Application of plant-derived miRNA in preparation of antitumor drugs

Abstract

The invention discloses an application of plant-derived miRNA in preparation of antitumor drugs, and belongs to the technical field of biological medicines and functional nucleic acid molecules. The miRNA is mul-miRNA-n16 from mulberry (Morus alba), and the nucleotide sequence of the miRNA is as shown in SEQ ID No: 1; in-vitro experiments prove that overexpression of mul-miRNA-n16 in a liver cancer cell line (such as HepG2) can significantly inhibit cell proliferation and reduce the cell growth rate; meanwhile, the migration and invasion ability of liver cancer cells can be remarkably inhibited, and it is prompted that the polypeptide possibly participates in regulation and control of diffusion and metastasis of tumors through a plurality of signal channels; in a HepG2 tumor-bearing mouse model, local delivery of the mul-miRNA-n16 simulant can also effectively inhibit tumor volume increase, and it is verified that the mul-miRNA-n16 has antitumor activity in vivo; the invention discloses the functional application of mul-miRNA-n16 and the mimic thereof in inhibiting the tumor process for the first time, and provides a new research thought and application basis for developing plant-derived anti-tumor molecules with a novel action mechanism, low toxic and side effects and high targeting property.

Description

TECHNICAL FIELD

[0001] The application relates to an application of a plant-derived miRNA in preparation of an anti-tumor drug and belongs to the technical field of biological medicine and functional nucleic acid molecules. BACKGROUND

[0002] Solid tumors refer to malignant tumors originating from solid organs or tissues, common types of which include liver cancer, breast cancer, lung cancer, pancreatic cancer, gastric cancer, prostate cancer, colorectal cancer, etc., and account for the vast majority of malignant tumors. Although certain progress has been made in surgery, radiotherapy, chemotherapy, targeted therapy and immunotherapy in recent years, the treatment of solid tumors still faces multiple challenges, such as high tumor heterogeneity, strong drug resistance, significant individual differences and high recurrence rate, especially in patients at middle and late stages, and the overall effective rate and long-term survival rate of existing treatment methods are still unsatisfactory. Therefore, developing novel anti-tumor strategies with novel mechanisms, low toxicity and strong targeting is still an important direction of tumor drug research and development.

[0003] In recent years, plant-derived microRNAs (miRNAs) have attracted widespread attention in the field of tumor treatment due to their stable structure, natural modification and low immunogenicity. Studies have shown that some plant miRNAs can be taken orally or delivered into the mammalian body in vivo, stably exist and participate in the regulation of post-transcriptional expression of cancer cells, thereby affecting multiple key processes such as cancer cell proliferation, migration and apoptosis, and exhibiting potential anti-tumor activity. Literature has reported that plant miRNAs play a biological effect in various solid tumor models such as lung cancer, colorectal cancer and pancreatic cancer, providing a theoretical basis for their application in tumor treatment.

[0004] Mul-miRNA-n16 is a novel plant miRNA molecule derived from mulberry (Morus atropurpurea Roxb.), and its nucleotide sequence has been disclosed. However, there is no literature reporting its function or mechanism in tumor treatment. Therefore, exploring and verifying the anti-proliferation, anti-migration and anti-invasion activity of mul-miRNA-n16 in various tumor cells is expected to fill the research gap in the field of solid tumor treatment. SUMMARY

[0005] In view of some deficiencies in the prior art, such as the lack of natural, safe and novel mechanism miRNA anti-tumor intervention means, the purpose of the present application is to provide an application of a plant-derived miRNA in preparation of an anti-tumor drug. Specifically, the plant-derived miRNA includes mul-miRNA-n16, a precursor of mul-miRNA-n16 and a mimic of mul-miRNA-n16.

[0006] To achieve the above technical purposes, the present application adopts the following technical solutions:

[0007] The present application first provides a miRNA derived from a plant, the miRNA is mul-miRNA-n16, the nucleotide sequence of the mul-miRNA-n16 is shown as SEQ ID No: 1, and the plant is mulberry.

[0008] The present application also provides a precursor or a mimic of the miRNA, the nucleotide sequence of the precursor of the mul-miRNA-n16 is shown as SEQ ID No: 2, and the mimic comprises a sense strand and an antisense strand, the nucleotide sequence of the sense strand is shown as SEQ ID No: 3, and the nucleotide sequence of the antisense strand is shown as SEQ ID No: 4.

[0009] The mimic is a mimic of the modified or unmodified mul-miRNA-n16, and the modification comprises one or more of methylation modification, cholesterol modification, phosphoric skeleton thio modification, peptide nucleic acid modification or locked nucleic acid modification.

[0010] Further, the methylation modification comprises modification by using 2'-O-methyl.

[0011] The present application also provides application of the miRNA or the precursor and the mimic of the miRNA in preparation of a medicine for preventing or treating tumors.

