Application of kit for detecting SNP (Single Nucleotide Polymorphism) molecular marker in milk-fat percentage character identification, high milk-fat percentage cattle screening and dairy cow genetic breeding

By using a kit to detect SNP molecular markers, superior alleles were selected and their frequency was increased generation by generation. This solved the problem of low efficiency in improving milk fat percentage in dairy cows using traditional methods, and achieved efficient selection and genetic improvement of milk fat percentage traits, thereby improving the economic benefits of dairy cow breeding and milk quality.

CN121320568APending Publication Date: 2026-01-13NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511752816.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-26
Publication Date
2026-01-13

AI Technical Summary

Technical Problem

Existing technologies are insufficient to quickly and effectively increase the milk fat percentage of dairy cows. Traditional methods are inefficient and costly, single gene marker selection has limited effectiveness, and traditional QTL mapping intervals are too broad to achieve efficient genetic improvement.

Method used

Develop a kit for detecting SNP molecular markers. By selecting dominant alleles and increasing the frequency of dominant alleles generation by generation, the milk fat content of breeding cattle will be improved, and superior breeding cattle with high milk fat content will be selected. PCR amplification and sequencing will be performed using specific primer pairs, and individuals with AA genotype will be eliminated while those with AG or GG genotype will be retained.

Benefits of technology

It enables rapid and accurate selection of milk fat percentage traits, improves the economic benefits of breeding cattle, enhances milk quality and corporate profits, and shortens the time required for genetic improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320568A_ABST
    Figure CN121320568A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biology, and particularly discloses application of a kit for detecting an SNP molecular marker in milk-fat percentage character identification, high milk-fat percentage cattle screening and dairy cow genetic breeding. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, N at the 961th site in the SEQ ID NO.1 represents A or G, N at the 961th site in the SEQ ID NO.1 represents A or G, N at the 961th site in the SEQ ID NO.1 represents A or G, and N at the 961th site in the SEQ ID NO.1 represents A or G; the polymorphism of the basic group at the site affects the milk-fat percentage character, and the milk-fat percentage content of cattle of AA genotype is lower than that of cattle of AG genotype or GG genotype. By optimizing the dominant alleles of the SNP, the frequency of the dominant alleles can be increased generation by generation, the milk-fat percentage of the cattle can be increased, the excellent cattle with the high milk-fat percentage character can be bred, and the genetic improvement progress of the cattle can be accelerated, so that the economic benefit of cattle breeding can be effectively improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology, specifically to the application of a kit for detecting SNP molecular markers in the identification of milk fat percentage, screening of high milk fat percentage cattle, and dairy cattle genetic breeding. Background Technology

[0002] Milk fat percentage is a crucial indicator of milk quality, directly impacting the flavor, nutritional value, and economic benefits of dairy products. Methods to improve milk fat percentage primarily involve two aspects: feeding management and genetic improvement. Traditional methods of increasing milk fat content by adjusting feed formulations or feeding conditions often require increased feed and costs, while genetic improvement relying solely on phenotypic selection is slow. Furthermore, as a typical quantitative trait, milk fat percentage is influenced by multiple genes and environmental factors, making it highly susceptible to environmental interference. The effects of single genes or SNP loci are limited, making rapid genetic progress difficult to achieve solely through phenotypic or single-gene marker-assisted selection. Therefore, introducing molecular breeding techniques to improve breeding accuracy and efficiency has become a current research hotspot.

[0003] Past research has primarily employed candidate gene and genome-wide linkage analysis (QTL mapping) to investigate the genetic mechanisms of milk fat percentage. Existing studies have located QTL segments associated with milk production traits on multiple bovine chromosomes, including chromosomes 14, 20, and 6, and identified candidate genes within these segments. For example, mutations in genes such as the DGAT1 gene on chromosome 14 (involved in triglyceride synthesis), the GHR gene on chromosome 20 (growth hormone receptor), and ABCG2 and SPP1 on chromosome 6 have been shown to be significantly associated with traits such as milk yield and milk fat percentage. However, the discovery of these key genes is relatively rare, explaining only a small portion of the genetic differences in milk production traits; and traditional QTL mapping typically involves broad confidence intervals and numerous genes, limiting the practical application of marker-assisted selection.

