Molecular markers associated with daily gain traits in finishing period of large white pigs and their application

By detecting SNP sites on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, the problem of precision breeding of daily weight gain during the fattening period of Large White pigs was solved, achieving efficient and economical breeding selection, and significantly improving breeding efficiency and the improvement of daily weight gain during the fattening period.

CN121344215BActive Publication Date: 2026-07-07INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511792426.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-01
Publication Date
2026-07-07
Estimated Expiration
2045-12-01

AI Technical Summary

Technical Problem

Existing technologies are insufficient to meet the precise and efficient breeding needs for daily weight gain traits during the fattening period of Large White pigs. Traditional testing methods are costly, time-consuming, and difficult to operate.

Method used

The SNP locus (A/G) located at position 270461314 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1 was provided. Specific primers were designed for PCR amplification to detect the genotype of the pigs to be tested, and breeding parents were selected based on the genotype.

Benefits of technology

Genotyping of this SNP locus can significantly improve breeding efficiency, shorten the breeding cycle, select superior pig breeds, and enhance the genetic improvement of daily weight gain during the fattening period.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344215B_ABST
    Figure CN121344215B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker related to daily weight gain of large white pigs in a fattening period and application thereof, relates to the technical field of biology, and corresponds to a SNP site at position 270461314 on a chromosome 1 in a pig reference genome Sus_scrofa.Sscrofa11.1, the site corresponding to a nucleotide at position 87 in a sequence of SEQ ID NO:1, and the nucleotide type being A or G. The molecular marker related to daily weight gain of large white pigs in a fattening period and application thereof discover that the A / G site at position 270461314 on a chromosome 1 in a pig reference genome Sus_scrofa.Sscrofa11.1 has a significant influence on daily weight gain of large white pigs in a fattening period; a method for identifying or assisting in identifying daily weight gain of large white pigs in a fattening period is provided based on the SNP site; and a new molecular breeding marker is provided for marker-assisted breeding of daily weight gain of large white pigs in a fattening period.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to molecular markers related to daily weight gain traits during the fattening period of Large White pigs and their applications. Background Technology

[0002] Commercial pig farming involves key stages such as lactation, nursery, and fattening. Among these, daily weight gain during the fattening period is a core indicator for measuring pig growth performance, directly determining the production efficiency and economic benefits of the pig farming industry. As a maternal breed in the internationally recognized three-way crossbreeding system, the genetic improvement of daily weight gain during the fattening period for Large White pigs is of great significance to the development of the pig farming industry.

[0003] Currently, traditional methods for measuring daily weight gain during the fattening period require specialized weighing equipment and take 70-90 days, resulting in high breeding costs, long cycles, and operational difficulties. With the development of molecular biotechnology, techniques such as genome-wide association studies (GWAS) have provided effective means to discover molecular markers related to daily weight gain, enabling more precise and efficient breeding selection. Existing studies include Huang et al.'s GWAS analysis of body weight and daily weight gain in Dongliao Black pigs, identifying relevant polymorphic markers on chromosomes 4, 11, and 17; and Xiang et al.'s optimization of the weighting factors for genomic selection in Danish Landrace and Large White pigs. However, because daily weight gain is a quantitative trait controlled by multiple genes and exhibits significant population specificity, existing molecular markers are insufficient to meet the practical needs of improving daily weight gain during the fattening period of Large White pigs. Therefore, it is necessary to develop new specific molecular markers. Summary of the Invention

[0004] The purpose of this invention is to provide molecular markers related to the daily weight gain trait during the fattening period of Large White pigs and their applications, so as to solve the problems mentioned in the background art.

[0005] To achieve the above objectives, the present invention provides the following technical solution: a molecular marker associated with the daily weight gain trait during the fattening period of Large White pigs, wherein the molecular marker corresponds to the SNP site at position 270461314 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, and the nucleotide at position 87 bp in the sequence SEQ ID NO:1 is of type A or G.