[0012] The tumor is a solid tumor, including liver cancer, breast cancer, lung cancer, colorectal cancer or pancreatic cancer.

[0013] The present application also provides a medicine for preventing or treating tumors, and the medicine comprises the miRNA or the precursor or the mimic of the miRNA.

[0014] The tumor is a solid tumor, including liver cancer, breast cancer, lung cancer, colorectal cancer or pancreatic cancer.

[0015] The medicine comprises an injection or an oral preparation.

[0016] In the experimental aspect, the present application verifies the feasibility and effectiveness of the technical solutions by the following ways:

[0017] In human hepatoma cell line HepG2 and mouse breast cancer cell line 4T1, overexpression of mul-miRNA-n16 can significantly inhibit cell proliferation, reduce cell activity and growth rate; the scratch test shows that mul-miRNA-n16 can effectively inhibit the migration and invasion ability of liver cancer cells and various breast cancer cells; Transwell invasion experiment shows that mul-miRNA-n16 can significantly inhibit the invasion ability of HepG2 cells, and interfere with its membrane penetration ability and matrix degradation behavior; the colony formation experiment shows that mul-miRNA-n16 can effectively reduce the number of tumor cell colony formation, reflecting its inhibition of cell self-renewal potential; in the HepG2 tumor-bearing mouse model, local injection of mul-miRNA-n16 mimics can significantly inhibit tumor volume growth, showing good in vivo anti-tumor activity; qPCR detection results show that mul-miRNA-n16 can be effectively transfected and expressed in cells and mice, and has good system delivery ability and stability.

[0018] The mul-miRNA-n16 mimics are verified by cell experiments to have bioequivalence with the original.

[0019] The application also provides a method for applying miRNA and its precursors and mimics, which comprises administering an effective dose of mul-miRNA-n16 or its precursors or modified form of mimics to a subject in need, to inhibit the proliferation, migration and invasion of tumor cells, and thus achieve the purpose of delaying or blocking tumor development. The method can deliver mul-miRNA-n16 or its precursors or modified form of mimics to tumor tissue by local injection, systemic delivery, nano delivery system, etc. The dosage and frequency of administration can be optimized according to the type of tumor, disease progression and individual differences.

[0020] In summary, the application provides a new application scheme of natural, safe, modifiable and functionally clear plant-derived miRNA molecules in the treatment of solid tumors, which is suitable for the intervention of liver cancer, breast cancer and other solid tumors, and has good industrial development potential.

[0021] Compared with the prior art, the application has the following remarkable beneficial effects:

[0022] Natural miRNA of plant origin usually has 2'-O-methylation modification at its 3' end, which is catalyzed by HEN1 methyltransferase and has the functions of enhancing stability and preventing degradation. The mul-miRNA-n16 described in the application is also an miRNA molecule with this natural modification, which is obtained by artificial synthesis in implementation, and the modification site is consistent with the natural state, ensuring functional equivalence.

[0023] (1) The present application first proposes that the miRNA molecule mul-miRNA-n16 derived from the plant mulberry (Morus alba) has significant anti-cancer activity in human tumor cells. Through in vitro experiments, it is verified that after overexpression of mul-miRNA-n16 in human hepatoma cell line (HepG2) and breast cancer cells (4T1 and MCF-7), the cell proliferation can be significantly inhibited, and the cell growth rate can be reduced; at the same time, mul-miRNA-n16 treatment can significantly inhibit the migration and invasion ability of tumor cells, suggesting that it may regulate multiple tumor-related signaling pathways and interfere with the diffusion and metastasis process of tumor. In the HepG2 tumor-bearing mouse model, local delivery of mul-miRNA-n16 can effectively inhibit the growth of tumor volume, proving that it also has anti-tumor activity in vivo.

[0024] (2) The mul-miRNA-n16 molecule described in the present application is derived from an edible plant, has a small structure, a clear sequence, good biocompatibility and low immunogenicity, and is suitable for development as an injection or oral nucleic acid drug. mul-miRNA-n16 can be produced by chemical synthesis or in vitro transcription, and is easy to perform maturation modification strategies including methylation, cholesterol modification, LNA (locked nucleic acid) modification, etc., and has good stability and delivery potential. At the same time, mul-miRNA-n16 shows significant anti-proliferative activity in liver cancer cells (such as HepG2) and breast cancer cells (such as 4T1), indicating that it has the potential for broad-spectrum indications across tumor types.

[0025] (3) The present application verifies the in vivo efficacy of mul-miRNA-n16 in solid tumor treatment in animal experiments. In the HepG2 tumor-bearing mouse model, mul-miRNA-n16 mimic treatment can effectively slow down the growth of tumor volume, which is significantly better than the control group. Considering that current solid tumor treatment often faces problems such as large toxic side effects and strong drug resistance, mul-miRNA-n16 as a natural small molecule RNA drug has good safety and targeting, showing application prospects in liver cancer, breast cancer and other tumor types. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 Figure 2 is the change result of the proliferation ability of liver cancer cells HepG2 in Example 2 (CCK-8 detection) (statistical test was performed on the data results, ns indicates no significant difference, and ** indicates extremely significant difference and P<0.01).

