SNP (Single Nucleotide Polymorphism) marker related to soybean mosaic virus resistance and application thereof
By developing an SNP marker at position 13049396 bp on chromosome 6 of the soybean genome, combined with Sanger sequencing and primer pair PCR amplification, the problem of low efficiency in traditional breeding methods was solved, enabling rapid identification of soybean mosaic virus resistance and efficient breeding.
Patent Information
- Application Number
- CN202511895870.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-16
- Publication Date
- 2026-01-16
AI Technical Summary
Traditional breeding methods are inefficient and have long breeding cycles, which cannot meet the needs of rapid breeding of new soybean mosaic virus resistant varieties. Existing molecular marker methods have problems such as complicated operation, high cost, low polymorphism or uneven distribution.
A SNP marker located at position 13049396 bp on chromosome 6 of the soybean genome was developed. Polymorphism was detected by Sanger sequencing, and PCR amplification was performed using primer pairs F and R to rapidly identify soybean mosaic virus resistance.
This method enables rapid, economical, and accurate identification of soybean mosaic virus resistance, shortens breeding time, improves breeding efficiency, and allows for the screening of highly resistant new soybean varieties.
Smart Images

Figure CN121344247A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a SNP marker related to soybean mosaic virus resistance and its application. Background Technology
[0002] Soybean (Glycine max (L.) Merr.) is an important dual-purpose crop for both food and oilseed, and a vital source of high-quality plant protein for humans. Soybean mosaic virus (SMV) is a major challenge in soybean production. During production, infection with SMV causes symptoms such as mottled leaves and wrinkling, reducing photosynthetic efficiency and ultimately negatively impacting yield and quality. Since there are currently no effective control methods, breeding soybean varieties with inherent SMV resistance is the most effective strategy to protect soybean production from SMV.
[0003] Traditional breeding methods are inefficient, time-consuming, and labor-intensive, failing to meet the urgent need for breeding new soybean varieties resistant to soybean mosaic virus. Molecular marker-assisted breeding (MMR) is a commonly used technique for identifying and screening resistant materials. MMR allows breeders to confirm disease resistance at the genetic level early on, selecting superior target lines while filtering out unsuitable resources, saving significant time and resources. Commonly used molecular markers include RFLP (Restriction Fragment Length Polymorphism), gene chips, and SSR (Simple Sequence Repeat), but each has its own limitations. For example, RFLP experiments are complex, time-consuming, and highly dependent on technology; SSRs are unevenly distributed in the genome and exhibit some bias; gene chips have long development cycles, high initial investment, and high testing costs. Sanger sequencing, on the other hand, can rapidly detect the genotype of a sample, providing an efficient, fast, and inexpensive detection method for breeding. This will accelerate the development and genetic improvement of new soybean mosaic virus resistant varieties. Therefore, developing SNP loci associated with soybean mosaic virus resistance is of great significance for the rapid breeding of new soybean varieties with soybean mosaic virus resistance.
[0004] Among the aforementioned marker-assisted methods, RFLP markers exhibit low polymorphism in the soybean genome, limiting the construction of high-density genetic maps of soybean (Keim P, Diers BW, Olson TC, et al. RFLP mapping in soybean: association between marker loci and variation in quantitative traits. [J]. Genetics, 1990, 126(3): 735–742.). Furthermore, this method requires polyacrylamide gel electrophoresis, making the experimental process complex, unstable, and highly dependent on technology. SSR markers, on the other hand, can be achieved through simple and easy high-concentration agarose gel electrophoresis. These markers are widely distributed in the soybean genome, exhibit co-dominance, and have significantly higher polymorphism than RFLP markers. However, this marker method suffers from uneven genomic distribution (Wang Zhen. Construction of soybean SSR genetic map and QTL analysis of important agronomic traits [D]. Guangxi University, 2004.). Gene chips suffer from high costs, slow speed and low efficiency in manual sampling. Although intelligent sampling systems save manpower, they are prone to contamination during multiple sample transfers. The sampling quality and efficiency need to be improved (Wang Pan. Research progress on high-throughput rapid detection technology of plant molecular markers [J]. China Seed Industry, 2024).