[0004] With the development of high-throughput sequencing and large-scale genotyping technologies, genome-wide association studies (GWAS) have become a new tool for studying complex quantitative traits. GWAS utilizes genome-wide SNP markers for association analysis, enabling the localization of genetic variations affecting traits at higher resolution. Increasing research shows that using whole-genome genotypic information for genetic assessment and selection can significantly improve breeding accuracy, and genomic selection has become a standard tool in modern dairy cattle breeding. In fact, large-scale studies have found that most milk production traits are controlled by multiple genes, requiring high-density marker-guided whole-genome scanning to capture most genetic differences. With advancements in molecular biology techniques, marker-assisted selection technology provides a new solution for the genetic improvement of important economic traits in dairy cattle. Therefore, it is necessary to develop new marker-based approaches for dairy cattle genetic breeding. Summary of the Invention

[0005] To develop a novel approach for marker-based dairy cattle genetic breeding, this invention provides a kit for detecting SNP molecular markers and its application in milk fat percentage trait identification, screening for high milk fat percentage cattle, and dairy cattle genetic breeding. By optimizing the dominant alleles of this SNP, this invention can increase the frequency of dominant alleles generation by generation, thereby increasing the milk fat percentage content in breeding stock, selecting superior breeding cattle with high milk fat percentage traits, accelerating the progress of cattle genetic improvement, and effectively improving the economic benefits of cattle breeding.

[0006] This invention provides a kit for detecting SNP molecular markers and its application in milk fat percentage trait identification, screening of high milk fat percentage cattle, and dairy cattle genetic breeding. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. In the sequence of SEQ ID NO.1, N at position 961 represents A or G. The polymorphism of the base at this site affects the milk fat percentage trait. Among them, the milk fat percentage of cattle with the AA genotype is lower than that of cattle with the AG or GG genotypes. The bovine reference genome version is: International Bovine Reference Genome Version 2.0.

[0007] This invention, by selecting the dominant allele of the SNP, can increase the frequency of the dominant allele generation by generation, improve the milk fat content, select superior breeding cattle with high milk fat content, accelerate the progress of cattle genetic improvement, and thus effectively improve the economic benefits of cattle breeding.

[0008] Furthermore, the kit for detecting SNP molecular markers includes the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3.

[0009] Further, the application involves: extracting genomic DNA from the cattle to be tested; using the primer pairs shown in SEQ ID NO.2 to SEQ ID NO.3, and with the obtained genomic DNA as template DNA, performing PCR amplification to obtain PCR amplification products; sequencing the PCR amplification products to obtain sequencing results; determining the genotype of the SNP molecular marker based on the sequencing results; culling individuals with the AA genotype and retaining individuals with the AG or GG genotypes according to the SNP sites of the SNP molecular markers; wherein, cattle with the AA genotype have a lower milk fat percentage than cattle with the AG or GG genotypes.

[0010] Furthermore, the PCR amplification system consisted of 10 μL: 1 μL DNA template, 3.4 μL double-distilled water, 5 μL 2×Taq PCR MasterMix with Loading Dye, and 0.3 μL each of upstream and downstream primers.

[0011] Furthermore, the PCR amplification program was as follows: pre-denaturation at 94℃ for 5 min, 35 cycles, each cycle first denaturing at 94℃ for 30 s, then annealing at 64.5℃ for 30 s, and finally extending at 72℃ for 45 s; after 35 cycles, a final extension at 72℃ for 5 min was performed.

[0012] The present invention also provides a primer pair, including the primers shown in SEQ ID NO.2 to SEQ ID NO.3, wherein the primer pair is used to amplify the SNP molecular marker.

[0013] The present invention also provides a detection kit containing the primer pair.

[0014] Furthermore, the test kit also includes 2×Taq PCR Master Mix with Loading Dye and double-distilled water.

[0015] The present invention also provides the application of the primer pair in the identification of milk fat percentage trait, screening of high milk fat percentage cattle, and dairy cattle genetic breeding.

[0016] The present invention also provides a method for detecting milk fat percentage, comprising the following steps: The SNP molecular markers on bovine chromosome 14 were detected, and the milk fat percentage trait was determined based on whether the single nucleotide at the SNP site was A or G. Among them, the milk fat percentage of cattle with the AA genotype was lower than that of cattle with the AG or GG genotypes. The cattle mentioned are Chinese Holstein dairy cows; the bovine reference genome version is: International Bovine Reference Genome Version 2.0.