[0027] Figure 2 Figure 3 is the change result of the proliferation ability of breast cancer cells 4T1 in Example 2 (CCK-8 detection) (statistical test was performed on the data results, ns indicates no significant difference, and *** indicates extremely significant difference and P<0.001).

[0028] Figure 3 The results of the migration ability change of liver cancer cells HepG2 in Example 3 (wound healing assay) are shown, including microscopic photographs (top) and statistical results of the relative migration area of cells (bottom) (statistical test was performed on the data results, ns indicates no significant difference, and ** indicates extremely significant difference and P<0.01).

[0029] Figure 4 The results of the migration ability change of breast cancer cells 4T1 in Example 3 (wound healing assay) are shown, including microscopic photographs (top) and statistical results of the relative migration area of cells (bottom) (statistical test was performed on the data results, ns indicates no significant difference, * indicates significant difference and P<0.05, ** indicates extremely significant difference and P<0.01, and *** indicates extremely significant difference and P<0.001).

[0030] Figure 5 The results of the migration ability change of breast cancer cells MCF-7 in Example 3 (wound healing assay) are shown, including microscopic photographs (top) and statistical results of the relative migration area of cells (bottom) (statistical test was performed on the data results, ns indicates no significant difference, * indicates significant difference and P<0.05, and ** indicates extremely significant difference and P<0.01).

[0031] Figure 6 The results of the invasion ability change of liver cancer cells HepG2 in Example 4 (Transwell assay) are shown, including photographs (left) and statistical results of the number of invasive cells (right) (statistical test was performed on the data results, ns indicates no significant difference, and ** indicates extremely significant difference and P<0.01).

[0032] Figure 7 The results of the clone formation ability change of liver cancer cells HepG2 in Example 5 are shown, including photographs (left) and statistical results of the number of clone cells (right) (statistical test was performed on the data results, ns indicates no significant difference, and * indicates significant difference and P<0.05).

[0033] Figure 8 The results of the change in tumor volume in HepG2 cell tumor-bearing mice after 17 days of administration in Example 6 (statistical test was performed on the data results, and ** indicates extremely significant difference and P<0.01).

[0034] Figure 9Changes of miRNA expression levels in HepG2 cells after transfection of mul-miRNA-n16 in Example 7 (left), and changes of miRNA expression levels in mice after administration of mul-miRNA-n16 (right) (statistical test was performed on the data results, ns indicates no significant difference, * indicates significant difference and P<0.05, ** indicates extremely significant difference and P<0.01).

[0035] Figure 10 Changes of proliferation ability of liver cancer cells HepG2 after transfection of mul-miRNA-n16 mimics in Example 8 (left), and changes of migration ability of liver cancer cells HepG2 after transfection of mul-miRNA-n16 mimics (right) (statistical test was performed on the data results, ns indicates no significant difference, ** indicates extremely significant difference and P<0.01, *** indicates extremely significant difference and P<0.001). DETAILED DESCRIPTION

[0036] In order to enable those skilled in the art to better understand and implement the technical solutions of the present application, the present application will be described in detail below in combination with specific examples. It should be understood that these examples are only used to illustrate the present application, and are not intended to limit the scope of protection of the present application. The scope of protection of the present application should be defined by the content defined in the claims.

[0037] Methods not specifically described in the examples are conventional operations well known to those skilled in the art. For example: transfection of miRNA molecules, qPCR detection, CCK-8 cell proliferation experiment, cell scratch migration experiment, Transwell invasion experiment, establishment of mouse tumor-bearing model and tumor volume measurement, etc. can be completed according to the published experimental procedures (such as Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989) or commercial kit instructions.

[0038] Unless otherwise specified, the percentage, composition ratio, etc. in the specification are calculated by weight. Unless otherwise defined, all professional and scientific terms used in the specification should be understood as having the meaning recognized by those skilled in the art. Any method and material that is substantially the same as or has the same functional effect as the technical solutions described in the present application should be considered to fall within the scope of protection of the present application.

[0039] The mul-miRNA-n16 and its mimics used in the examples are artificially synthesized and have a clear nucleotide sequence. Their modified forms (such as 2'-O-methylation, cholesterol modification, locked nucleic acid (LNA) modification, etc.) conform to the conventional nucleic acid drug design strategy, and have good in vivo stability, biocompatibility and delivery efficiency.

[0040] In addition, unless otherwise specified, the cell lines mentioned in the present application (including but not limited to HepG2, 4T1, MCF-7, etc.) are purchased from a regular certified cell bank, and the reagents, consumables and instruments used in the related experiments are standard commercial products, and the experimental steps are performed according to the product instructions or mainstream literature specifications.