[0005] Compared with the previous three methods, SNP markers also possess the characteristics of high polymorphism, co-dominance, and wide distribution, and are simpler and less costly to detect than other SNP marker methods. SNP marker identification only requires PCR amplification of the sequence at the location, followed by Sanger sequencing, to identify the locus and thus screen for soybean mosaic virus resistance. This achieves an economical, efficient, and simple breeding-assisted selection method. Summary of the Invention
[0006] The purpose of this invention is to provide an SNP marker related to soybean mosaic virus resistance and its application.
[0007] The technical solution adopted by this invention to solve the technical problem is as follows:
[0008] This invention provides a SNP marker associated with soybean mosaic virus resistance, wherein the SNP marker is located at position 13049396 bp on chromosome 6 of the soybean genome, and the polymorphism of the SNP marker is C or T.
[0009] In a preferred embodiment, the chromosome in which the SNP marker is located and the location of the SNP marker site are determined based on the soybean whole genome of version Glycine max Wm82.a4.v1.
[0010] The present invention also provides primer pairs for detecting the aforementioned SNP marker associated with soybean mosaic virus resistance.
[0011] In a preferred embodiment, the primer pair includes amplification primer F and amplification primer R, wherein the nucleotide sequence of amplification primer F is shown in SEQ ID NO.1 and the nucleotide sequence of amplification primer R is shown in SEQ ID NO.2.
[0012] The present invention also provides a method for identifying or assisting in the identification of soybean mosaic virus resistance, comprising: detecting the polymorphism of the SNP markers related to soybean mosaic virus resistance as described in claim 1 in the genome of the soybean to be tested, and identifying or assisting in the identification of soybean mosaic virus resistance based on the polymorphism of the SNP markers related to soybean mosaic virus resistance.
[0013] The present invention also provides the application of the SNP marker or the primer pair described herein in soybean breeding.
[0014] As a preferred implementation method, the genotype of the SNP marker site at position 13049396 bp on chromosome 6 of the soybean genome is detected, and soybeans with genotype C are selected as parents for breeding, and soybean offspring resistant to soybean mosaic virus are harvested.
[0015] The beneficial effects of this invention are:
[0016] 1. The SNP marker sites and primer pairs provided by this invention can accurately and quickly identify the resistance of soybean varieties to soybean mosaic virus, providing technical support for the efficient breeding of high-quality soybean varieties with high resistance to soybean mosaic virus, shortening the breeding time, improving the breeding efficiency, and playing an important role in soybean mosaic virus resistance breeding.
[0017] 2. The SNP marker provided by this invention can be widely used to screen soybean materials with polymorphism at the marker to identify individuals with high resistance to soybean mosaic virus. This provides a simple, easy-to-use, economical and efficient molecular marker for the breeding of new varieties with high resistance to soybean mosaic virus, and provides a more feasible and practical solution for the efficient selection and utilization of soybean mosaic virus resistance traits.
[0018] 3. This invention reduces selection costs, accelerates the breeding process of new soybean mosaic virus resistant varieties, and improves the efficiency of quality improvement of cultivated soybeans. Attached Figure Description
[0019] Figure 1 This is a population structure diagram of the associated population obtained based on SNP analysis in Example 1.
[0020] Figure 2Manhattan plot of GWAS analysis results for soybean mosaic virus resistance in Example 1.
[0021] Figure 3 The result is the PCR amplification result from Example 3. Detailed Implementation
[0022] In a first aspect, the present invention provides an SNP marker associated with soybean mosaic virus resistance.
[0023] The SNP marker provided by this invention is located at position 13049396 bp on chromosome 6 of the soybean genome, and the polymorphism of the SNP marker is C or T.
[0024] The chromosome on which the SNP marker is located, and the location of the SNP marker site, provided in this invention, are determined based on the soybean whole genome of version Glycine max Wm82.a4.v1.
