SNP (Single Nucleotide Polymorphism) molecular marker for soybean mosaic virus resistance-assisted selection, primer group and application of SNP molecular marker
By developing SNP molecular markers and primer sets at position 29327608 bp on chromosome 13 of the soybean genome, the problem of soybean mosaic virus disease control was solved, enabling efficient screening and breeding of resistant soybean varieties and improving breeding efficiency.
Patent Information
- Application Number
- CN202511896458.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-16
- Publication Date
- 2026-02-10
AI Technical Summary
The lack of effective prevention and control measures in existing technologies to deal with soybean mosaic virus disease leads to reduced soybean yield and quality, and makes it difficult to efficiently screen and breed resistant soybean varieties.
A novel SNP molecular marker for soybean mosaic virus resistance-assisted selection was developed. The marker is located at position 29327608 bp on chromosome 13 of the soybean genome and has a polymorphism of A/C. Soybean genotypes were detected by primer set analysis, and soybeans with genotype A were selected for breeding to achieve disease resistance.
It improves soybean breeding efficiency, shortens breeding time, provides a simple and efficient selection scheme, and helps to screen out highly resistant soybean varieties.
Smart Images

Figure CN121496086A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a SNP molecular marker, primer set, and application for auxiliary selection of soybean mosaic virus resistance. Background Technology
[0002] Soybean mosaic virus (SMV) is a prevalent and significant disease in soybean production, causing not only yield reduction but also severe quality degradation. The primary source of infection is infected seeds, with plants growing from these seeds becoming the source of reinfection in the field. The main transmission route for SMV is through aphids, followed by transmission via leaf abrasions and agricultural damage. SMV presents with typical mosaic symptoms on soybean leaves, commonly including severe mosaic, wrinkled mosaic, and mild mosaic types. Currently, there are no effective control measures for SMV. Summary of the Invention
[0003] The purpose of this invention is to provide a SNP molecular marker, primer set, and its application for soybean mosaic virus resistance-assisted selection. The SNP molecular marker and related primer set obtained by this invention are mainly applicable to the development and screening of soybean germplasm resources. By performing molecular-assisted identification of soybean mosaic virus resistance, it enables the screening of superior soybean mosaic virus-resistant soybean germplasm and the design of breeding programs.
[0004] The technical solution adopted by this invention to solve the technical problem is as follows:
[0005] The present invention provides a SNP molecular marker for soybean mosaic virus resistance-assisted selection, which is located at position 29327608 bp on chromosome 13 of the soybean genome, and the polymorphism of the SNP molecular marker is A / C.
[0006] Specifically, the chromosome and locus location of the SNP molecular marker for soybean mosaic virus resistance-assisted selection provided by this invention are determined based on the soybean genome version number Glycine max Wm82.a4.v1.
[0007] This invention provides a primer set for detecting the SNP molecular marker for auxiliary selection of soybean mosaic virus resistance, the sequence information of which is as follows:
[0008] F: 5' - TTTGGCCACACAGACTTGTTA -3';
[0009] R: 5' - TCCTTCCGGAAGATTTTGGAC -3'.
[0010] This invention provides an SNP molecular marker for auxiliary selection of soybean mosaic virus resistance and the application of related primer sets in auxiliary selection of soybeans resistant to soybean mosaic virus.
[0011] Specifically, the applications include auxiliary selection for soybean mosaic virus resistance traits and early prediction of soybean mosaic virus resistance.
[0012] Specifically, the primer set described above is used to detect the polymorphism of the SNP molecular marker for soybean mosaic virus resistance-assisted selection in the soybean genome to be tested, and the soybean mosaic virus resistance is identified based on the polymorphism of the SNP molecular marker.
[0013] Specifically, by detecting the genotype of the SNP molecular marker site at position 29327608 bp on chromosome 13 of the soybean genome, soybeans with genotype A are selected for breeding in order to harvest soybean offspring resistant to soybean mosaic virus.
[0014] Compared with the prior art, the beneficial effects of the present invention are:
[0015] This invention has found that the interval between 29127690 bp and 29526882 bp on soybean chromosome 13 is an ideal marker interval for regulating soybean mosaic virus resistance, and the SNP at 29327608 bp contributes 31.65% to soybean mosaic virus resistance.
[0016] The SNP molecular markers and related primer sets provided by this invention can assist in the selection of soybean varieties with high resistance to soybean mosaic virus, serving the breeding of new soybean varieties with high resistance to soybean mosaic virus, improving the efficiency of soybean breeding, shortening the time of soybean breeding, and providing a simple, easy-to-implement, economical and efficient solution for the efficient selection and application of soybean mosaic virus resistance traits. Attached Figure Description
[0017] Figure 1 This is a population structure diagram of the associated groups obtained based on SNP analysis.
[0018] Figure 2 Manhattan plot of GWAS analysis results for soybean mosaic virus resistance.
[0019] Figure 3 This is the PCR amplification result in Example 3 of the present invention. Detailed Implementation
[0020] I. This invention provides an SNP molecular marker for auxiliary selection of soybean mosaic virus resistance.