[0041] All experimental data involved in the embodiments of the present application have good repeatability and consistency. Some data results have obtained stable conclusions through repeated experiments, and the authenticity and scientificity can be supported and verified by the original experimental records.

[0042] Therefore, the technical effects described in the present application have been fully verified by standard experimental methods, and have good repeatability and implementability.

[0043] The miRNA transfection described in the embodiments is a conventional means, and the transfection reagent used is Lipofectamine 3000.

[0044] The source of miRNA and literature support are as follows:

[0045] The mul-miRNA-n16 described in the present application is derived from the miRNA deep sequencing data of the plant mulberry (Morus atropurpurea Roxb.). The miRNA was first reported as one of the plant endogenous miRNAs in the following literature: “MicroRNA Profiling During Mulberry (Morus atropurpurea Roxb) Fruit Development and Regulatory Pathway of miR477 for Anthocyanin Accumulation” ([J]. Frontiers in Plant Science, 2021.).

[0046] In the present application, mul-miRNA-n16 is first artificially synthesized and introduced into mammalian cells and animal model systems. The series of in vitro and in vivo experimental results verify the significant biological functions of the miRNA in regulating cancer cell proliferation, migration and invasion, etc., and first reveal its anti-tumor activity in the context of cross-species, expand the application boundary of plant miRNA in the medical field, and have important scientific research and industrialization value.

[0047] The “U” included in the sequence information of the miRNA in the present application is represented by “T” in the readable form of the sequence list.

[0048] The miRNA described in the present application can include the following different molecular forms:

[0049] 1. Mature body (entity): Artificially synthesized single-stranded miRNA with the sequence identical to SEQ ID No: 1, with 3' end 2'-O-methylation modification, simulating the natural structure of plant miRNA. The entity form is used in the cell experiments of the present application, with good transfection efficiency and biological activity.

[0050] 2. Mimics: Based on the entity, introduce full-chain 2'-O-methylation, multi-site cholesterol modification and other chemical structures, and construct double-stranded RNA to enhance its in vivo stability and tissue penetration ability. This form is used in animal experiments of the present application, and cell experiments have confirmed that it has biological equivalence with the entity.

[0051] 3. Pre-form (pre-miRNA): Since pre-miRNA can be processed into mature miRNA by Dicer in cells, it has the advantages of natural delivery and expression, and has the potential to be a candidate form of nucleic acid drugs. It should be noted that the pre-miRNA form itself does not directly exert an anti-tumor effect, but as a precursor structure of mature mul-miRNA-n16, it is processed into a functional mature chain by Dicer enzyme in cells. Since the mature chain of mul-miRNA-n16 has been verified by in vitro functional experiments in the present application for its anti-tumor effect, the pre-miRNA form can be considered as another form of expression and delivery, with the same functional basis, and is one of the common nucleic acid configuration choices in drug development. Existing studies have shown that the pre-miRNA expression system can efficiently generate mature miRNA in cells and exert its biological function (reference: Zeng & Cullen, RNA (2003), 9: 112-123.).

[0052] Example 1: Artificially synthesized mul-miRNA-n16 and its mimics

[0053] miRNA entity: The present application aims to develop an miRNA molecule with stable structure, long-lasting expression and anti-tumor activity for the treatment of various solid tumors including liver cancer and breast cancer.

[0054] The miRNA molecule provided by the present application is mul-miRNA-n16, with the nucleotide sequence of 5'-UUCCAAAUCCACCCAUGCCCAC-3' (SEQ ID No: 1), which can be in the form of mature chain or precursor, derived from mulberry tissue or artificially synthesized.

[0055] The mature chain nucleotide sequence of the mul-miRNA-n16 is:

[0056] 5'-UUCCAAAUCCACCCAUGCCCAC -3'

[0057] The nucleotide sequence of the mul-miRNA-n16 precursor (mul-miRNA-n16 precursor, or simply pre-miR-n16) is as follows:

[0058] 5'-AUAUAUAUAUAUAUAUAUAUAUAUGACUUGACUGAGAUGAAUAAGGGAA

[0059] AGAGAGAAGCCUGAGGAAAUUGUGGGCAUGGGUGGAUUUGGAAGGAGAACUAAAUUAAAACAUACAAUUAUAAUAUCAAUUAAGUGAACAAAA-3' (SEQ ID No: 2)

[0060] The pre-miRNA of the precursor sequence is derived from the region of chromosome 14 of Morus alba (GenBank: CP050237.2: 6828074-6828215), which can form a typical stem-loop structure in RNAfold analysis, can be recognized and processed into mature miRNA by Dicer enzyme in cells, has a typical stem-loop structure, and is suitable for the design of subsequent delivery and expression systems.