[0025] The molecular marker provided by this invention is a single nucleotide polymorphism (SNP) marker, which can be used to detect the genotype of a sample by Sanger sequencing. Compared with other types of molecular markers, such as simple sequence repeats (SSRs), insertion-deletion sequences (InDels), and cleaved amplified polymorphic sequences (CAPS), it has the advantages of simple operation and high sensitivity, enabling high-throughput genotype detection of soybean materials, saving time and reducing manpower and material costs.
[0026] Secondly, the present invention provides primer pairs for detecting a SNP marker associated with soybean mosaic virus resistance.
[0027] The primer pair provided by the present invention includes amplification primer F and amplification primer R. The nucleotide sequence of amplification primer F is shown in SEQ ID NO.1, and the nucleotide sequence of amplification primer R is shown in SEQ ID NO.2.
[0028] Thirdly, the present invention provides a method for identifying or assisting in the identification of soybean mosaic virus resistance.
[0029] The present invention provides a method for identifying or assisting in the identification of soybean mosaic virus resistance, comprising the following steps: detecting the polymorphism of SNP markers related to soybean mosaic virus resistance in the genome of the soybean to be tested, and identifying or assisting in the identification of soybean mosaic virus resistance based on the polymorphism of the SNP markers related to soybean mosaic virus resistance.
[0030] Fourthly, the present invention provides the application of the SNP marker or the primer pair in soybean breeding, including:
[0031] (1) It can be used for the selection of soybean mosaic virus resistance traits;
[0032] (2) It can be used for early prediction of soybean mosaic virus resistance.
[0033] This invention detects the genotype of the SNP marker site at position 13049396 bp on chromosome 6 of the soybean genome, selects soybeans with genotype C as parents for breeding, and harvests soybean offspring resistant to soybean mosaic virus.
[0034] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0035] Unless otherwise specified, the present invention does not have special requirements for the raw materials used in the preparation, and commercially available products well known to those skilled in the art can be used.
[0036] Example 1: Development of SNP markers associated with soybean mosaic virus resistance
[0037] 1. Identification and standards for soybean mosaic virus resistance;
[0038] The identification method and standard for soybean mosaic virus disease is the agricultural industry standard NY / T 3428-2019.
[0039] 2. Genome-wide association analysis of soybean mosaic virus genes;
[0040] (1) Genomic DNA acquisition;
[0041] Healthy, fresh soybean leaves were taken and flash-frozen in liquid nitrogen. DNA was then extracted using the CTAB method.
[0042] (2) Genome sequencing and quality control;
[0043] The construction and sequencing of the genome sequencing library were performed by BGI Genomics Co., Ltd. Sequencing was conducted on the Illumina HiSeq 2000 platform using the PE100 sequencing strategy. Trimmomatic (Version 0.39) was used to further filter the sequencing reads with the following parameters: LEADING: 3 TRAILING: 3 HEADCROP: 5 MINLEN: 50. Subsequently, the pruned reads were aligned to a reference sequence using BWA (Version 0.7.17-r1188), which contained the soybean (G.max) genome (Phytozome v4.0), mitochondrial genome (NC_020455.1), and chloroplast genome (NC_007942.1). The BAM files were sorted using Samtools (Version 1.12). Variance detection and genotyping were performed using the mpileup function in BCFtools (Version 1.12) with parameters -E -q 10 -Q 20 -P illumina -d10000 and the -m parameter. PLINK (Version 1.90b6.9) was used to filter raw variants to exclude indels, sites with high deletion rates (0.5), or low minor allele frequencies (MAF < 0.05). Samples with more than 25% deletions were discarded.