[0006] Further methods for identifying or assisting in the identification of daily weight gain during the fattening period of Large White pigs include the following steps:

[0007] S1) Extract genomic DNA from the pig to be tested as a template;

[0008] S2) Design specific primers for the 87bp site of the DNA molecule shown in SEQ ID NO:1 and perform PCR amplification;

[0009] S3) Detect the genotype at the 87bp site of the pig sequence SEQ ID NO:1 to be tested;

[0010] S4) Based on the genotype identification or auxiliary identification obtained in step S3, the daily weight gain of the Large White pigs to be tested during the fattening period is as follows: the daily weight gain of individuals with the AA genotype is greater than that of individuals with the AG genotype, and the daily weight gain of individuals with the AG genotype is greater than that of individuals with the GG genotype.

[0011] Furthermore, the sequences of the specific primers in step S2 are SEQ ID NO:2 and SEQ ID NO:3, wherein SEQ ID NO:2 is 5'-TGTTCTCCAGCCTGGTCCA-3' and SEQ ID NO:3 is 5'-GGTCCTTCCTTCTGCCTTGA-3'.

[0012] Furthermore, the genotype of the Large White pig to be tested is identified according to the method described in claim 2 or 3, and the pig to be tested with a homozygous A genotype at 87bp of SEQ ID NO:1 is selected as the parent for breeding.

[0013] Furthermore, the application of molecular markers related to the daily weight gain trait during the fattening period of the Large White pigs, wherein the application is any one of the following A1 to A4:

[0014] A1. To detect or assist in detecting the daily weight gain of Large White pigs during the fattening period;

[0015] A2. Identification and auxiliary identification of daily weight gain during the fattening period of Large White pigs;

[0016] A3. To prepare products for detecting or assisting in the detection of daily weight gain during the fattening period of Large White pigs;

[0017] A4. Products for the preparation, identification, and auxiliary identification of daily weight gain during the fattening period of Large White pigs.

[0018] Furthermore, the product is a reagent kit.

[0019] This invention provides molecular markers related to the daily weight gain trait during the fattening period of Large White pigs and their applications, with the following beneficial effects: This invention discovers the A / G locus at position 270461314 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, which has a significant impact on the daily weight gain during the fattening period of Large White pigs; based on this SNP locus, a method for identifying or assisting in the identification of daily weight gain during the fattening period of Large White pigs is provided; a new molecular breeding marker is provided for marker-assisted breeding of the daily weight gain trait during the fattening period of Large White pigs, which is beneficial to improving breeding efficiency, effectively shortening the breeding cycle, and is of great significance for selecting superior pig breeds. Attached Figure Description

[0020] Figure 1 This is the Manhattan plot of the genome-wide association analysis in Embodiment 1 of the present invention.

[0021] Figure 2 This is a QQ diagram representing the data structure of the genome-wide association analysis in Embodiment 1 of the present invention. Detailed Implementation

[0022] The embodiments of the present invention will be described in further detail below with reference to examples. These examples are for illustrative purposes only and should not be construed as limiting the scope of the invention.

[0023] This application provides molecular markers related to daily weight gain traits during the fattening period of Large White pigs and their applications. The invention is further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the invention and not for limiting its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0024] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0025] The following examples used SAS 9.0 statistical software to process the data. Experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 was observed. This indicates a significant difference.

[0026] All animals in the following examples were sourced from Henan Yifa Animal Husbandry Co., Ltd.

[0027] The daily weight gain of the Large White pigs in the following examples refers to the daily weight gain during the fattening period within the fattening stage.

[0028] Example 1: Determination of SNP sites on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1

[0029] The inventors previously conducted whole-genome sequencing on 560 pigs and a genome-wide association study (GWAS) of the daily weight gain trait during the fattening period. The model used was: Y = μ + G + B + P + e, where Y is the trait value; μ is the population mean; G is the genotype effect; B is the batch effect; and P is the farm-year-season effect. The results identified 20 SNP loci significantly associated with daily weight gain during the fattening period, such as... Figure 1 and Figure 2 As shown, the inventors designed primers for amplification within a 150bp range upstream and downstream of the five most prominent sites, and found that only the sequence containing one site on stain 1 could be amplified well.