[0021] The SNP molecular marker for soybean mosaic virus resistance-assisted selection provided by this invention is located at position 29327608 bp on chromosome 13 of the soybean genome, and its polymorphism is A / C.
[0022] The chromosome and locus location of the SNP molecular marker for soybean mosaic virus resistance-assisted selection provided by this invention are determined based on the soybean genome version number Glycine max Wm82.a4.v1.
[0023] II. The present invention provides a primer set for detecting the SNP molecular markers for auxiliary selection of soybean mosaic virus resistance.
[0024] The primer set provided by this invention for detecting the SNP molecular marker for auxiliary selection of soybean mosaic virus resistance has the following sequence information:
[0025] F: 5' - TTTGGCCACACAGACTTGTTA -3';
[0026] R: 5' - TCCTTCCGGAAGATTTTGGAC -3'.
[0027] III. This invention provides an SNP molecular marker for soybean mosaic virus resistance-assisted selection and the application of related primer sets in assisting the selection of soybeans resistant to soybean mosaic virus.
[0028] This invention provides an SNP molecular marker and related primer set for auxiliary selection of soybean mosaic virus resistance, mainly used for auxiliary selection of soybean mosaic virus resistance traits and early prediction of soybean mosaic virus resistance.
[0029] The polymorphism of the SNP molecular marker for soybean mosaic virus resistance auxiliary selection in the soybean genome was detected using the primer set described above, and the soybean mosaic virus resistance was identified based on the polymorphism of the SNP molecular marker.
[0030] By detecting the genotype of the SNP molecular marker locus at position 29327608 bp on chromosome 13 of the soybean genome, soybeans with genotype A were selected for breeding to facilitate the harvesting of soybean offspring resistant to soybean mosaic virus.
[0031] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.
[0032] Example 1: Development of a SNP molecular marker for soybean mosaic virus resistance-assisted selection
[0033] 1. Identification and standards for soybean mosaic virus resistance;
[0034] The identification method and standard for soybean mosaic virus disease is the agricultural industry standard NY / T 3428-2019.
[0035] 2. Genome-wide association analysis of soybean mosaic virus genes;
[0036] (1) Genomic DNA acquisition;
[0037] Healthy, fresh soybean leaves were taken and flash-frozen in liquid nitrogen. DNA was then extracted using the CTAB method.
[0038] (2) Genome sequencing and quality control;
[0039] The construction and sequencing of the genome sequencing library were completed by BGI Genomics Co., Ltd. Sequencing was performed on the Illumina HiSeq 2000 platform using the PE100 sequencing strategy. Trimmomatic (Version 0.39) was used to further filter the sequencing reads with the following parameters: LEADING: 3 TRAILING: 3 HEADCROP: 5 MINLEN: 50. Subsequently, the pruned reads were aligned to a reference sequence using BWA (Version 0.7.17-r1188), which contained the soybean (G.max) genome (Phytozome v4.0), mitochondrial genome (NC_020455.1), and chloroplast genome (NC_007942.1). The BAM files were sorted using Samtools (Version 1.12). Variance detection and genotyping were performed using the mpileup function in BCFtools (Version 1.12) with parameters -E -q 10 -Q 20 -P illumina -d10000 and the -m parameter. PLINK (Version 1.90b6.9) was used to filter raw variants to exclude indels, sites with high deletion rates (0.5), or low minor allele frequencies (MAF < 0.05). Samples with more than 25% deletions were discarded.
[0040] (3) Genetic structure analysis of the test population;
[0041] For phylogenetic analysis, the vcf2phylip.py script (https: / / github.com / edgardomortiz / vcf2phylip) was used to convert variants to a Phylip-compatible input format. A phylogenetic tree was constructed using Phylip's default parameters. The tree was then visualized using Figtree (Version 1.4.4, https: / / tree.bio.ed.ac.uk / software / figtree / ). Linkage disequilibrium (LD) analysis was performed using pairwise r² calculated via PLINK. The mean r² of 5 kb segments was calculated and graphically visualized using R (Version 4.1.3). For principal component analysis (PCA) and population structure analysis, SNPs with r² less than 0.2 were pruned using the PLINK parameter --indep-pairwise 50 10 0.2. A total of 9170 SNPs were used for PCA and population structure analysis. Eigenvectors and eigenvalues were calculated using PLINK. The ancestor component matrix was calculated using Admixture (Version 1.3.0), and 200 bootstrap resampling iterations were performed. The optimal number of clusters (k) was selected based on the error rate of 5-fold cross-validation from k = 2 to k = 10. The population structure diagram of the associated groups obtained based on SNP analysis is shown below. Figure 1 As shown, clustering was performed on samples assuming the number of clusters (K value) ranged from 1 to 20. Cross-validation was then performed on the clustering results, and the optimal number of clusters was determined to be 7 based on the trough of the cross-validation error rate.
