Primer probe set, detection reagent and application of primer probe set in detection of virulent pathogenic bacteria

Abstract

The invention relates to the field of biological detection, in particular to a primer probe set, a detection reagent and application of the primer probe set and the detection reagent in detection of virulent pathogenic bacteria. The invention provides a primer probe group. The primer probe group comprises a primer probe group used for amplifying bacillus anthracis, Francisella tularensis, bacillus plague, rhinotrichum-like bacteria, brucella, vibrio cholerae, salmonella typhimurium and staphylococcus aureus, wherein the primer probe group is used for amplifying bacillus anthracis, Francisella tularensis, bacillus plague, rhinotrichum-like bacteria, brucella, vibrio cholerae and salmonella typhimurium. The invention establishes a primer probe combination for rapidly and sensitively detecting various virulent pathogenic bacteria and a kit thereof, aiming at eight virulent pathogenic bacteria such as bacillus anthracis, Francisella tularensis, bacillus plague, rhinotrichum, vibrio cholerae, brucella, salmonella typhimurium and staphylococcus aureus. The kit is stored in a freeze-dried state, adaptive sample lysate can directly expand different types of samples, and the kit has the advantages of being good in specificity, high in sensitivity, short in detection time, good in accuracy, good in stability after redissolution and good in compatibility.

Description

Technical Field

[0001] This invention relates to the field of biological detection, and more particularly to primer and probe sets, detection reagents, and their application in detecting highly pathogenic bacteria. Background Technology

[0002] Highly contagious diseases (such as typhoid fever, plague, cholera, anthrax, pertussis, diphtheria, and meningococcal meningitis) are caused by highly pathogenic microorganisms (including bacteria, viruses, and parasites). They spread rapidly and cause enormous harm, seriously threatening public health and social stability, and are also considered potential biological warfare agents and bioterrorism agents. The core of their prevention and control lies in the early, rapid, and accurate identification of pathogenic microorganisms in order to promptly implement measures such as isolation and treatment and cutting off the transmission chain.

[0003] Traditional methods for detecting pathogenic microorganisms (such as microbial culture and isolation, and immunological detection) have significant drawbacks, such as being cumbersome to operate, time-consuming (usually requiring 3 to 4 days), and having low sensitivity, making it difficult to meet the urgent needs of rapid response to outbreaks of highly infectious diseases and emergency handling of biosafety incidents.

[0004] Nucleic acid detection technology based on polymerase chain reaction (PCR), especially real-time quantitative PCR (qPCR), has become the mainstream technology for rapid detection of pathogenic microorganisms due to its advantages such as high specificity, high sensitivity, and fast speed.

[0005] Conventional qPCR methods primarily target a single target in a single sample. However, when faced with samples of unknown origin or suspected mixed infections, it is often necessary to screen for multiple potential pathogens simultaneously. Traditional tube-based multiplex fluorescent PCR technology suffers from severely limited throughput due to interference between primers and probes and a limited number of fluorescence detection channels (typically only 3-4 targets can be detected simultaneously in a single reaction), making it difficult to meet the needs of simultaneous and rapid screening for multiple pathogens.

[0006] Melting curve analysis in fluorescent PCR is one of the effective ways to overcome the throughput limitations of multiplex detection. This method adds a melting program with an increasing temperature gradient after the PCR amplification program. During this process, fluorescent probes (or dyes embedded in the DNA double strand) that specifically bind to the target nucleic acid release fluorescence signals as the double-stranded DNA unwinds (melts), forming melting peaks with specific melting points (Tm values). Target nucleic acid products of different lengths and sequences (especially GC content and base matching) have different Tm values, thus enabling the differentiation of multiple targets within a single fluorescence channel. Theoretically, this method can significantly increase the number of targets detected per tube.

[0007] Multiplex fluorescent PCR melting curve method is based on the development of qPCR. It uses multiple sets of primers and fluorescent probes to amplify multiple nucleic acids at the same time, thereby realizing the simultaneous detection of multiple pathogens and making the detection more efficient. However, there are also certain factors that limit its development and need to be solved.

[0008] (1) The difficulty of designing multiple detection primer-probe combinations

[0009] Finding primer-probe combinations that are non-interfering, highly specific, have high amplification efficiency, and are distinguishable by Tm values ​​in multiplex reactions is extremely challenging. How to design primers reasonably while taking into account sensitivity and specificity is the main obstacle to applying existing technologies to such complex scenarios.

[0010] (2) Limitations on detection time

[0011] Although qPCR offers a significant improvement in detection time compared to traditional pathogen detection methods (such as microbial culture and isolation, and immunological detection), the detection time is usually greater than 2 hours.

[0012] (3) The sensitivity of multiplex detection will be suppressed.

[0013] Compared to conventional qPCR, multiplexing reduces detection sensitivity and may increase the risk of false negatives.

[0014] (4) The detection process is complicated: the nucleic acid extraction step increases the risk of contamination and the operation time.

[0015] (5) High storage costs: cold chain transportation is required, and it cannot be flexibly applied to different scenarios, such as field inspection operations.

[0016] While some patents have been published regarding the detection of highly pathogenic bacteria, several problems remain, including cumbersome testing procedures, potential sample contamination and false positives, limitations in throughput and sensitivity. Summary of the Invention

[0017] In view of this, the present invention provides primer and probe sets, detection reagents, and their applications in the detection of highly pathogenic bacteria. This invention establishes a rapid and sensitive primer and probe combination and kit for detecting multiple highly pathogenic bacteria, targeting eight highly pathogenic bacteria: Bacillus anthracis, Tulafrancella, Yersinia pestis, Meredithromyces, Vibrio cholerae, Brucella, Salmonella typhi, and Staphylococcus aureus. The kit is stored in a lyophilized state and can directly amplify different types of samples using appropriate sample lysis buffers. It has advantages such as high specificity, high sensitivity, short detection time, high accuracy, good stability after reconstitution, and good compatibility.