[0044] (3) Genetic structure analysis of the test population;
[0045] For phylogenetic analysis, the vcf2phylip.py script (https: / / github.com / edgardomortiz / vcf2phylip) was used to convert variants to a Phylip-compatible input format. A phylogenetic tree was constructed using Phylip's default parameters. The tree was then visualized using Figtree (Version 1.4.4, https: / / tree.bio.ed.ac.uk / software / figtree / ). Linkage disequilibrium (LD) analysis was performed using pairwise r² calculated via PLINK. The mean r² of 5 kb segments was calculated and graphically visualized using R (Version 4.1.3). For principal component analysis (PCA) and population structure analysis, SNPs with r² less than 0.2 were pruned using the PLINK parameter --indep-pairwise 50 10 0.2. A total of 9170 SNPs were used for PCA and population structure analysis. Eigenvectors and eigenvalues were calculated using PLINK. The ancestor component matrix was calculated using Admixture (Version 1.3.0), and 200 bootstrap resampling iterations were performed. The optimal number of clusters (k) was selected based on the error rate of 5-fold cross-validation from k = 2 to k = 10. The population structure diagram of the associated groups obtained based on SNP analysis is shown below. Figure 1 As shown, clustering is performed on samples with the number of clusters (K value) ranging from 1 to 20. The clustering results are then cross-validated, and the optimal number of clusters is determined to be 7 based on the valley of the cross-validation error rate.
[0046] (4) GWAS analysis;
[0047] GWAS analysis was performed for each trait and genome-wide SNP using a mixed linear model (MLM) approach implemented in GEMMA software (Version 0.98.5). A phylogenetic matrix (K) was used to define the variance structure of the random variables, thus controlling for recessive associations among varieties. The first three principal components (PCs) were fitted as fixed effects to explain population structure. The mean squared deviation (MSD) method was used to compare models with different covariates. In short, the deviation of each model's p-value from the expected distribution was estimated by calculating the MSD for all markers. The model with the lowest MSD value was selected for each trait under each environment. The false discovery rate (FCR) of the GWAS results for each trait was calculated. Finally, a uniform significance threshold (p-value < 1.00 × 10⁻⁶) was selected based on the overall FCR for all quantitative traits. -5 However, the 4SPN trait is an exception, as it is sparsely distributed in a few germplasms. For 4SPN and the two quality traits PC and SGH, a more stringent threshold (p-value < 1.00 × 10⁻⁶) was used.-7 Based on the p-value for each trait and linkage disequilibrium between SNPs (r² = 0.3), significant associated sites (SALs) were identified using the clump function in PLINK, and overlapping clump ranges were merged to form a single SAL. To obtain all genes potentially associated with SALs, genes located within the SAL region and within 10 kb upstream and downstream of it were extracted. The best matches for these genes in soybean were identified using the blastp program. Genes with known functions or with related functional homologs in soybean were selected as candidate genes for the SAL.
[0048] Manhattan plot of GWAS analysis results for soybean mosaic virus resistance is shown below. Figure 2 As shown, the vertical axis represents the negative logarithm of the p-value, and the horizontal axis represents the chromosome. Each point represents a SNP locus. The dashed line corresponds to a p-value of 10⁻⁵. Points higher than the dashed line indicate that the corresponding SNP marker is significantly associated with soybean mosaic virus resistance. The highest point on the blue line of chromosome 6 of the soybean genome corresponds to position 13,049,396.
[0049] Example 2: Obtaining SNP markers associated with soybean mosaic virus resistance
[0050] Based on the analysis results of Example 1, a SNP marker associated with soybean mosaic virus resistance was successfully developed. The SNP marker associated with soybean mosaic virus resistance is located at position 13049396 bp on chromosome 6 of the soybean genome. The polymorphism of the SNP marker associated with soybean mosaic virus resistance, i.e., the variant base type, is C / T (see Table 1). The soybean genome version used is Glycine max Wm82.a4.v1.
[0051] Table 1
[0052] Tag type chromosome Location Variant base types SMV infection / resistance SNP No. 6 13049396bp C / T C-resistance, T-sensitivity
[0053] The amplification primers for SNP markers associated with soybean mosaic virus resistance are as follows:
[0054] F: 5' - GACGGGAATTTGATTCAGAAGC -3';
[0055] R: 5' - AGGCCTTGTTTGAGTAAGCTT -3'.