[0030] After amplification, alignment was performed using Seqman software, revealing a differentially expressed site (SNP) named A270461314G. This site is located at nucleotide 270461314 on chromosome 1 of the pig reference genome Sus_scrofa.Sscrofa11.1, which is nucleotide 87 of sequence SEQ ID NO:1. The nucleotide type of A270461314G is either A or G, and the genotype is AA, GG, or AG. The AA genotype with the nucleotide at A270461314G is homozygous for A. The GG genotype with the nucleotide at A270461314G is homozygous for G. The AG genotype with the nucleotide at A270461314G is heterozygous for both A and G.

[0031] Example 2: Correlation analysis of the A270461314G locus on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1 with the daily weight gain of Large White pigs during the fattening period;

[0032] To determine whether the A270461314G locus on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1 is related to the daily weight gain during the fattening period of Large White pigs, 1024 Large White pigs were used as experimental materials. The genotype of the SNP locus in Example 1 and the daily weight gain during the fattening period of each individual were measured, and correlation analysis was performed.

[0033] I. Genotype Identification

[0034] 1. PCR amplification

[0035] Based on the SNP information on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.1, a pair of primers was designed as follows:

[0036] Upstream primer F: 5'-TGTTCTCCAGCCTGGTCCA-3' (SEQ ID NO:2);

[0037] Downstream primer R: 5'- GGTCCTTCCTTCTGCCTTGA-3' (SEQ ID NO:3).

[0038] Using the genomic DNA of each Large White pig as a template, PCR amplification was performed using the above-mentioned materials to obtain PCR products.

[0039] 2. Cloning, sequencing, and sequence analysis

[0040] The PCR products of each individual were purified using an agarose gel extraction kit (Tiangen Biotech Co., Ltd.). The recovered DNA fragments were ligated into the pGEM-T vector (Promega), and the ligation product was transformed into E. coli DH5α competent cells (Mingri Biotech (Beijing) Co., Ltd.). Positive clones were screened based on the carbenicillin resistance marker on the vector to obtain recombinant plasmids containing the recovered fragments. The nucleotide sequence of this recombinant plasmid vector was determined using the T7 and SP6 promoter sequences as primers (Invitrogen (Shanghai) Trading Co., Ltd.).

[0041] The genotypes of the pigs to be tested are as follows:

[0042] AA genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R contains only a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 87th nucleotide of SEQ ID NO:1 being G, and does not contain a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 87th nucleotide of SEQ ID NO:1 being A, then the genotype of chromosome 1 at position A270461314G in the aforementioned pig reference genome Sus_scrofa.Sscrofa11.1 of the pig to be tested is AA.

[0043] GG genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R does not contain a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 87th nucleotide of SEQ ID NO:1 being G, and only contains a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 87th nucleotide of SEQ ID NO:1 being A, then the genotype of the A270461314G position on chromosome 1 of the aforementioned pig reference genome (Sus_scrofa.Sscrofa11.1) of the pig to be tested is GC.

[0044] AG genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R contains both a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 87th nucleotide of SEQ ID NO:1 being G, and a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 87th nucleotide of SEQ ID NO:1 being A, then the genotype of the A270461314G position on chromosome 1 of the aforementioned pig reference genome (Sus_scrofa.Sscrofa11.1) of the pig to be tested is AG.

[0045] The results are shown in Table 2. Genotyping of the A270461314G locus in 1024 Large White pigs showed that 189 pigs had the AA genotype, 496 had the GG genotype, and 339 had the AG genotype. The genotype and allele frequencies of the A270461314G locus in the tested pig population are shown in Table 1. Table 1 shows that this locus has a high heterozygosity and great potential for breeding.

[0046] Table 1. Genotype and allele frequencies of locus A270461314G in the tested pig population.

[0047]

[0048] II. Association Analysis between Pig Genotype and Daily Weight Gain during the Fattening Period of Large White Pigs

[0049] The daily weight gain during the fattening stage of Large White pigs was measured using the Osborn automated measurement device. SAS software was used for genotype-phenotype association analysis, and Duncan's multiple test was used for significance testing (P<0.05). Data are expressed as mean ± standard error, and P<0.05 was considered statistically significant.