[0018] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0019] This invention provides primer sets, including one or more of primer sets 1 to 8;

[0020] Primer set 1: The primer set used for amplifying Bacillus anthracis has the following characteristics:

[0021] (1) Nucleotide sequences as shown in SEQ ID NO:1 and SEQ ID NO:2; or

[0022] (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (1), and which has the same or similar function to the nucleotide sequence shown in (1); and / or

[0023] Primer set 2: The primer set used for amplifying *Tula Francisella* has the following characteristics:

[0024] (3) Nucleotide sequences as shown in SEQ ID NO:5 and SEQ ID NO:6; or

[0025] (4) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (3), and which has the same or similar function to the nucleotide sequence shown in (3); and / or

[0026] Primer set 3: The primer set used for amplifying Yersinia pestis has the following characteristics:

[0027] (5) Nucleotide sequences as shown in SEQ ID NO:9 and SEQ ID NO:10; or

[0028] (6) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (5), and which has the same or similar function to the nucleotide sequence shown in (5); and / or

[0029] Primer set 4: The primer set used for amplifying melioidosis has the following characteristics:

[0030] (7) Nucleotide sequences as shown in SEQ ID NO:13 and SEQ ID NO:14; or

[0031] (8) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (7), and which has the same or similar function to the nucleotide sequence shown in (7); and / or

[0032] Primer set 5: The primer set used for amplifying Brucella has the following characteristics:

[0033] (9) Nucleotide sequences as shown in SEQ ID NO:17 and SEQ ID NO:18; or

[0034] (10) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (9), and which has the same or similar function to the nucleotide sequence shown in (9); and / or

[0035] Primer set 6: The primer set used for amplifying Vibrio cholerae has the following characteristics:

[0036] (11) Nucleotide sequences as shown in SEQ ID NO:21 and SEQ ID NO:22; or

[0037] (12) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (11), and having the same or similar function to the nucleotide sequence shown in (11); and / or

[0038] Primer set 7: The primer set used for amplifying Salmonella typhi has the following characteristics:

[0039] (13) Nucleotide sequences as shown in SEQ ID NO:25 and SEQ ID NO:26; or

[0040] (14) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (13), and having the same or similar function to the nucleotide sequence shown in (13); and / or

[0041] Primer set 8: The primer set used for amplifying Staphylococcus aureus has the following characteristics:

[0042] (15) Nucleotide sequences as shown in SEQ ID NO:29 and SEQ ID NO:30; or

[0043] (16) A nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (15), and a nucleotide sequence that has the same or similar function to the nucleotide sequence shown in (15).

[0044] In some embodiments of the present invention, the primers in the above primer set are modified with the nucleic acid analog inosine.

[0045] The present invention also provides a probe set, including one or more of probe set 1 to probe set 8;

[0046] Probe set 1: The probes for detecting Bacillus anthracis have the following characteristics:

[0047] (17) Nucleotide sequences as shown in SEQ ID NO:3 and SEQ ID NO:4; or

[0048] (18) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (17), and having the same or similar function to the nucleotide sequence shown in (17); and / or

[0049] Probe set 2: The probes for detecting *Tulafrancsis* have the following characteristics:

[0050] (19) Nucleotide sequences as shown in SEQ ID NO:7 and SEQ ID NO:8; or

[0051] (20) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (19), and which has the same or similar function to the nucleotide sequence shown in (19); and / or

[0052] Probe set 3: Probes for detecting Yersinia pestis have the following characteristics:

[0053] (21) Nucleotide sequences as shown in SEQ ID NO:11 and SEQ ID NO:12; or

[0054] (22) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (21), and having the same or similar function to the nucleotide sequence shown in (21); and / or

[0055] Probe set 4: Probes for detecting melioidosis have the following characteristics:

[0056] (23) Nucleotide sequences as shown in SEQ ID NO:15 and SEQ ID NO:16; or

[0057] (24) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (23), and having the same or similar function to the nucleotide sequence shown in (23); and / or

[0058] Probe set 5: Probes for detecting Brucella have the following characteristics:

[0059] (25) Nucleotide sequences as shown in SEQ ID NO:19 and SEQ ID NO:20; or

[0060] (26) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (25), and having the same or similar function to the nucleotide sequence shown in (25); and / or

[0061] Probe set 6: Probes for detecting Vibrio cholerae have the following characteristics:

[0062] (27) Nucleotide sequences as shown in SEQ ID NO:23 and SEQ ID NO:24; or

[0063] (28) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (27), and having the same or similar function to the nucleotide sequence shown in (27); and / or

[0064] Probe set 7: Probes for detecting Salmonella typhi have the following characteristics:

[0065] (29) Nucleotide sequences as shown in SEQ ID NO:27 and SEQ ID NO:28; or

[0066] (30) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (29), and which has the same or similar function to the nucleotide sequence shown in (29); and / or

[0067] Probe set 8: Probes for detecting Staphylococcus aureus have the following characteristics:

[0068] (31) Nucleotide sequences as shown in SEQ ID NO:31 and SEQ ID NO:32; or

[0069] (32) A nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (31), and which has the same or similar function as the nucleotide sequence shown in (31).

[0070] In some embodiments of the present invention, in the above-mentioned primer-probe set, the 5' end and 3' end of probe number 2X-1 are respectively connected to a fluorescent reporter group and a fluorescent quencher group; wherein, the fluorescent reporter group is selected from any one of FAM, HEX, TET, CY3, Red-X, TAMRA, and ROX; and the fluorescent quencher group is selected from any one of Dabcy1, BHQ1, BHQ2, BHQ3, and MGB.

[0071] The probe numbered 2X has 3' end phosphorylation.

[0072] In some embodiments of the present invention, in the above primer-probe set, the probe number 2X-1 corresponds to probe 1; the probe number 2X corresponds to probe 2.

[0073] The present invention also provides a primer-probe set, comprising: the primer set and the probe set described above.

[0074] In some embodiments of the present invention, the primer-probe set further includes: an internal standard primer set and an internal standard probe set;

[0075] The internal standard primer set has the following characteristics:

[0076] (33) Nucleotide sequences as shown in SEQ ID NO:33 and SEQ ID NO:34; or

[0077] (34) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (33), and having the same or similar function to the nucleotide sequence shown in (33); and / or

[0078] The internal standard probe set has:

[0079] (35) Nucleotide sequences as shown in SEQ ID NO:35 and SEQ ID NO:36; or

[0080] (36) A nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (35), and which has the same or similar function as the nucleotide sequence shown in (35).

[0081] In some embodiments of the present invention, the primer-probe set includes: an anthrax Bacillus primer-probe combination:

[0082] Upstream primer: GCACATGGTACTACTCAA (SEQ ID NO:1);

[0083] Downstream primer: GTTCCCAATAAATGTCTGTA (SEQ ID NO:2);

[0084] Probe 1: TCCTTCTATGTATGTACGAGTCTCTGA (SEQ ID NO:3);

[0085] Probe 2: TCGTTCTATCTATGAACGAGTCTCTGA (SEQ ID NO:4);

[0086] Tulafrancsis primer and probe combination:

[0087] Upstream primer: TTGCCGAGTCAGTCTATG (SEQ ID NO:5);

[0088] Downstream primer: GCTACTGAGTACCTCAAC (SEQ ID NO:6);

[0089] Probe 1: TAACTGCTAGACCTTCCTGACACCA (SEQ ID NO:7);

[0090] Probe 2: TATCTGCTAGAGCTTGCTCACACCA (SEQ ID NO:8);

[0091] Yersinia pestis primer-probe combination:

[0092] Upstream primer: CCTCTTCATTAACTGGTAAG (SEQ ID NO:9);

[0093] Downstream primer: TCCCACTACTATCCTTTAC (SEQ ID NO:10);

[0094] Probe 1: CCAACTGAAGATGTTACTAGCATAA (SEQ ID NO:11);

[0095] Probe 2: CGATCTGATGATGTTACTAGCATAA (SEQ ID NO:12);

[0096] Meredithromyces primer and probe combination:

[0097] Upstream primer: CCCAATTCGTATCTAAATCC (SEQ ID NO:13);

[0098] Downstream primer: TTCGGCGATATCAAATTG (SEQ ID NO:14);

[0099] Probe 1: TTCTGTTCGGCAGCAATCAGC (SEQ ID NO:15);

[0100] Probe 2: TTCTGATCCGCAGCAATCAGC (SEQ ID NO:16);

[0101] Brucella primer-probe combination:

[0102] Upstream primer: GGTCTTTACCTTGGCTATG (SEQ ID NO:17);

[0103] Downstream primer: CACCTTCAACACCGTATA (SEQ ID NO:18);

[0104] Probe 1: CACCTTCAACACCGTATA (SEQ ID NO:19);

[0105] Probe 2: CAGCTTCATCACGGTATA (SEQ ID NO: 20);

[0106] Vibrio cholerae primer and probe combination:

[0107] Upstream primer: GAGGTAGAAATCTTATGTGAA (SEQ ID NO:21);

[0108] Downstream primer: CTTGGCTATATGTTTACTGA (SEQ ID NO:22);

[0109] Probe 1: TGAGTCCTCGCTGCTACGC (SEQ ID NO:23);

[0110] Probe 2: TGATGTCGTCGCTCCTACGC (SEQ ID NO:24);

[0111] Salmonella Typhi primer and probe combination:

[0112] Upstream primer: CCGCTATCAAAGGCTATG (SEQ ID NO:25);

[0113] Downstream primer: CACCAGAAATCGATGCAG (SEQ ID NO:26);

[0114] Probe 1: TCACCAGACACTCATCACCAGC (SEQ ID NO:27);

[0115] Probe 2: TCACGAGACACTCATCACGAGC (SEQ ID NO:28);

[0116] Staphylococcus aureus primer-probe combination:

[0117] Upstream primer: AGAGGTATACTATGTCAAATAC (SEQ ID NO:29);

[0118] Downstream primer: AACCGAAAATATGTAAAGGA (SEQ ID NO:30);

[0119] Probe 1: AGAGAAGAATACGCTACCGAACAATC (SEQ ID NO:31);

[0120] Probe 2: AGTAGAACATTACGCTACCCAACAATC (SEQ ID NO:32);

[0121] Internal standard primer-probe combination:

[0122] Upstream primer: CCATGACAACTTTGGTATTG (SEQ ID NO:33);

[0123] Downstream primer: AGGGATGATGTTCTGGAG (SEQ ID NO:34);

[0124] Probe 1: CCACGGTCCACGCTATCACT (SEQ ID NO:35);

[0125] Probe 2: CGACGCTCCTCGCTATCACT (SEQ ID NO:36).

[0126] The present invention also provides the application of the above-mentioned primer set, probe set and / or primer-probe set in the preparation of detection products and / or devices for detecting highly pathogenic bacteria.

[0127] In some embodiments of the present invention, in the above applications, the highly pathogenic bacteria include one or more of the following: Bacillus anthracis, Tulafrancs, Yersinia pestis, melioidosis, Vibrio cholerae, Brucella, Salmonella typhi, and Staphylococcus aureus.

[0128] The present invention also provides a detection product comprising the above-described primer set, the above-described probe set, and / or the above-described primer-probe set, as well as acceptable adjuvants.

[0129] In some embodiments of the present invention, in the above-mentioned detection product, the final concentration of the primer set is 25nM~500nM; and the final concentration of the probe set is 65nM~800nM.

[0130] In some embodiments of the present invention, the concentrations of the primer-probe set in the above-described detection product are as follows:

[0131]

[0132]

[0133] In some embodiments of the present invention, the above-mentioned detection product further includes one or more of the following: DNA polymerase, protectant, PCR enhancer, and sample lysis buffer.

[0134] In some embodiments of the present invention, the concentration of the DNA polymerase in the above-mentioned detection product is 1 U / μL to 8 U / μL.

[0135] In some embodiments of the present invention, the concentration of the DNA polymerase in the above-mentioned detection product is 2 U / μL to 5 U / μL.

[0136] In some embodiments of the present invention, the protective agent in the above-mentioned detection product includes one or more of the following: trehalose, polyethylene glycol, Tween 20, bovine serum albumin, and PCR enhancer.

[0137] In some embodiments of the present invention, the protective agent in the above-mentioned test product includes one or more of the following: 1-15% (W / V) trehalose, 2% (V / V) polyethylene glycol, 0.05% (V / V) Tween 20 and 1-10% (W / V) bovine serum albumin.

[0138] In some embodiments of the present invention, the protective agent in the above-mentioned test product includes one or more of the following: 5-10% (w / v) trehalose, 2% (v / v) polyethylene glycol, 0.05% (v / v) Tween 20 and 2-5% (w / v) bovine serum albumin.

[0139] In some embodiments of the present invention, the sample lysis buffer in the above-mentioned detection product includes one or more of the following: buffer, formamide, Triton X-100, and bovine serum albumin.

[0140] In some embodiments of the present invention, the sample lysis buffer in the above-mentioned detection product includes one or more of the following: 10 mM Tris-HCl buffer, 5-50% (V / V) formamide, 0.05-10% (V / V) Triton X-100 and 0.1-5% (W / V) bovine serum albumin.

[0141] In some embodiments of the present invention, the sample lysis buffer in the above-mentioned detection product includes one or more of the following: 10 mM Tris-HCl buffer, 10-30% (V / V) formamide, 0.1-5% (V / V) Triton X-100 and 0.5-2% (W / V) bovine serum albumin.

[0142] In some embodiments of the present invention, the PCR enhancer in the above-mentioned detection product includes: tetramethylammonium chloride.

[0143] In some embodiments of the present invention, the PCR enhancer in the above-mentioned detection product includes: 1-300mM tetramethylammonium chloride.

[0144] In some embodiments of the present invention, the PCR enhancer in the above-mentioned detection product includes 15-100 mM tetramethylammonium chloride.

[0145] The present invention also provides a detection kit comprising: the primer set, the probe set, the primer-probe set and / or the detection product described above, as well as acceptable adjuvants and / or devices.

[0146] The present invention also provides a method for using the above-mentioned detection product and / or the above-mentioned detection kit, wherein the detection product is mixed with the sample nucleic acid, PCR detection is performed, and the positive or negative status of the sample is determined based on the detection results.