[0017] This invention also provides a method for genetic improvement of cattle, comprising the following steps: The SNP molecular marker loci in the core breeding cattle population were identified, and corresponding selections were made based on the molecular markers: breeding cattle individuals with the AG or GG genotype at locus 616,087 on chromosome 14 of the International Bovine Reference Genome 2.0 were selected from the core breeding cattle population, while breeding cattle individuals with the AA genotype were culled, in order to increase the frequency of the G allele at this locus generation by generation, thereby improving the milk fat percentage trait of offspring cattle.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention, by selecting the dominant allele of the SNP, can increase the frequency of the dominant allele generation by generation, improve the milk fat percentage of breeding cattle, select superior breeding cattle with high milk fat percentage, accelerate the progress of cattle genetic improvement, and thus effectively improve the economic benefits of cattle breeding.

[0019] This invention studies and identifies molecular markers associated with milk fat percentage located on nucleotide sequences of bovine chromosome 14, verifies their effects on this trait, and ultimately establishes an efficient and accurate marker-assisted breeding technology. This technology can be applied to genetic improvement of breeding cattle to increase milk fat percentage, thereby improving milk quality, increasing enterprise profits, and enhancing core competitiveness. This invention provides a primer pair and kit for detecting the above-mentioned SNP molecular markers. With this primer pair and kit, an efficient and accurate molecular marker-assisted breeding technology can be established, enabling rapid and accurate selection of milk fat percentage traits and accelerating the breeding process. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 This is a graph showing the genotypic differences at position 961 at the 5' end in Chinese Holstein cattle.

[0022] Figure 2 Manhattan plot of genome-wide association analysis (GWAS) on milk fat percentage on chromosome 14 in Chinese Holstein cattle using EMMAX software based on a linear mixture model; where: x-axis represents the chromosome number of the cattle; principal y-axis represents -log 10 P value. Detailed Implementation

[0023] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0024] Example 1: A SNP molecular marker located on bovine chromosome 14 associated with the milk fat percentage trait and its application.

[0025] I. Experimental subjects, phenotypic determination, and DNA sample collection (1) Experimental animals The experimental cattle herds used in this invention are Chinese Holstein dairy cows from multiple ranches in Shaanxi, Ningxia, Anhui and Jiangsu provinces.

[0026] This experiment used a herd of 597 Chinese Holstein dairy cows, with detailed herd pedigree records. The herd maintained normal feed and water intake, and all feeding methods and conditions remained consistent throughout the experiment, adhering to standard practices.

[0027] (2) Phenotype To determine the milk fat percentage trait, milk samples are collected monthly from the farm and sent to the Dairy Herd Improvement Center (DHI) for laboratory analysis. The average of the five measurements is then taken to obtain the milk fat percentage.

[0028] (0) Bovine tissue sample collection To extract DNA, blood samples were collected from 597 Chinese Holstein dairy cows and stored at -80°C for subsequent DNA extraction and sequencing.

[0029] II. Development of SNP Molecular Markers (1) Sample DNA extraction DNA from collected blood samples was extracted using a Magnetic Universal Genomic DNA kit (purchased from TIANGENBIOTECH (BEIJING) CO.,LTD.). Five 96-well deep-well plates were prepared, each containing 200 μL Buffer NAL + 25 μL proteinase K, 500 μL Wash 1 + 20 μL magnetic beads, 500 μL Wash 2, 500 μL Wash 3, and 80 μL Elution Buffer, respectively. 350 μL of sample was transferred to the deep-well plate containing 200 μL Buffer NAL + 25 μL proteinase K. The Kingfisher (Thermofisher, USA) instrument was started, the corresponding DNA extraction program was selected, and each deep-well plate was placed in its corresponding position on the instrument. The program was run. After lysis was complete, the program was paused, and 400 μL Buffer MBD was added as prompted. The program was then resumed. After the program finished, the DNA solution in the Elution Buffer deep-well plate was transferred to a 1.5 mL centrifuge tube for storage.

[0030] (2) Whole genome resequencing The whole-genome resequencing data were all completed by BGI Genomics Co., Ltd. in Shenzhen. The specific methods and steps are as follows: ① Library construction: The qualified DNA extracted in step (1) is randomly fragmented and processed into a sequencing library through steps such as DNA fragment end repair, 3' end addition of polyA, sequencing adapter configuration, and PCR amplification.

[0031] ② Sequencing: Resequencing was performed on BGI's DNB SEQ-T7 platform, with an average sequencing depth greater than 10×, yielding raw sequencing data in FASTQ format.