[0056] Example 3: A method for determining soybean mosaic virus resistance using SNP markers obtained in Example 2
[0057] 1. Identification and standards for soybean mosaic virus resistance;
[0058] Resistance to soybean mosaic virus was identified in 10 soybean varieties with known phenotypic data. The identification method and standard were agricultural industry standard NY / T 3428-2019. The identification results of these 10 soybean varieties are shown in Table 2.
[0059] Table 2
[0060] Serial Number Resource Name Resistance identification 1 T309 feel 2 T265H feel 3 Elgin feel 4 Goraw feel 5 Vinton 81 feel 6 H39-1 anti- 7 SS202 anti- 8 kariyufaka anti- 9 T212 anti- 10 Pixie anti-
[0061] 2. Extract genomic DNA;
[0062] Genomic DNA was extracted from soybean leaves according to the operating instructions of the TIANGEN Plant Genomic DNA Extraction Kit (DP305).
[0063] 3. PCR amplification;
[0064] Using soybean leaf genomic DNA as a template, PCR amplification was performed on the sample using the amplification primers from Example 2 to obtain amplified product fragments. The PCR reaction was carried out on a PCR thermal cycler from ABI (Applied Biosystems, USA), and the amplified product fragments were finally sequenced by Sanger sequencing.
[0065] The above PCR reaction system is 10 μL, including 1 μL of 30 ng template, 5 μL of 2xEs Taq MasterMix (Comway Century, catalog number CW0690H), 2 μL of ddH2O, and 1 μL each of F and R primers.
[0066] The above PCR amplification program is as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s; and optimized annealing temperature.
[0067] Anneal at 58℃ for 30 seconds, extend at 72℃ for 40 seconds, for 35 cycles; extend at 72℃ for 10 minutes; store at 4℃.
[0068] Table 3
[0069] Serial Number Resource Name Resistance identification genotype 1 T309 feel T 2 T265H feel T 3 Elgin feel T 4 Goraw feel T 5 Vinton 81 feel T 6 H39-1 anti- C 7 SS202 anti- C 8 kariyufaka anti- C 9 T212 anti- C 10 Pixie anti- C
[0070] The PCR amplification results are shown in Table 3 and Figure 3 Genotyping was performed using the SNP markers and amplification primers of this invention. When the 164th base in the Sanger sequencing result was C, the sample was identified as a soybean line with high resistance to soybean mosaic virus; when the 164th base in the Sanger sequencing result was T, the sample was identified as a soybean line with low resistance to soybean mosaic virus. The SNP markers and amplification primers of this invention achieved 100% accuracy in detecting soybean materials, demonstrating the effectiveness of SNP markers in soybean-assisted selection.
[0071] Example 4: Application of SNP markers associated with soybean mosaic virus resistance
[0072] Soybean samples tested: 66 soybean germplasm resources (from Jilin Academy of Agricultural Sciences). Following Example 3, a method for detecting soybean mosaic virus resistance using SNP markers was established using soybean materials with known phenotypic data. The results are shown in Table 4. The results showed that among the 66 tested soybean samples, 26 varieties were sensitive, and 41 varieties were resistant. Overall, soybean varieties with the T genotype were susceptible to soybean mosaic virus, while those with the C genotype showed resistance. The accuracy was 75.76%, the sensitivity was 96.27%, and the specificity was 96.00%.