[0147] The beneficial effects of this invention include:

[0148] (1) High specificity: The rigorously screened and optimized primer-probe combination ensures the specificity of the detection and effectively avoids cross-reactions between the eight pathogens and with non-target microorganisms. The difference in the Tm value of the melting curve provides a second layer of identification basis, further ensuring the accuracy of result interpretation.

[0149] (2) High sensitivity: The LOD for Bacillus anthracis, Staphylococcus aureus, Tula Francisella, Brucella and Meredithiomycosis reaches 50 copies / mL; the LOD for Vibrio cholerae, Yersinia pestis and Salmonella typhi is 100 copies / mL.

[0150] (3) Rapid, efficient and stable: The rapid PCR enzyme system is used, and the sample lysis buffer is adapted to the direct amplification of the nucleic acid extraction-free technology. The entire detection process takes less than 1 hour, and the reagents have good stability after reconstitution.

[0151] (4) Strong compatibility of direct sample amplification: The compatible sample lysis buffer can be used for direct amplification of oropharyngeal swabs, serum and soil samples, with strong compatibility.

[0152] (5) High detection efficiency: Compared with multiplex qPCR, a single tube and a single reaction can simultaneously screen for and cover 8 highly pathogenic and virulent pathogens, thus increasing the detection throughput.

[0153] (6) Easy to operate: The premixed lyophilized reagent is used. Users only need to add the extraction-free nucleic acid template to perform multiple detection, which greatly simplifies the operation steps and reduces the technical requirements for operators.

[0154] (7) Biosafety: Direct sample lysis and no need for multiple solution preparations avoid excessive contact with infectious samples by operators and ensure the personal safety of operators.

[0155] (8) Low cost: Single tube detection of multiple targets also significantly reduces the detection cost of a single pathogen (reagent consumption, manpower, time). Attached Figure Description

[0156] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0157] Figure 1The diagram shows a mismatch between the upstream and downstream primers of the primer-probe combination; where: A shows a mismatch between the downstream primer of *Tetrandrine tularemia* and the upstream primer of *Yersinia pestis*; B shows a mismatch between the upstream primer of *Tetrandrine tularemia* and the downstream primer of *Melioides melioides*.

[0158] Figure 2 The images show comparisons of primer and probe combinations before and after optimization; where: A shows *Tetrandella tularensis* before optimization; B shows *Tetrandella tularensis* after optimization; C shows *Yersinia pestis* before optimization; D shows *Yersinia pestis* after optimization; E shows *Melioides aureus* before optimization; F shows *Melioides aureus* after optimization; G shows blank control before optimization; H shows blank control after optimization.

[0159] Figure 3 The results of sensitivity testing are shown below: A shows the amplification curves of Bacillus anthracis samples at different concentrations; B shows the melting curves of Bacillus anthracis samples at different concentrations; C shows the amplification curves of Staphylococcus aureus samples at different concentrations; D shows the melting curves of Staphylococcus aureus samples at different concentrations; E shows the amplification curves of Tulafrancs samples at different concentrations; F shows the melting curves of Tulafrancs samples at different concentrations; G shows the amplification curves of Vibrio cholerae samples at different concentrations; H shows the melting curves of Vibrio cholerae samples at different concentrations; I shows the amplification curves of Brucella samples at different concentrations; J shows the melting curves of Brucella samples at different concentrations; K shows the amplification curves of Glandella bacteria at different concentrations; L shows the melting curves of Glandella bacteria at different concentrations; M shows the amplification curves of Yersinia pestis samples at different concentrations; N shows the melting curves of Yersinia pestis samples at different concentrations; O shows the amplification curves of Salmonella typhi at different concentrations; P shows the melting curves of Salmonella typhi at different concentrations.

[0160] Figure 4The results of multiplex mixed positive plasmid samples are shown below: A shows the amplification curve of Bacillus anthracis in a single sample; B shows the melting curve of Bacillus anthracis in a single sample; C shows the amplification curve of Bacillus anthracis in a double sample; D shows the melting curve of Bacillus anthracis in a double sample; E shows the amplification curve of Glandella spp. in a double sample; F shows the melting curve of Glandella spp. in a double sample; G shows the amplification curve of Bacillus anthracis in a quadruple sample; H shows the melting curve of Bacillus anthracis in a quadruple sample; I shows the amplification curves of Vibrio cholerae and Brucella in a quadruple sample; J shows the melting curves of Vibrio cholerae and Brucella in a quadruple sample; K shows the amplification curve of Glandella spp. in a quadruple sample; L shows the melting curve of Glandella spp. in a quadruple sample; M shows the amplification curve of Bacillus anthracis and Tula Francisella in a septum sample; N shows the amplification curve of Bacillus anthracis in a septum sample. Melting curves of Bacillus and Tulafrancsis; O shows the amplification curves of Vibrio cholerae and Brucella in 6-sample composites; P shows the melting curves of Vibrio cholerae and Brucella in 6-sample composites; Q shows the amplification curves of Glandella and Yersinia pestis in 6-sample composites; R shows the melting curves of Glandella and Yersinia pestis in 6-sample composites; S shows the amplification curves of Bacillus anthracis, Staphylococcus aureus, and Tulafrancsis in 8-sample composites; T shows the melting curves of Bacillus anthracis, Staphylococcus aureus, and Tulafrancsis in 8-sample composites; U shows the amplification curves of Vibrio cholerae and Brucella in 8-sample composites; V shows the melting curves of Vibrio cholerae and Brucella in 8-sample composites; W shows the amplification curves of Glandella, Salmonella typhi, and Yersinia pestis in 8-sample composites; X shows the melting curves of Glandella, Salmonella typhi, and Yersinia pestis in 8-sample composites.

[0161] Figure 5 The results of stability tests on the reconstituted products are shown below; where: A represents the stability results of Bacillus anthracis at different time points; B represents the stability results of Tula Francisella at different time points; C represents the stability results of Yersinia pestis at different time points; D represents the stability results of Glandella melioides at different time points; E represents the stability results of Brucella at different time points; F represents the stability results of Salmonella typhi at different time points; G represents the stability results of Vibrio cholerae at different time points; H represents the stability results of Staphylococcus aureus at different time points; and I represents the stability results of precision samples at different time points.

[0162] Figure 6 Schematic diagram of negative control; where: A shows the amplification curve; B shows the melting curve;

[0163] Figure 7The diagram shows positive results for eight highly pathogenic bacteria; A shows the amplification curve of Bacillus anthracis; B shows the melting curve of Bacillus anthracis; C shows the amplification curve of Staphylococcus aureus; D shows the melting curve of Staphylococcus aureus; E shows the amplification curve of Tulafrancsis; F shows the melting curve of Tulafrancsis; G shows the amplification curve of Vibrio cholerae; H shows the melting curve of Vibrio cholerae; I shows the amplification curve of Brucella; J shows the melting curve of Brucella; K shows the amplification curve of Glandella; L shows the melting curve of Glandella; M shows the amplification curve of Salmonella typhi; N shows the melting curve of Salmonella typhi; O shows the amplification curve of Yersinia pestis; P shows the melting curve of Yersinia pestis.