[0032] (3) Resequencing data analysis ① Use the Fastp software (v0.23.4) with default parameters to perform quality control on the raw sequencing data obtained in step (2), including filtering out adapter sequences and low-quality reads, to obtain the quality-controlled sequencing data in FASTQ file format; ②Use the mem module in the BWA-mem2 software (v2.2.1) with default parameters to align the quality-controlled sequencing data from step ① to the International Bovine Reference Genome 2.0, and obtain the aligned BAM file; ③ Use the sort function of Samtools software (v1.17) and the MarkDuplicates function of GATK software (v4.4.0.0) to sort the BAM files after alignment in step ② and remove duplicate sequences; ④ SNP calling was performed using the HaplotypeCaller module of GATK software (v4.4.0.0) to accurately identify SNPs and obtain a VCF file containing information on all SNP sites; the VariantFiltration module of GATK software was used to further filter the variants, and finally 23,842,307 SNPs were identified.

[0033] (4) Genome-wide association analysis (GWAS) The selected Plink (v1.90) and EMMAX software were used to perform GWAS analysis on the relationship between variant sites and traits using a linear mixed model. The SNP locus information results (VCF file) obtained in step (3) were converted into Plink binary format files using Plink software (v1.90), and variants with a variant detection rate of less than 10% and a minor allele frequency (MAF) of less than 5% were filtered out. GWAS analysis was performed on the entire population, using SNP variants. Association analysis was performed using the efficient mixed-model association expedited (EMMAX) software based on a linear mixed model, in which the kinship matrix and population structure were included as random effects for correction. The significance thresholds for all traits were calculated according to the formula.P =0.05 / n Evaluation (where n is the number of independent valid SNPs). 1×10 −6 (Bonferroni correction) serves as a genome-wide significance threshold, annotating regions within 200 kb upstream and downstream of significant sites.

[0034] (6) Association analysis between different genotypes and somatic cell scoring traits Table 1. Correlation analysis of SNP sites of molecular markers g.961 A>G with milk fat percentage trait. To identify SNP loci influencing milk fat percentage, we performed a genome-wide association analysis, the results of which are shown below. Figure 2 GWAS analysis revealed a significant associated locus, g.961 A>G (the A>G mutation at position 616,087 on chromosome 14 in the International Bovine Reference Genome 2.0), which lies on a major-effect QTL (Chr14: 616,086bp-616,090bp) on chromosome 14 that significantly affects fat yield. Therefore, this locus was given special attention. Figure 1 Analysis of Table 1 shows that the SNP site g.961 A>G of the molecular marker is highly significantly correlated with the milk fat percentage trait. P The value <0.001 indicates that this molecular marker significantly affects the milk fat percentage trait. It is hoped that the milk fat percentage trait can be improved during the breeding process through assisted selection of this SNP site in cattle.

[0035] Additionally, according to Table 1 and... Figure 1 Furthermore, it is known that the proportion of individuals with the AA and AG genotypes is relatively high in the Chinese Holstein dairy cow population, while the proportion of individuals with the GG genotype is relatively low. This indicates that for the trait of milk fat percentage, the AA genotype is the most frequent genotype in the Chinese Holstein dairy cow population, which means that the AA genotype may be related to the low milk fat percentage in the Chinese Holstein dairy cow population. This suggests that for the trait of high milk fat percentage in the Chinese Holstein dairy cow population, the AA genotype may be detrimental, and this conclusion is corroborated by the previous conclusion.

[0036] Based on the above analysis, it is clear that the AA genotype results in low milk fat content and relatively poor milk quality. Therefore, in breeding processes, it is necessary to cull AA genotype breeding cattle and retain AG and GG genotype cattle to gradually increase the frequency of the G allele at this locus. Currently, the GG gene frequency in the Chinese Holstein dairy cattle population is approximately 6.53%, indicating significant potential for genetic improvement.

[0037] III. Amplification and Sequencing of Target DNA Sequence (1) Primer design The DNA sequence of bovine chromosome 14, as shown in SEQ ID NO.1, was downloaded from the Ensemble website (https: / / asia.ensembl.org / ). Primers were designed using the primer design software Primer Premier 6.0 and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The DNA sequences of the designed primers are shown below:

[0038] P001-F: 5'-ACTTCAAGCACAGCAACA-3' (SEQ ID NO. 2); P002-R: 5'-ATCCGAGTAGTCGTCTCC-3' (SEQ ID NO. 3).