[0061] The sequence of the mul-miRNA-n16 mimic in the present application is as follows:

[0062] Guide strand: 5'-UUCCAAAUCCACCCAUGCCCAC-3' (consistent with the mature strand, SEQ ID No: 3);

[0063] Passenger strand: 5'-GUGGGCAUGGGUGGAUUUGGAA-3' (SEQ ID No: 4);

[0064] Note: According to the base complementarity principle, 2 oxidized modified nucleosides (such as dTdT) can be added at the 5' or 3' end to improve stability.

[0065] The mul-miRNA-n16 is further chemically modified to improve its stability in vivo and cellular uptake efficiency. The modification of the mimics includes, but is not limited to, 2'-O-methyl modification (2'-OMe), 3' end modification (including cholesteryl modification), phosphorothioate modification (PS), locked nucleic acid modification, or peptide nucleic acid modification. Among them, the 2'-O-methyl modification (2'-OMe) is a modification acting on the ribosyl position of the entire 22 nt sequence (i.e. 1-22), to enhance the anti-nuclease degradation ability of the nucleic acid molecule; the 3' end modification (including cholesteryl modification) is to connect a methoxy (OCH3) or a cholesteryl group at the 3' end of the 22nd position, to improve the membrane penetration and in vivo half-life; the phosphorothioate modification (PS) is located between the 1-2 and 18-21 positions of the phosphodiester bond, to enhance the stability of the nucleic acid by replacing oxygen with sulfur; and the locked nucleic acid modification or the peptide nucleic acid modification is to introduce a locked nucleic acid (LNA) or a peptide nucleic acid (PNA) unit at a partial base (such as 10-12) or an end position, to enhance the targeting binding efficiency.

[0066] Preferably, the mul-miRNA-n16 is modified by the following combination modification methods: 2'-O-methyl modification of the entire chain, phosphorothioate modification of the 1-2 and 18-21 positions, and 3' end cholesteryl modification.

[0067] The mul-miRNA-n16 used in the embodiments of the present application is a plant miRNA derived from mulberry (Morus alba) tissue, which can be obtained by artificial synthesis or in vitro transcription:

[0068] (1) Artificial synthesis method: according to the known mature chain sequence, a commercial synthesis company (such as GenePharma or a synthesis platform such as IDT) is commissioned to perform artificial chemical synthesis, with a purity of ≥98%, and HPLC purification is adopted.

[0069] (2) In vitro transcription method: an expression vector containing the mul-miRNA-n16 precursor sequence is constructed, and a T7 RNA polymerase is used for in vitro transcription reaction, followed by RNA gel electrophoresis analysis and column chromatography (such as DEAE column) purification.

[0070] The mul-miRNA-n16 used in the present application is obtained by artificial synthesis, and is used in the functional verification experiment.

[0071] Example 2: In vitro experiment of mul-miRNA-n16 inhibiting proliferation of various tumor cells

[0072] This embodiment verifies the antitumor activity of mul-miRNA-n16 in solid tumor cells, demonstrating its potential as an important active ingredient in antitumor drugs. The miRNA used in this experiment is mul-miRNA-n16, a synthetically produced single-stranded RNA with natural 2'-O-methylation modification, mimicking the modification state of plant-derived miRNAs.

[0073] Human hepatocellular carcinoma cells (HepG2) were purchased from the Shanghai Cell Bank (Cat# SCSP-510), and mouse breast cancer cells (4T1) were purchased from the Shanghai Cell Bank (Cat# TCM32). Cells were cultured under the following conditions before and during the experiments: DMEM high-glucose medium (containing 10% FBS), 5% CO2, incubator at 37°C.

[0074] Set up the following experimental groups:

[0075] Blank: Blank control group, cells were not treated.

[0076] mmNC group: negative control group, cells were transfected with negative miRNA, that is, the miRNA transfected in the cells was a commercially available universal negative control sequence (mmNC: 5'-UCACAACCUCCUAGAAAGAGUAGA-3' (SEQ ID No: 5)), which has been verified to have no biological activity, and methylation modification at the corresponding sites was performed to mimic endogenous plant miRNA.

[0077] mmn16 group: Experimental group, cells transfected with mul-miRNA-n16.

[0078] The transfection reagent Lipofectamine 3000 was thoroughly mixed with the corresponding miRNA and added dropwise to the cells to ensure a final miRNA concentration of 50 mM. Forty-eight hours after transfection with mul-miRNA-n16 or negative miRNA (concentration 50 nM), cell viability was assessed using a CCK-8 cell counting kit (Beyotime). Cells from each group were seeded in 96-well plates, and CCK-8 working solution was added to each well. After incubation for 1 hour, absorbance (OD450) was measured at 450 nm, and a cell viability bar chart was plotted.