[0164] Figure 8 The amplification curve of the blank control kit shows nonspecific amplification.

[0165] Figure 9 The freeze-drying reaction system is shown. Detailed Implementation

[0166] This invention discloses primer and probe sets, detection reagents, and their application in detecting highly pathogenic bacteria.

[0167] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.

[0168] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.

[0169] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.

[0170] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.

[0171] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately". Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.

[0172] This invention provides a primer-probe combination for the simultaneous detection of multiple highly pathogenic bacteria: the combination includes primer pairs and corresponding probes designed for specific target sequences in the genomes and internal standard genes of eight pathogenic bacteria, namely Bacillus anthracis, Tulafrancs, Yersinia pestis, Glandella, Vibrio cholerae, Brucella, Salmonella typhi, and Staphylococcus aureus.

[0173] The primer sequences for detecting Bacillus anthracis are shown in SEQ ID NO. 1~2, and the probe sequences are shown in SEQ ID NO. 3~4.

[0174] The primer sequences for detecting *Tulafrancsis* are shown in SEQ ID NO. 5-6, and the probe sequences are shown in SEQ ID NO. 7-8.

[0175] The primer sequences for detecting Yersinia pestis are shown in SEQ ID NO. 9~10, and the probe sequences are shown in SEQ ID NO. 11~12.

[0176] The primer sequences for detecting melioidosis are shown in SEQ ID NO.13~14, and the probe sequences are shown in SEQ ID NO.15~16.

[0177] The primer sequences for detecting Vibrio cholerae are shown in SEQ ID NO.17~18, and the probe sequences are shown in SEQ ID NO.19~20.

[0178] The primer sequences for detecting Brucella are shown in SEQ ID NO.21~22, and the probe sequences are shown in SEQ ID NO.23~24.

[0179] The primer sequences for detecting Salmonella typhi are shown in SEQ ID NO.25~26, and the probe sequences are shown in SEQ ID NO.27~28.

[0180] The primer sequences for detecting Staphylococcus aureus are shown in SEQ ID NO.29~30, and the probe sequences are shown in SEQ ID NO.31~32.

[0181] The primer sequences for detecting the internal standard gene are shown in SEQ ID NO.33~34, and the probe sequences are shown in SEQ ID NO.35~36.

[0182] Multiplex fluorescent PCR melting curve detection kit: Based on the above primer and probe combination, the present invention provides a multiplex fluorescent PCR melting curve detection kit.

[0183] The core components of this kit include: premixed and dispensed lyophilized reaction system, lyophilized negative control, lyophilized positive control, reconstitution solution, and sample lysis buffer.

[0184] The premixed and dispensed lyophilized reaction system includes PCR working solution, heat-stable DNA polymerase mixture, and lyophilization protectant.

[0185] The PCR working solution contains a primer and probe combination premix of Bacillus anthracis, Tulafrancs, Yersinia pestis, Glandella, Vibrio cholerae, Brucella, Salmonella typhi, Staphylococcus aureus, and the internal standard gene GAPDH, wherein the working concentration of the primers is 25~500 nmol / L and the working concentration of the probes is 65~800 nmol / L.

[0186] The PCR working solution contains tetramethylammonium chloride PCR enhancer at a concentration of 15-100 nM.

[0187] The heat-stable DNA polymerase mixture is a rapid PCR enzyme with a concentration of 2-5 U / μL.

[0188] The premixed and packaged lyophilization reaction system contains lyophilization protectants including 5%~10% trehalose (W / V), 2% polyethylene glycol (V / V), 0.05% Tween 20 (V / V), and 2%~5% bovine serum albumin (W / V).

[0189] The premixed and dispensed lyophilized reaction system is as follows: 1 μL primer probe working solution (containing primer probes for 8 pathogens and human GAPDH), 4 μL enzyme mixture, and PCR working solution (Mg... 2+ 2 μL of KCl, ammonium sulfate, tetramethylammonium chloride, Tris-HCl, dNTPs, etc., 8 μL of purified water, 5 μL of lyophilization protectant, totaling 20 μL / test reagent for PCR pre-lyophilization.

[0190] The sample lysis buffer includes TE buffer (10mM Tris-HCl (pH 8.0), 10%~30% formamide (V / V), 0.1%~5% Triton X-100 (V / V), and 0.5%~2% bovine serum albumin (W / V).

[0191] The process of lysing sample nucleic acid with the sample lysis buffer is as follows: the sample and sample lysis buffer are mixed in equal proportions, and after being mixed evenly, they are allowed to stand for 3 minutes.

[0192] The premixed and dispensed lyophilization reaction system is used as follows: take the lysed sample nucleic acid and add it directly to the premixed and dispensed lyophilization reaction system.

[0193] The freeze-drying reaction system includes the following steps: mixing PCR working solution, DNA polymerase, and protective agent, then adding liquid nitrogen dropwise before freeze-drying.

[0194] The freeze-drying process sequence is as follows: pre-freezing at -40℃ for 0.5~2h; main drying at -40℃, 0.01mbar for 0.5~1h; -35℃, 0.01mbar for 1~1.5h; -30℃, 0.01mbar for 6~12h; 0℃, 0.01mbar for 2~2.5h; 20℃, 0.01mbar for 2~2.5h; and final drying at 30℃, 0.01mbar for 3~4h.

[0195] The multiplex PCR amplification program is as follows: 50℃ for 2 min, 95℃ for 1 min; 95℃ for 5 s, 60℃ for 10 s (collect fluorescence), 69℃ for 5 s, 42 cycles. The melting curve program is: 25℃ for 10 s, 25~68℃ (collect fluorescence).

[0196] The fluorescence channels and melting temperatures corresponding to the eight highly pathogenic bacteria are as follows. The type of pathogenic bacteria can be determined based on the Ct value of the fluorescence channel and the melting temperature.

[0197] The fluorescence detection channel for the anthrax Bacillus is FAM, with a Ct value ≤ 40 and a Tm value of 29.0~33.0.

[0198] The fluorescence detection channel for the Staphylococcus aureus is FAM, with a Ct value ≤ 40 and a Tm value of 37.0~41.0.

[0199] The fluorescence detection channel for *Tulafrancsis* is FAM, with a Ct value ≤ 40 and a Tm value of 46.0~50.0.