[0073] Table 4. Evaluation of soybean mosaic virus resistance and genotypic analysis of tested soybeans
[0074] Serial Number Resource Name genotype Resistance identification 1 Hefeng 39 C feel 2 Beijiang No. 91 C anti- 3 Bin County Black Beans C anti- 4 Da'an flat bean C anti- 5 Dongnong 57 C anti- 6 Dongshi 94-2-890 C anti- 7 Gannan Niu Mao Huang C anti- 8 Heihe No. 6 C anti- 9 Black Farmer 56 C anti- 10 Heinong No. 68 C anti- 11 Hujiao 2117 C anti- 12 Huma Black Beans C anti- 13 Jihuang Xiaoli No. 8 C anti- 14 Jiyu 321 C anti- 15 36g of Beans C anti- 16 Kenfeng No. 16 C anti- 17 Kenfeng No. 18 C anti- 18 Kenjian No. 17 C anti- 19 Kenong No. 4 C anti- 20 Liaoning soybean 37 C anti- 21 Linjiang Purple Flower Four-Grain Yellow C anti- 22 Full warehouse gold C anti- 23 Qi Nong 9 C anti- 24 Suinong 22 C anti- 25 Suinong 75 C anti- 26 Iron Bean No. 37 C anti- 27 Zhonghuang 55 C anti- 28 Adachi White Eyebrows T feel 29 Northern Xinjiang 91 T feel 30 Red Bean No. 1 T feel 31 Large Yellow T feel 32 Dongda No. 2 T feel 33 East Wind Boundless Purple Flowers T feel 34 Black beans T feel 35 Black navel T feel 36 Huadian Four-Grain Yellow T feel 37 Huai De returned home in sixty days T feel 38 Huanren early soybean T feel 39 Huang Dali T feel 40 Yellow soybeans T feel 41 Jilin No. 28 T feel 42 Group No. 5 T feel 43 93 Black 05-59 T feel 44 Linjiang Large Grain Yellow T feel 45 American Flat Stem-1 T feel 46 Mutton Test No. 9 T feel 47 Raohe in August T feel 48 shangzhi douludou T feel 49 Double Yang Full Warehouse Gold T feel 50 Swan eggs T feel 51 Tonghua green beans T feel 52 Beidou No. 3 T anti- 53 North Bean 40 T anti- 54 He Nong 95 T anti- 55 Heihe No. 53 T anti- 56 Jilin-Heilongjiang No. 4 T anti- 57 Jilin-Heilongjiang 61 T anti- 58 Jinong No. 17 T anti- 59 Jiyu 102 T anti- 60 Jiyu 504 T anti- 61 Jiyu No. 97 T anti- 62 Jin Yuan No. 1 T anti- 63 Mengdou 37 T anti- 64 Saint Bean 41 T anti- 65 Changnong 29 T anti- 66 Changnong 15 T anti-
[0075] This invention discloses a SNP marker associated with soybean mosaic virus resistance and its application. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The product of this invention has been described through preferred embodiments, and those skilled in the art can clearly modify or appropriately change and combine the product described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
Claims
1. A SNP marker associated with soybean mosaic virus resistance, characterized in that, The SNP marker is located at 13049396 bp of chromosome 6 of the soybean genome, and the polymorphism of the SNP marker is C or T.
2. The SNP marker associated with soybean mosaic virus resistance according to claim 1, wherein, The chromosome where the SNP marker is located and the position of the site of the SNP marker are determined based on the full genome of Glycine max Wm82.a4.v1.
3. A primer pair for detecting the SNP marker associated with soybean mosaic virus resistance according to claim 1.
4. The primer pair according to claim 3, characterized in that, The primer pair comprises an amplification primer F and an amplification primer R, the nucleotide sequence of the amplification primer F is shown as SEQ ID NO. 1, and the nucleotide sequence of the amplification primer R is shown as SEQ ID NO.
2.
5. A method for identifying or assisting in the identification of soybean mosaic virus resistance, characterized in that, Comprise: Detecting the polymorphism of the SNP marker associated with soybean mosaic virus resistance in claim 1 in the soybean genome to be tested, and identifying or assisting in identifying soybean mosaic virus resistance according to the polymorphism of the SNP marker associated with soybean mosaic virus resistance.
6. The SNP marker according to claim 1 or the primer pair according to claim 3 is applied in soybean breeding.
7. Use according to claim 6, characterized in that, Detecting the genotype of the SNP marker site at 13049396 bp on chromosome 6 of the soybean genome, selecting soybeans with genotype C as parents for breeding, and harvesting soybean offspring resistant to soybean mosaic virus.