[0079] The results are as follows Figure 1 (HepG2 cells) and Figure 2 As shown in (4T1 breast cancer cells), Figure 1 The results showed that in HepG2 cells, transfection with mul-miRNA-n16 significantly reduced cell proliferation, with OD450 values ​​significantly lower than the negative control group and the blank control group; the same treatment was applied to breast cancer 4T1 cells (…).Figure 2 A significant inhibitory effect on cell proliferation was also observed in the control group; there was no significant difference between the negative miRNA group (mmNC) and the blank group, indicating that the experimental results were specific. These results demonstrate that mul-miRNA-n16 has a significant inhibitory effect on the proliferation of tumor cells from multiple sources, showing its broad-spectrum anti-tumor potential and applicability to the interventional treatment of various solid tumors, laying the foundation for its development as an anti-tumor drug.

[0080] Example 3: In vitro experiment on the inhibition of migration ability of various tumor cells by mul-miRNA-n16

[0081] This embodiment verifies the inhibitory effect of mul-miRNA-n16 on cell migration in three types of tumor cells (HepG2, 4T1, and MCF-7) and further evaluates its anti-tumor metastasis potential.

[0082] The cell lines, sources, and culture conditions were the same as in Example 2, including HepG2 (human liver cancer cells), 4T1 (mouse breast cancer cells), and MCF-7 (human breast cancer cells, purchased from the Cell Bank of the Chinese Academy of Sciences, Cat# SCSP-531). The experimental grouping and transfection methods (transforming miRNA into cells using transfection reagents and continuing culture for 48 hours) were the same as in Example 2.

[0083] Scratch test was performed 48 hours after transfection:

[0084] (1) Seed cells into a 6-well plate. After the cells form a monolayer and fuse, use a sterile pipette tip to make a straight wound in the center of the cell layer.

[0085] (2) Remove suspended cells and add serum-free culture medium;

[0086] (3) Observe and photograph the wound width at 0 hours;

[0087] (4) Continue culturing for 24 hours and then photograph the cell migration again;

[0088] (5) Use ImageJ software to measure the change in scratch width and calculate the migration rate.

[0089] The results are as follows Figures 3-5 As shown, from Figure 3 Results of HepG2 cell scratch assay Figure 4 Results of 4T1 cell scratch assay and Figure 5 The results of the MCF-7 cell scratch assay showed that, compared with the Blank group and the mmNC group, the cell migration speed of the mmn16 group was significantly slower and the scratch closure rate was significantly reduced. This result indicates that mul-miRNA-n16 can effectively inhibit tumor cell migration in liver cancer and human and mouse breast cancer cells.

[0090] Example 4: In vitro experiment of mul-miRNA-n16 inhibiting tumor cell invasion ability

[0091] This example verifies the influence of mul-miRNA-n16 on the invasion ability of liver cancer cells HepG2 by Transwell experiment, and illustrates the potential of mul-miRNA-n16 in preventing tumor metastasis.

[0092] Cell strain: HepG2 (human liver cancer cells) (source and culture conditions are the same as in Example 2), grouping and transfection method are the same as in Example 2.

[0093] Transwell invasion experiment was performed 48 hours after transfection:

[0094] (1) Matrigel was laid on the Transwell membrane;

[0095] (2) The cell suspension after transfection (without serum) was added to the upper chamber;

[0096] (3) The lower chamber was complete culture medium containing 10% FBS;

[0097] (4) After 24 hours of incubation, the cells that passed through the membrane were fixed and stained with crystal violet;

[0098] (5) The number of cells that passed through the membrane was counted under a microscope.

[0099] The results are shown in Figure 6 Figure, it can be seen from the figure that the number of cells that passed through the membrane in the mmn16 group was significantly reduced compared with the Blank group and the mmNC group, indicating that mul-miRNA-n16 can effectively inhibit the invasion behavior of HepG2 cells.

[0100] Example 5: Experiment of mul-miRNA-n16 inhibiting the clonogenic ability of liver cancer cells

[0101] This example further verifies the influence of mul-miRNA-n16 on the self-renewal and proliferation potential of tumor cells.

[0102] Cell strain: HepG2 (human liver cancer cells) (source and culture conditions are the same as in Example 2), grouping and transfection method are the same as in Example 2.

[0103] After 48 hours of transfection, cells were seeded in 6-well plates at 500 cells per well, and cultured for 10-14 days until visible colony spots were observed:

[0104] (1) Fix the cells;

[0105] (2) Crystal violet staining;

[0106] (3) Take pictures and count the number or area of colonies.

[0107] Results are shown in Figure 2. As can be seen from the figure, the number of colonies in the mmn16 group was significantly reduced compared to the Blank group and the mmNC group, indicating that mul-miRNA-n16 can effectively inhibit the colony formation ability of tumor cells. Figure 7

[0108] Example 6: In vivo experiment of mul-miRNA-n16 inhibiting tumor growth

[0109] This example verifies the in vivo anti-tumor effect of mul-miRNA-n16 in a tumor-bearing mouse model, further illustrating its application potential as a nucleic acid drug in the treatment of solid tumors.