[0200] The fluorescence detection channel for Vibrio cholerae is VIC, with a Ct value ≤ 40 and a Tm value of 42.0~46.0.

[0201] The fluorescence detection channel for Brucella is VIC, with a Ct value ≤ 40 and a Tm value of 50.5~54.5.

[0202] The fluorescence detection channel for the aforementioned melioidosis bacteria is ROX, with a Ct value ≤ 40 and a Tm value of 39.5~43.5.

[0203] The fluorescence detection channel for the Salmonella typhi is ROX, with a Ct value ≤ 40 and a Tm value of 47.0~51.0.

[0204] The fluorescence detection channel for the Yersinia pestis is ROX, with a Ct value ≤ 40 and a Tm value of 52.5~56.5.

[0205] The fluorescence detection channel of the internal standard is CY5, with a Ct value ≤ 40 and a Tm value of 41.0~45.0.

[0206] This invention provides a method for simultaneously detecting multiple highly pathogenic bacteria, using the kit of this invention, and implemented according to the following steps:

[0207] a) The sample lysis buffer releases the sample nucleic acid;

[0208] b) Add sample to the premixed and dispensed lyophilized reaction system;

[0209] c) Single-tube multiplex fluorescent PCR amplification: The reaction system contains a premixed primer and probe combination;

[0210] d) Result analysis and judgment: The type of pathogen infection is determined based on the Ct value of the amplification curve and the Tm value of the melting curve.

[0211] In Examples 1 to 7 of this invention, all raw materials and reagents used can be purchased from the market.

[0212] The present invention will be further illustrated below with reference to the embodiments:

[0213] Example 1: Primer-Probe Combination Optimization Case

[0214] To construct a high-specificity and high-sensitivity multiplex qPCR system, target sequences of eight highly pathogenic bacteria were downloaded from bioinformatics databases. Primers were designed from relatively conserved regions, and then specific probes capable of recognizing various target nucleic acid sequences were designed from regions with high differences between primer pairs. Some primer-probe combinations are shown in the table.

[0215] Table 1. Sequence listing of some primers and probes

[0216]

[0217] Then, the primers and probes are screened using the following steps:

[0218] Initial screening of single-system: The amplification curve is used to screen the optimal primers and probes of each group based on the lowest cycle threshold (Ct) and the highest fluorescence intensity (ΔRn) increase. The melting curve is required to have a Tm value difference of ≥5℃.

[0219] Multiple combination construction: After merging the optimal single combinations, the following problems were found in *Tulafrancsis*, *Yersinia pestis*, and *Melioides nigra*:

[0220] When a positive plasmid is amplified, a bimodal amplification curve appears, while the blank control shows nonspecific amplification.

[0221] The primer combination sequences were analyzed, and the results are shown below. Figure 1 A and Figure 1 B.

[0222] Figure 1 The A-value indicates a 6-base mismatch between the downstream primer of *Streptococcus tularensis* and the upstream primer of *Yersinia pestis*. Figure 1 The B result indicates a six-base mismatch between the upstream primer of *La frondosa* and the downstream primer of *Mallotus tumefaciens*. This mismatch leads to primer dimer formation, interfering with multiplex amplification. This suggests that the existing *La frondosa* primer combination negatively impacts multiplex amplification.

[0223] Triple optimization of primers for *Tulafrancsis*:

[0224] Targeted base modification: Introducing ≥2 mismatched bases into the critical region of the primer;

[0225] Nucleic acid analogue replacement: Hypoxanthine modification is used to reduce nonspecific binding;

[0226] Enhanced reaction system: Adding tetramethylammonium chloride (TMAC) stabilizes the DNA double strand and regulates the consistency of Tm values.

[0227] Comparison of detection effects of Tulafrancella, Yersinia pestis, and Meredithroids before and after optimization. Figure 2 As shown.

[0228] Example 2: Optimization of Multiplex Detection Kit

[0229] To establish a stable multiplex assay kit system, the concentrations of primers / probes, the amount of enzyme, and the amount of protective agent need to be optimized to determine the optimal PCR reaction system. To evaluate the ability of the sample lysis buffer to lyse sample nucleic acids, the sample lysis buffer needs to be tested to adapt it to the multiplex assay kit. The design scheme is shown in Tables 2-5.

[0230] Table 2 Optimization of Primer and Probe Dosage

[0231]

[0232] Table 3 Enzyme Dosage Optimization

[0233]

[0234] Table 4 Optimization of Protectant Formulation

[0235]

[0236] Table 5 Optimization of Sample Lysis Buffer Formulation

[0237]

[0238] To evaluate the design scheme, simulated sample A (concentration 2×10⁻⁶) was constructed, containing 2-fold (Bacillus anthracis, Glandella) and 4-fold (Bacillus anthracis, Brucella, Vibrio cholerae, Glandella) recombinant plasmids of the target pathogens. 5 copies / mL), B (concentration 2×10 3 The samples were tested according to the method for simultaneous detection of multiple highly pathogenic bacteria (copies / mL). The test results are shown in Tables 6 to 9.

[0239] Analysis of test results: The amplification curve exhibits a typical S-shaped amplification curve with the lowest cycle threshold (Ct). The melting curve shows a clear melting peak (clear Tm value) as the judgment criterion. The differences between various design combinations are compared to find the optimal solution.

[0240] Table 6. Screening Results of Primer and Probe Dosage

[0241]

[0242] The analysis results show that the Ct value of the amplification curve of combination 1 is smaller than that of combination 2, and the peak shape of the melting curve of combination 1 is better than that of combination 2. Finally, it was confirmed that the optimal amount of primers and probes is combination 1, that is, the working concentration of primers is 25~500 nmol / L and the working concentration of probes is 65~800 nmol / L.

[0243] Table 7. Enzyme Dosage Screening Results

[0244]

[0245] The analysis results showed that there was no significant difference in the Ct values ​​of the amplification curves of combination 2 and combination 3, and both were smaller than those of combination 1 and combination 4. The peak shapes of the melting curves of the four groups were not significantly different. Finally, it was confirmed that the concentration of enzyme used was between combination 2 and combination 3, that is, 2~5 U / μL.

[0246] Table 8 Screening results of protective agent formulations

[0247]

[0248] The analysis results showed that there was no significant difference in the Ct values ​​of the amplification curves of combination 2 and combination 3, and both were smaller than those of combination 1 and combination 4. The peak shapes of the melting curves of the four groups were not significantly different. Finally, it was confirmed that the concentrations of each component of the protective agent were between those of combination 2 and combination 3, namely 5%~10% trehalose (W / V), 2% polyethylene glycol (V / V), 0.05% Tween 20 (V / V), 2%~5% bovine serum albumin (W / V), and 15~100mM tetramethylammonium chloride.