[0039] (2) PCR amplification PCR amplification: Add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCRMaster Mix with Loading Dye, and 0.3 μL each of upstream primer P001-F and downstream primer P002-R to a 10 μL reaction system. The PCR reaction conditions are: pre-denaturation at 94℃ for 5 min to allow the DNA double strands to fully unwind; then perform 35 cycles of amplification. In each cycle, denature at 94℃ for 30 s to allow the DNA double strands to unwind into single strands, then anneal at 64.5℃ for 30 s to allow the primers to specifically bind to the template DNA single strands, and finally extend at 72℃ for 45 s to synthesize a new DNA strand under the action of DNA polymerase. After 35 cycles, perform a final extension at 72℃ for 5 min to ensure that the newly synthesized DNA strand is fully extended.

[0040] (3) DNA sequencing DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced using both forward and reverse reactions. The obtained sequences were compared with the Ensemble genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:

[0041] SEQ ID NO.1: ATGGATCTGCCCGTGGGCCCGGGCGCGGCGGGGCCCAGCAACGTCCCGGCCTTCCTGACCAAGCTGTGGACCCTCGTGAGCGACCCGGACACGGACGCGCTCATCTGCTGGAGCCCGAGCGGGAACAGCTTCCACGTGCTGGACCAGGGCCAGTTTGCCAAGGAGGTGCTGCCCAAGTACTTCAAGCACAGCAACATGGCTAGCTTCGTGCGGCAGCTCAACATGTATGGCTTCCGGAAGGTGGTCCACATTGAGCAGGGTGGCCTGGTCAAGCCAGAGAGGGACGACACCGAGTTCCAGCACCCGTGCTTCCTGCGAGGCCAGGAGCAGCTCCTCGAGAACATCAAGAGGAAAGTGACCAGTGTGTCCACTCTGCGGAGCGAGGACATAAAGATTCGCCAGGACAGTGTTACCAAGCTGTTGACCGACGTGCAGCTGATGAAGGGGAAGCAGGAGAGCATGGACTCCAAGCTGCTGGCCATGAAGCACGAGAACGAGGCGCTGTGGCGAGAGGTGGCCAGCCTGCGGCAGAAGCACGCCCAGCAACAGAAAGTCGTCAACAAGCTCATCCAGTTCCTCATCTCGCTGGTGCAGTCAAACCGGATCCTTGGGGTGAAGAGAAAGATCCCCCTGATGCTGAACGACGGCGGCCCTGCGCACCCCATGCCCAAGTACGGCCGGCAGTACTCGCTGGAGCATATCCACGGCCCAGGCCCCTACCCGGCCCCTTCCCCAGCCTACAGCGGCTCCAGCCTCTACTCCCCAGACGCTGTCACCAGCTCCGGACCCATCATCTCCGACATCACCGAACTGGCCCCCGGCAGCCCCGTGGCCTCCTCAGGCGGGAGTGTAGACGAGAGGCCCCTGTCCAGCAGCCCCCTGGTTCGCGTAAAGGAGGAGCCCCCAAGCCCGCCACAGAGCCCCCGGGCAGAGGGTGCCAGCCCCGGCCGACCATCCTCC N(A / G)TGGTGGAGACGCCTCTGTCCCCGACCACCCTTATTGACTCCATCCTCCGGGAGAGCGAGCCCACGCCCGTTGCCTCCACCACACCCTCGTGGACACCGGGGGCCGCCCCCCCTCGCCCCTGCCCGCCTCGGCTCCCGAGAAGTGCCTCACGGT CGCCTGCCTAGACAAGACCGAGCTCAGCGACCACTTGGACGCCATGGACTCCAACCTGGACAACCTGCAGACCATGCTGACAAGCCATGGCTTCAGCGTGGACACCAGCACCCTGCTGGATCTGTTCAGCCCCTCGGTTACGGTGCCCGACATG AGCCTGCCCGACCTGGACAGCAGCCTGGCCAGCATCCAGGAGCTCCTCTCTCCCCAGGAGCCCCCCAGACCTCTGGAGGCAGAAAAGCAGCCCAGACTCAGGGAAGCAGCTGGTGCACTACACCGCCCAGCCCCTGCTGCTCCTGGACCCGG GCTCCGTGGACGTGGGGAGCAGCGACCTGCCGGTGCTCTTCGAGCTGGGGGAGGGCTCCTACTTCTCCGAGGGAGACGACTACTCGGATGACCCCACCATCTCCCTGCTGACGGGCTCAGAACCCCCAAAGCCAAGGACCCCACTGTCTCGTAG The one marked in SEQ ID NO.1 N Mutation sites are indicated by underlining (the mutated bases are in parentheses, representing allele mutations). The positions of the designed primer sequences are indicated by bolding at the beginning and end of the sequence.