[0110] In the embodiments of the present application, the sequence of the mimic of mul-miRNA-n16 is 22 nt, and the following modification methods are used:

[0111] full chain 2'-O-methyl modification, introduction of phosphorothioate modification between the 1st-2nd and 18th-21st positions, and connection of a cholesterol group at the 3' end of the 22nd position; the above combination of modifications significantly improves the stability of the mimic in a cell environment and the ability to transport across the membrane.

[0112] The experimental animals were male BALB / c nude mice (6-8 weeks old, 18-20 g), purchased from Changzhou Cavens Experimental Animal Co., Ltd. (License No. SCXK (Su) 2021-0013). The mice were adaptively fed for 7 days before the experiment, the environmental temperature was 22±2℃, the light-dark cycle was 12 hours, and the mice were allowed to drink and eat freely. A HepG2 tumor-bearing nude mouse model was established (1×10 7 HepG2 cells were subcutaneously inoculated in each mouse), and the source and culture conditions of the HepG2 cells were the same as in Example 2).

[0113] The experimental groups were as follows:

[0114] Blank group: injection of blank solvent normal saline (control).

[0115] mmn16 group: intratumoral injection of mul-miRNA-n16 mimic (the dose of the mul-miRNA-n16 mimic was 2 nmol per mouse, and the drug was administered every 2 days).

[0116] The drug was administered continuously for 17 days, and the tumor volume was measured every 2 days using a vernier caliper.

[0117] Results are shown in Figure 2. As can be seen from the figure, the number of colonies in the mmn16 group was significantly reduced compared to the Blank group and the mmNC group, indicating that mul-miRNA-n16 can effectively inhibit the colony formation ability of tumor cells. Figure 8

[0118] ​​The present embodiment also provides a medicine for treating tumors, which comprises an effective dose of mul-miRNA-n16, a precursor thereof, or a mimic or modified form of the mimic, and can inhibit the proliferation, migration and invasion of tumor cells, thereby inhibiting the growth of tumors.

[0119] The medicine can deliver the miRNA to the tumor tissue by conventional methods in the art, including but not limited to local injection, systemic administration (such as intravenous injection), and nanoparticle-based delivery systems.

[0120] In a preferred embodiment, in a mouse subcutaneous solid tumor model, the present embodiment uses tail vein injection for administration at a dose of 2 nmol per mouse (about 0.75 mg / kg body weight), 2 times per week, for 3 consecutive weeks, and a significant reduction in tumor volume is observed. The dose and frequency of administration can be optimized according to the type of tumor (such as breast cancer, colorectal cancer, lung cancer, etc.), the stage of disease progression (early, advanced, recurrent), and individual differences (such as body weight, tolerance). The recommended dose range is generally 0.5-2 mg / kg, the administration frequency is 1-3 times per week, and the treatment course is set to 2-4 weeks according to the response.

[0121] The above animal experiment results support the feasibility and prospects of mul-miRNA-n16 as a nucleic acid drug for the treatment of solid tumors.

[0122] Example 7: Detection of changes in miRNA expression levels (in cells and mice)

[0123] The present embodiment detects changes in miRNA expression levels by RT-qPCR to verify the delivery efficiency and stability of mul-miRNA-n16.

[0124] The source and culture conditions of HepG2 (human hepatoma cells) are the same as in Example 2, and the experimental animals are male BALB / c nude mice (6-8 weeks old, 18-20 g), which are obtained and raised under the same conditions as in Example 6.

[0125] mul-miRNA-n16 was transfected into HepG2 cells (50 nM) (see Example 2), total RNA was extracted on days 3, 6 and 9, and qPCR was performed using miRNA-specific primers (miRNA Real-Time PCR Primer Kit, purchased from BioMed Valley, Inc., Catalog No. BK1010), with U6 (purchased from BioMed Valley, Inc.) as the internal control. The mmn16 group of mice in Example 6 was administered for 5 consecutive times, and after the administration was completed, the mice were continuously raised until day 17 for tail bleeding, total RNA was extracted, and qPCR was performed using miRNA-specific primers, with U6 as the internal control.

[0126] The nucleotide sequence of internal reference U6 is as follows:

[0127] U6-upper-primer: 5'-TGGAACGCTTCACGATTTTGC-3' (SEQ ID No: 6)

[0128] U6-lower-primer: 5'-AGAAGATTAGCATGGCCCCTG-3' (SEQ ID No: 7)

[0129] The results are as follows Figure 9 As shown, after transfection or injection, mul-miRNA-n16 in cells ( Figure 9 (Left) and in mice ( Figure 9 Both (right) showed significant upregulation of expression, indicating that it can be effectively delivered to target cells and remain stable in vivo. mul-miRNA-n16 showed stable expression at the cellular level, with high expression abundance remaining 9 days after transfection; high expression levels were still detectable in animal peripheral blood on day 17 after the end of administration, indicating good biological stability.