[0249] Table 9. Results of Sample Lysis Buffer Formulation Screening

[0250]

[0251] The analysis results showed that there was no significant difference in the Ct values ​​of the amplification curves of combination 2 and combination 3, and both were smaller than those of combination 1 and combination 4. The peak shapes of the melting curves were not significantly different among the four groups. Finally, it was confirmed that the concentrations of each component in the sample lysis buffer were between those of combination 2 and combination 3, namely TE buffer (10 mM Tris-HCl (pH 8.0), 10%~30% formamide (V / V), 0.1%~5% Triton X-100 (V / V), 0.5%~2% bovine serum albumin (W / V).

[0252] Example 3 Sensitivity Test

[0253] To accurately assess the limit of detection (LOD) of the kit, following the method for simultaneous detection of multiple highly pathogenic bacteria, artificial simulant samples of 8 highly pathogenic bacteria (concentration gradient: 10) were used. 6 , 10 5 , 10 4 , 10 3 The assay was performed using 100 and 50 copies / mL. The results are shown below; see details. Figure 3 .

[0254] Amplification curve analysis: All eight pathogens showed typical S-shaped amplification curves at their respective concentrations, with uniform curve spacing between different concentration gradients, indicating good amplification efficiency and excellent linearity.

[0255] Melting curve analysis: Each pathogen target produces a single, clear melting peak (with a clear Tm value), which can accurately distinguish the types of pathogens.

[0256] Lowest limit of detection (LOD): such as Figure 3 As shown, the kit achieves a LOD of 50 copies / mL against Bacillus anthracis, Staphylococcus aureus, Tulafrancs, Brucella, and Meredithromyces; and a LOD of 100 copies / mL against Vibrio cholerae, Yersinia pestis, and Salmonella typhi. These results fully demonstrate the high sensitivity of this kit.

[0257] Example 4: Verification of Multiple Positive Detection Capability

[0258] To evaluate the performance of the kit in multiple infection scenarios, particularly the interference and specificity between primer-probe combinations, simulated samples (A1~A5, all at a concentration of 2×10⁻⁶) containing different numbers (single, double, quadruple, hexaple, and octuplet) of recombinant plasmids from target pathogens (Bacillus anthracis, Tulafrancella, Yersinia pestis, Glandella, Vibrio cholerae, Brucella, Salmonella typhi, and Staphylococcus aureus) were constructed. 4 (copies / mL), and tested according to the "Method for Simultaneous Detection of Multiple Highly Pathogenic Bacteria".

[0259] Test results: All preset target pathogens were accurately detected in samples A1 (single) to A5 (eight), as shown in the "Result Judgment" column of Table 10.

[0260] The results strongly confirm that this kit has excellent multiplex detection capability. Even under high multiplex (8-fold) conditions, the interference between primer-probe combinations is minimal, the specificity is maintained, the detection efficiency is high, and the kit performance is stable and reliable.

[0261] Table 10 Detection results of multiple mixed positive plasmid samples

[0262]

[0263] Example 5: Stability test of the reagent kit after reconstitution

[0264] To evaluate the stability of this kit after reconstitution, the pre-aliported lyophilized reaction system was reconstituted and left at room temperature for 0 h, 12 h, 24 h, and 36 h, and then tested according to the method of claim 8.

[0265] Negative samples: Staphylococcus epidermidis, mumps virus, Haemophilus influenzae, human genomic DNA recombinant plasmid (5×10⁻⁶) 6 All copies / mL were correctly detected as negative.

[0266] Low-value positive samples: recombinant plasmids of 8 target pathogens including Bacillus anthracis (1×10⁻⁶) 3 Positive results could be consistently detected in both copies / mL.

[0267] Precision sample: Bacillus anthracis recombinant plasmid (2×10⁻⁶) 6 The samples were tested repeatedly for 10 copies / mL, and the calculated precision (CV%) were: 0h (1.02%), 12h (0.73%), 24h (0.55%), and 36h (0.35%), respectively. The precision was excellent and changed very little over time.

[0268] Conclusion: During the 36-hour room temperature storage, the detection ability and precision of the kit for negative and low-concentration positive samples did not change significantly, fully demonstrating its excellent stability after reconstitution. The test results of negative samples are shown in Table 11, and the test results of low-value positive samples are shown in Figure 5 A to Figure 5 H of Figure 5 I.

[0269] Table 11 Test Results of Negative Samples at Different Time Points

[0270]

[0271] Example 6 Direct Amplification Compatibility Test for Different Sample Types

[0272] To verify the performance of the sample lysate compatible with the kit for direct amplification of different clinical and environmental samples, positive substances of 8 target pathogenic bacteria (all at a concentration of 1×10 3 copies / mL) were separately added to human oropharyngeal swabs, human negative serum, and negative soil samples to prepare simulated samples. Direct amplification was performed using the sample lysate, and the kit was used for detection (the method is described in "Method for Simultaneously Detecting Multiple Virulent Pathogenic Bacteria"). The results are shown in Table 12.

[0273] Test Results: Among the three different sample types of oropharyngeal swabs, serum, and soil, all 8 target pathogenic bacteria were accurately detected, and the results were all positive for the corresponding pathogenic bacteria.

[0274] This result clearly shows that the nucleic acid-free sample lysate supporting this kit has broad sample type compatibility, is suitable for direct amplification of samples from multiple sources, and does not require nucleic acid purification.

[0275] Table 12 Test Results for Different Sample Types

[0276]

[0277] Example 7 Detection of Clinical Simulated Samples

[0278] Due to the strong pathogenicity of the target pathogenic microorganisms and the difficulty in obtaining real clinical samples, 16 simulated clinical samples were specially prepared (10 cases containing positive fragments of the target pathogenic bacteria and 6 cases of negative samples with similar or homologous sites to the target pathogenic microorganisms in the disease site) for verification. The samples were prepared by mixing engineered bacterial solutions with the negative matrix of human oropharyngeal swabs. Detection was performed according to the "Method for Simultaneously Detecting Multiple Virulent Pathogenic Bacteria", and the test results were compared with the preset "true values" to check for consistency.

[0279] Test results: As shown in Table 13, the test results of the kit for all 16 simulated samples were completely consistent with the preset "true values". The corresponding pathogens were correctly detected in 10 positive samples, and the 6 negative samples were correctly identified as negative.

[0280] These results fully demonstrate that this kit has extremely high accuracy and specificity in practical applications and can be used for reliable screening of target highly pathogenic bacteria.

[0281] Table 13 Simulated Sample Test Results

[0282]

[0283] Table 14 Schematic diagram of negative controls

[0284]

[0285] Table 15. Positive results for 8 highly pathogenic bacteria.