[0042] IV. Analysis of the SNP site g.961 A>G effect of molecular markers According to Table 1 and Figure 1 It is known that, for the milk fat percentage trait, the milk from the AG and GG genotypes at the SNP locus g.961 A>G in the Chinese Holstein dairy cattle population has a higher milk fat percentage (compared to the AA genotype). Higher milk fat percentage in cattle results in better milk quality, taste, flavor, and nutritional value. This will significantly improve the economic benefits of dairy farming and generate wealth for enterprises. By selecting the allele (G) for this SNP in individuals with the SNP marker, it is possible to ultimately improve economic efficiency and increase enterprise profits.

[0043] This invention utilizes the detection of the mutation site at position 961 in the sequence of SEQ ID NO.1 to conduct preliminary association analysis between its genotype and the milk fat percentage trait in cattle, providing a new molecular marker for marker-assisted selection in cattle.

[0044] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0045] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of a kit for detecting SNP molecular markers in the identification of milk fat percentage, screening of high milk fat percentage cattle, and genetic breeding of dairy cattle, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. In the sequence of SEQ ID NO.1, N at position 961 represents A or G. The polymorphism of the base at this position affects the milk fat percentage trait. Among them, the milk fat percentage of cows with the AA genotype is lower than that of cows with the AG or GG genotypes. The bovine reference genome version is: International Bovine Reference Genome Version 2.

0.

2. The application of the SNP molecular marker detection kit according to claim 1 in the identification of milk fat percentage trait, screening of high milk fat percentage cattle, and genetic breeding of dairy cattle, characterized in that, The kit for detecting SNP molecular markers includes the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.

3.

3. The application of the SNP molecular marker detection kit according to claim 1 in the identification of milk fat percentage trait, screening of high milk fat percentage cattle, and genetic breeding of dairy cattle, characterized in that, The application is as follows: extracting genomic DNA from the cattle to be tested; using the primer pairs shown in SEQ ID NO.2 to SEQ ID NO.3, and using the obtained genomic DNA from the cattle to be tested as template DNA, performing PCR amplification to obtain PCR amplification products; The PCR amplification products were sequenced to obtain the sequencing results; Based on the sequencing results, the genotype of the SNP molecular marker was determined; Based on the SNP sites of SNP molecular markers, individuals with the AA genotype were eliminated, while individuals with the AG or GG genotypes were retained; among them, the milk fat content of cattle with the AA genotype was lower than that of cattle with the AG or GG genotypes.

4. The application of the SNP molecular marker detection kit according to claim 3 in the identification of milk fat percentage trait, screening of high milk fat percentage cattle, and dairy cow genetic breeding, characterized in that, The PCR amplification program was as follows: pre-denaturation at 94℃ for 5 min, 35 cycles, each cycle first denaturing at 94℃ for 30 s, then annealing at 64.5℃ for 30 s, and finally extending at 72℃ for 45 s; after 35 cycles, a final extension at 72℃ for 5 min was performed.

5. A primer pair, characterized in that, Includes primers shown in SEQ ID NO.2 to SEQ ID NO.3, wherein the primer pairs are used to amplify the SNP molecular marker described in claim 1.

6. A detection kit containing the primer pair of claim 5.

7. The detection kit according to claim 6, characterized in that, The test kit also includes 2×Taq PCRMaster Mix with Loading Dye and double-distilled water.

8. The application of the primer pair according to claim 5 in the identification of milk fat percentage trait, screening of high milk fat percentage cattle, and genetic breeding of dairy cattle.

9. A method for detecting milk fat percentage, characterized in that, Includes the following steps: The SNP molecular marker described in claim 1 is detected on bovine chromosome 14. Based on whether the single nucleotide of the SNP site of the SNP molecular marker is A or G, the milk fat percentage trait is determined. Among them, the milk fat percentage of cattle with the AA genotype is lower than that of cattle with the AG or GG genotypes. The cattle mentioned are Chinese Holstein dairy cows; the bovine reference genome version is: International Bovine Reference Genome Version 2.

0.

10. A method for genetic improvement of cattle, characterized in that, Includes the following steps: The SNP molecular marker sites of claim 1 in the core breeding cattle population are determined, and corresponding selections are made based on the molecular markers: breeding cattle individuals with the AG or GG genotype at locus 616,087 on chromosome 14 of the International Bovine Reference Genome 2.0 are selected from the core breeding cattle population, and breeding cattle individuals with the AA genotype are culled, so as to increase the frequency of the G allele at this locus generation by generation, thereby improving the milk fat percentage trait of offspring cattle.