[0130] Example 8: miRNA morphology description and bioequivalence verification

[0131] The mul-miRNA-n16 used in the cell experiments described in Examples 1-5 of this invention is a synthetic single-stranded miRNA whose sequence is consistent with that of natural plant sources and has 3' end 2'-O-methylation modification.

[0132] The animal experiments (Examples 6-7) used the mul-miRNA-n16 mimic, which is a double-stranded structure with full-chain 2'-O-methyl modification, thiomodification of the phosphate backbone at positions 1–2 and 18–21, and cholesterol modification at the 3' end, to enhance stability and in vivo bioavailability.

[0133] To confirm the functional consistency between the mul-miRNA-n16 prototype and its mimic, this invention conducted parallel functional validation experiments at the cellular level. Specifically, following the methods described in Examples 2 and 3, the mimic of mul-miRNA-n16 was transfected into HepG2 liver cancer cells, and its effect on cell proliferation was evaluated. Figure 10 (left) and transferability ( Figure 10 The influence of (right); among which Figure 10 The orange bar in the right center represents the blank control group, the yellow bar represents the negative control group (mmNC), and the green bar represents the mimic treatment group. The experimental results show that the trends in proliferation and migration ability of HepG2 cells after transfection with the mimic are similar to those after transfection with mul-miRNA-n16 (see [link to results]).Figure 1 and Figure 3 ) were highly consistent, all showed the effect of inhibiting cell proliferation and migration, and had statistical significance (p<0.05). The results showed that the mimic of mul-miRNA-n16 was bioequivalent to the original in vitro function, and had the feasibility to replace the original for subsequent in vivo delivery and application, supporting it as one of the candidate components of therapeutic nucleic acid drugs.

[0134] It should be noted that the mul-miRNA-n16 mimic described in the application introduces full-chain 2'-O-methylation in structure, and introduces cholesterol modification at the 3' end and multiple sites in the middle, the purpose is to improve its stability and delivery efficiency in the in vivo environment. The mimic has the same trend as mul-miRNA-n16 in vitro function verification, which constitutes bioequivalence.

[0135] The application also expresses mul-miRNA-n16 in the form of pre-miRNA. The precursor sequence can be processed into mature mul-miRNA-n16 in cells by Dicer. It is known that this processing pathway can occur naturally in mammalian cells, so its functional effect can be attributed to the action of mature miRNA.

[0136] For other modification methods mentioned in the specification, such as LNA, PNA, etc., they are common modification methods in the art and can also achieve the technical effects claimed in the present application.

[0137] All experiments were repeated three times with consistent results, and the technical solution had good implementability and industrial application prospect.

[0138] In summary, different molecular forms of mul-miRNA-n16 can be flexibly selected according to the application scene. The mature body and the mimic have been verified by experiments in the application that the anti-tumor effect is significant, and the precursor form of miRNA-n16 is also within the protection scope of the application as an extended embodiment.

Claims

1. A plant-derived miRNA, characterized in that, The miRNA is mul-miRNA-n16, and a nucleotide sequence of the mul-miRNA-n16 is shown as SEQ ID No:

1.

2. Precursor or mimic of the miRNA according to claim 1, characterized in that, A nucleotide sequence of the precursor of the mul-miRNA-n16 is shown as SEQ ID No: 2; the mimic comprises a sense strand and an antisense strand, a nucleotide sequence of the sense strand is shown as SEQ ID No: 3, and a nucleotide sequence of the antisense strand is shown as SEQ ID No:

4.

3. The precursor or mimetibody of claim 2, wherein, The mimic is a mimic of the modified or unmodified mul-miRNA-n16, and the modification comprises one or more of methylation modification, cholesterol modification, phosphor backbone sulphur modification, peptide nucleic acid modification or locked nucleic acid modification.

4. The precursor or mimetibody of claim 3, wherein, The methylation modification comprises modification using 2'-O-methyl.

5. Use of the miRNA of claim 1, or the precursor or mimic of the miRNA of any one of claims 2-4 in the preparation of a medicament for preventing or treating a tumor.

6. Use according to claim 5, characterized in that, The tumor comprises liver cancer, breast cancer, lung cancer, colorectal cancer or pancreatic cancer.

7. A medicament for preventing or treating a tumor, characterized by, The medicament comprises the miRNA of claim 1, or the precursor or mimic of the miRNA of any one of claims 2-4.

8. The medicament according to claim 7, characterized in that, The tumor is a solid tumor.

9. The medicament according to claim 8, characterized in that, The solid tumor comprises liver cancer, breast cancer, lung cancer, colorectal cancer or pancreatic cancer.

10. The medicament according to any one of claims 7 to 9, characterized in that, The medicament comprises an injection, an oral preparation.

Images