[0286]

[0287] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer set, characterized in that, Includes one or more of primer sets 1 through 8; Primer set 1: The primer set used for amplifying Bacillus anthracis has the following characteristics: (1) Nucleotide sequences as shown in SEQ ID NO:1 and SEQ ID NO:2; or (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (1), and which has the same or similar function to the nucleotide sequence shown in (1); and / or Primer set 2: The primer set used for amplifying *Tulafrancsis* has the following characteristics: (3) Nucleotide sequences as shown in SEQ ID NO:5 and SEQ ID NO:6; or (4) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (3), and which has the same or similar function to the nucleotide sequence shown in (3); and / or Primer set 3: The primer set used for amplifying Yersinia pestis has the following characteristics: (5) Nucleotide sequences as shown in SEQ ID NO:9 and SEQ ID NO:10; or (6) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (5), and which has the same or similar function to the nucleotide sequence shown in (5); and / or Primer set 4: The primer set used for amplifying melioidosis has the following characteristics: (7) Nucleotide sequences as shown in SEQ ID NO:13 and SEQ ID NO:14; or (8) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (7), and which has the same or similar function to the nucleotide sequence shown in (7); and / or Primer set 5: The primer set used for amplifying Brucella has the following characteristics: (9) Nucleotide sequences as shown in SEQ ID NO:17 and SEQ ID NO:18; or (10) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (9), and which has the same or similar function to the nucleotide sequence shown in (9); and / or Primer set 6: The primer set used for amplifying Vibrio cholerae has the following characteristics: (11) Nucleotide sequences as shown in SEQ ID NO:21 and SEQ ID NO:22; or (12) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (11), and having the same or similar function to the nucleotide sequence shown in (11); and / or Primer set 7: The primer set used for amplifying Salmonella typhi has the following characteristics: (13) Nucleotide sequences as shown in SEQ ID NO:25 and SEQ ID NO:26; or (14) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (13), and having the same or similar function to the nucleotide sequence shown in (13); and / or Primer set 8: The primer set used for amplifying Staphylococcus aureus has the following characteristics: (15) Nucleotide sequences as shown in SEQ ID NO:29 and SEQ ID NO:30; or (16) A nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (15), and a nucleotide sequence that has the same or similar function to the nucleotide sequence shown in (15).

2. A probe assembly, characterized in that, Including one or more of probe groups 1 to 8; Probe set 1: The probes for detecting Bacillus anthracis have the following characteristics: (17) Nucleotide sequences as shown in SEQ ID NO:3 and SEQ ID NO:4; or (18) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (17), and having the same or similar function to the nucleotide sequence shown in (17); and / or Probe set 2: The probes for detecting *Tulafrancsis* have the following characteristics: (19) Nucleotide sequences as shown in SEQ ID NO:7 and SEQ ID NO:8; or (20) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (19), and which has the same or similar function to the nucleotide sequence shown in (19); and / or Probe set 3: Probes for detecting Yersinia pestis have the following characteristics: (21) Nucleotide sequences as shown in SEQ ID NO:11 and SEQ ID NO:12; or (22) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (21), and having the same or similar function to the nucleotide sequence shown in (21); and / or Probe set 4: Probes for detecting melioidosis have the following characteristics: (23) Nucleotide sequences as shown in SEQ ID NO:15 and SEQ ID NO:16; or (24) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (23), and having the same or similar function to the nucleotide sequence shown in (23); and / or Probe set 5: Probes for detecting Brucella have the following characteristics: (25) Nucleotide sequences as shown in SEQ ID NO:19 and SEQ ID NO:20; or (26) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (25), and having the same or similar function to the nucleotide sequence shown in (25); and / or Probe set 6: Probes for detecting Vibrio cholerae have the following characteristics: (27) Nucleotide sequences as shown in SEQ ID NO:23 and SEQ ID NO:24; or (28) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (27), and having the same or similar function to the nucleotide sequence shown in (27); and / or Probe set 7: Probes for detecting Salmonella typhi have the following characteristics: (29) Nucleotide sequences as shown in SEQ ID NO:27 and SEQ ID NO:28; or (30) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (29), and which has the same or similar function to the nucleotide sequence shown in (29); and / or Probe set 8: Probes for detecting Staphylococcus aureus have the following characteristics: (31) Nucleotide sequences as shown in SEQ ID NO:31 and SEQ ID NO:32; or (32) A nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (31), and which has the same or similar function as the nucleotide sequence shown in (31).

3. A primer-probe set, characterized in that, include: The primer set as described in claim 1 and the probe set as described in claim 2.

4. The primer-probe set as described in claim 3, characterized in that, Also includes: Internal standard primer set and internal standard probe set; The internal standard primer set has the following characteristics: (33) Nucleotide sequences as shown in SEQ ID NO:33 and SEQ ID NO:34; or (34) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (33), and having the same or similar function to the nucleotide sequence shown in (33); and / or The internal standard probe set has: (35) Nucleotide sequences as shown in SEQ ID NO:35 and SEQ ID NO:36; or (36) A nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (35), and which has the same or similar function as the nucleotide sequence shown in (35).

5. The use of the primer set as described in claim 1, the probe set as described in claim 2, and / or the primer-probe set as described in claim 3 or 4 in the preparation of detection products and / or devices for detecting highly pathogenic bacteria.

6. The product being tested, characterized in that, It includes the primer set as described in claim 1, the probe set as described in claim 2, and / or the primer-probe set as described in claim 3 or 4, as well as acceptable auxiliaries.

7. The testing product as described in claim 6, characterized in that, The final concentration of the primer set is 25 nM to 500 nM; the final concentration of the probe set is 65 nM to 800 nM.

8. The test product as described in claim 6 or 7, characterized in that, Also includes: One or more of DNA polymerase, a protective agent, and a sample lysis buffer.

9. The testing product as described in claim 8, characterized in that, The concentration of the DNA polymerase is 1 U / μL to 8 U / μL.

10. The test product as described in claim 8 or 9, characterized in that, The protective agent includes one or more of the following: trehalose, polyethylene glycol, Tween 20, bovine serum albumin, and PCR enhancer.

11. The test product as described in claim 10, characterized in that, The PCR enhancer includes: tetramethylammonium chloride.

12. The test product as described in any one of claims 8 to 11, characterized in that, The sample lysis buffer includes one or more of the following: TE buffer, formamide, Triton X-100, and bovine serum albumin.

13. A test kit, characterized in that, include: The primer set as claimed in claim 1, the probe set as claimed in claim 2, the primer-probe set as claimed in claim 3 or 4, and / or the detection product as claimed in any one of claims 6 to 12, as well as acceptable adjuvants and / or devices.

14. The method of using the detection product as described in any one of claims 6 to 12 and / or the detection kit as described in claim 13, characterized in that, The test product is mixed with the sample nucleic acid and subjected to PCR testing. The positive or negative result of the sample is determined based on the test results.

Images