[0050] The results are shown in Table 2. The SNP (A270461314G) locus had a significant impact on the daily weight gain during the finishing period of Large White pigs. Large White pigs with the AA genotype had a greater daily weight gain during the finishing period than those with the AG genotype, and those with the AG genotype had a greater daily weight gain than those with the GG genotype. Furthermore, the daily weight gain of Large White pigs with the AA genotype was significantly greater than that of those with the GG genotype (P<0.05). In practical pig breeding, the SNP (A270461314G) genotyping results can be used for auxiliary selection of daily weight gain during the finishing period.

[0051] Table 2. Association analysis of single nucleotide polymorphisms on chromosome 1 in the pig reference genome (Sus_scrofa.Sscrofa11.1) with daily weight gain during the fattening period.

[0052]

[0053] Note: Different lowercase letters in the table indicate significant differences (P<0.05), and the same letter indicates no significant differences (P>0.05). Values ​​are expressed as mean ± standard error.

[0054] In summary, determining the genotype of the A270461314G locus on chromosome 1 in the pig reference genome (Sus_scrofa.Sscrofa11.1) can help identify the daily weight gain during the finishing period of Large White pigs: Large White pigs with the AA genotype have a greater daily weight gain during the finishing period than those with the GG genotype, and Large White pigs with the AG genotype have a greater daily weight gain during the finishing period than those with the GG genotype. In practical breeding work, pigs with the AA genotype at the SNP (A270461314G) locus can be selected as parents for breeding.

[0055] SEQ ID NO:1

[0056] 5'- TGTTCTCCAGCCTGGTCCAGGCCAAGGCGGGATTCAGATGGGCCACTTGCAGGCAGATCTGAGTTGGGGAGAAGCTCAGAATTATGWGAGCTCAGAAGGGGTTCCAGGATCAGGTTTGGTGCTCAGAGAAGGCTTCCTGGTGGAGGTGATGTTCCACTGGGCACCCGAAGGATGAGCAGGAGTTGGCCAGGATGGATGGATGGGAGGACAAATGTTCAAGGCAGAAGGAAGGACC -3'.

[0057] The W is either A or G.

[0058] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

[0059] The embodiments of the present invention are given for illustrative and descriptive purposes only, and are not intended to be exhaustive or to limit the invention to the forms disclosed. Many modifications and variations will be apparent to those skilled in the art. The embodiments were chosen and described in order to better illustrate the principles and practical application of the invention, and to enable those skilled in the art to understand the invention and to design various embodiments with various modifications suitable for a particular purpose.

Claims

1. The application of molecular markers related to daily weight gain during the fattening period of Large White pigs, characterized in that, The molecular marker corresponds to the SNP site at position 270461314 on chromosome 1 in the pig reference genome Sus_scrofa.Sscrofa11.

1. This site corresponds to the nucleotide at position 87 bp in sequence SEQ ID NO:1, and the nucleotide type is A or G. Individuals with the AA genotype have a greater daily weight gain during the fattening period than individuals with the AG genotype, and individuals with the AG genotype have a greater daily weight gain during the fattening period than individuals with the GG genotype. The application is any one of A1 to A4 below: A1. To detect or assist in detecting the daily weight gain of Large White pigs during the fattening period; A2. Identification and auxiliary identification of daily weight gain during the fattening period of Large White pigs; A3. To prepare products for detecting or assisting in the detection of daily weight gain during the fattening period of Large White pigs; A4. Products for the preparation, identification, and auxiliary identification of daily weight gain during the fattening period of Large White pigs.

2. The application of molecular markers related to daily weight gain during the fattening period of Large White pigs as described in claim 1, characterized in that, The product in question is a reagent kit.

Citation Information

Patent Citations

  • Application of pig SNP molecular marker in pig daily gain characters study and / or pig breeding

    CN107177681A

  • SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 1 and related to daily gain and application of SNP molecular marker

    CN118480607A