIVEKGRLQEEEARRFFQQIISGVEYCHRNMVVHRDLKPENLLLDSKCNVKIADFGLSNVMRDGHFLKTSCGSPNYAAPEVISGKLYAGPEVDVWSCGVILYALLCGTLPFDDENIPNLFKKIKGGIYTLPSHLSPLARDLIPRMLVVDPMKRITIREIREHSWFKARLPRYLAVPPPDTAQQVKKLDDETLNDVIKMGFDKNQLTESLQKRLQNEATVAYYLLLDNKLRTTSGYLGAEYQESMDSSFSQVSPETPSSASEARQYGSPGFGLRHHFAAERKWALGLQSRAHPREIITEVLKALQELNVCWKKIGHYNMKCRWSPGFVETMMHNNNGFGVESAIIEADGLSDKSTHIVKFEIQLYKTRDEKYLLDLQRVSGPQLLFLDLCSAFLTQLRVL SEQ ID No.3: AGGTCGACTCTAGAGGATCCATGGACGCAGCAGGCAGAG SEQ ID No.4:CGTGGTCCTTGTAGTCGAGGACTCTCAGCTGGGTTAG SEQ ID No.5:CTAACCCAGCTGAGAGTCCTCGACTACAAGGACCACG SEQ ID No.6: AGCTCGGTACCCGGGGATCCTTACTTGTCGTCGTCGTC SEQ ID No.7: TAGCCCTGCCTTCATACGCT SEQ ID No.8: AAGACCGGCAACAGGATTCA SEQ ID No.9: GGTCGTGCCCCTCTCTAGAGATA SEQ ID No.10:TCCAGAGGCAGCGACAGAGATGC SEQ ID No.11: GGAGATGGAAGAGAAAGTGAAAAG SEQ ID No.12: CCTTCCCTTCTCAACAATGTAATC SEQ ID No.13: GGAATCCATGAGACCACCTAC SEQ ID No.14: GACCCAGACAACTCGCAAC SEQ ID No. 15: GACTACAAAGACCATGATGGAGACTATAAGGATCACGACATCGATTACAAGGACGATGACGATAAGTGA.

[0039] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0040] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable way without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0041] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A kind TaSnRK1α Application of genes in regulating the content of high molecular weight glutenin in wheat.

2. The application according to claim 1, characterized in that, By increasing the wheat TaSnRK1α Gene expression is used to increase the content of high molecular weight glutenin in wheat.

3. Wheat TaSnRK1α Gene overexpression vector, characterized in that, Based on pWMB110 as the core, and also including the Ubi bootloader driver TaSnRK1α-FLAG Fusion gene expression cassette and terminator.

4. The wheat according to claim 3 TaSnRK1α Gene overexpression vectors improve wheat TaSnRK1α Applications in gene expression.

5. The wheat according to claim 3 TaSnRK1α Application of gene overexpression vectors in increasing the content of high molecular weight glutenin in wheat.

6. A method for increasing the high molecular weight glutenin content in wheat, characterized in that, The vector described in claim 3 is used to overexpress wheat. TaSnRK1α Gene.

7. The wheat according to claim 3 TaSnRK1α A method for constructing a gene overexpression vector, characterized in that, Includes the following steps: (1) Using SEQ ID No. 3 and SEQ ID No. 4 as primers, and wheat Fielder line seed cDNA 10 days after pollination as template, amplification was performed with the stop codon removed. TaSnRK1α The CDS region of the gene is used for gel recovery of the product; (2) Using SEQ ID No. 5 and SEQ ID No. 6 as primers, the FLAG tag sequence was amplified, and the product was subjected to gel recovery treatment; (3) Using SEQ ID No. 3 and SEQ ID No. 6 as primers, the two products from steps (1) and (2) were ligated by overlap extension PCR. TaSnRK1α-FLAG The fused fragments are then subjected to adhesive recovery treatment of the product; (4) Linearize the pWMB110 vector using the restriction endonuclease BamHI; (5) The splicing obtained in step (3) TaSnRK1α-FLAG The fusion fragment was cloned into the linearized vector pWMB110; (6) The ligation system obtained in step (5) is transformed into Escherichia coli competent cells DH5α, positive clones are screened, the single clones with correct sequencing are propagated, plasmids are extracted, and transformed into EHA105 Agrobacterium competent cells.

Images