[0042] (4) GWAS analysis;
[0043] GWAS analysis was performed for each trait and genome-wide SNP using a mixed linear model (MLM) approach implemented in GEMMA software (Version 0.98.5). A phylogenetic matrix (K) was used to define the variance structure of the random variables, thus controlling for recessive associations among varieties. The first three principal components (PCs) were fitted as fixed effects to explain population structure. The mean squared deviation (MSD) method was used to compare models with different covariates. In short, the deviation of each model's p-value from the expected distribution was estimated by calculating the MSD for all markers. The model with the lowest MSD value was selected for each trait under each environment. The false discovery rate (FCR) of the GWAS results for each trait was calculated. Finally, a uniform significance threshold (p-value < 1.00 × 10⁻⁶) was selected based on the overall FCR for all quantitative traits. -5 However, the 4SPN trait is an exception, as it is sparsely distributed in a few germplasms. For 4SPN and the two quality traits PC and SGH, a more stringent threshold (p-value < 1.00 × 10⁻⁶) was used.-7 Based on the p-value for each trait and linkage disequilibrium between SNPs (r² = 0.3), significant associated sites (SALs) were identified using the clump function in PLINK, and overlapping clump ranges were merged to form a single SAL. To obtain all genes potentially associated with SALs, genes located within the SAL region and their upstream and downstream 10 kb regions were extracted. The best matches for these genes in soybean were identified using the blastp program. Genes with known functions or with related functional homologs in soybean were selected as candidate genes for the SAL. The Manhattan plot of the GWAS analysis results for soybean mosaic virus resistance is shown below. Figure 2 As shown, the vertical axis represents the negative logarithm of the p-value, and the horizontal axis represents the chromosome. Each point represents a SNP locus; the dashed line corresponds to a p-value of 10. -5 Points above the dashed line indicate that the corresponding SNP molecular markers are significantly associated with soybean mosaic virus resistance, with the highest point on the blue line of chromosome 13 corresponding to position 29,327,608.
[0044] Example 2: Obtaining a SNP molecular marker and related primer set for soybean mosaic virus resistance-assisted selection
[0045] Based on the above analysis results, this invention successfully developed an SNP molecular marker for soybean mosaic virus resistance-assisted selection. The SNP molecular marker is located at position 29327608 bp on chromosome 13 of the soybean genome. The polymorphism of the SNP molecular marker, i.e., the variant base type, is A / C, and the SMV susceptibility / resistance is: A for resistance, C for susceptibility.
[0046] The chromosome containing the SNP molecular marker for soybean mosaic virus resistance-assisted selection provided by this invention, and the location of the SNP marker site, are determined based on the soybean whole genome of version Glycine max Wm82.a4.v1.
[0047] The sequence information of the primer set used to detect SNP molecular markers for soybean mosaic virus resistance auxiliary selection is as follows:
[0048] F: 5' - TTTGGCCACACAGACTTGTTA -3';
[0049] R: 5' - TCCTTCCGGAAGATTTTGGAC -3'.
[0050] Example 3: A method for identifying soybean mosaic virus resistance using SNP molecular markers and related primer sets obtained in Example 2 for auxiliary selection.
[0051] 1. Identification and standards for soybean mosaic virus resistance;
[0052] Resistance to soybean mosaic virus was identified in 10 soybean varieties with known phenotypic data. The identification method and standard were agricultural industry standard NY / T 3428-2019. The identification results of these 10 soybean varieties are shown in Table 2.
[0053] Table 2
[0054] Serial Number Resource Name Resistance identification 1 Hefeng 39 feel 2 Hack feel 3 T265H feel 4 Weber feel 5 thome feel 6 H39-1 anti- 7 American Flat Stem-1 anti- 8 century-2 anti- 9 Dongnong 57 anti- 10 Heihe No. 11 anti-
[0055] 2. Extract genomic DNA;
[0056] Genomic DNA was extracted from soybean leaves according to the operating instructions of the TIANGEN Plant Genomic DNA Extraction Kit (DP305).
[0057] 3. PCR amplification;
[0058] Using soybean leaf genomic DNA as a template, PCR amplification was performed on the sample using the primer set described in Example 2 to obtain amplified product fragments. The PCR reaction was carried out on a PCR thermal cycler from ABI (Applied Biosystems, USA), and the amplified product fragments were finally sequenced by Sanger sequencing.
[0059] The above PCR reaction system is 10 μL, including 1 μL of 30 ng template, 5 μL of 2xEs Taq MasterMix (Comway Century, catalog number CW0690H), 2 μL of ddH2O, and 1 μL each of F and R primers.
[0060] The above PCR amplification program is as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, optimized annealing temperature at 58℃ for 30 s, extension at 72℃ for 40 s, 35 cycles; final extension at 72℃ for 10 min; stored at 4℃.
[0061] Table 3
[0062] Serial Number Resource Name Resistance identification genotype 1 Hefeng 39 feel C 2 Hack feel C 3 T265H feel C 4 Weber feel C 5 thome feel C 6 H39-1 anti- A 7 American Flat Stem-1 anti- A 8 century-2 anti- A 9 Dongnong 57 anti- A 10 Heihe No. 11 anti- A
[0063] The PCR amplification results are shown in Table 3 and Figure 3 Genotyping was performed using the SNP molecular markers and amplification primers of this invention. When the 117th base in the Sanger sequencing result was A, the sample was identified as a soybean line with high resistance to soybean mosaic virus; when the 117th base in the Sanger sequencing result was C, the sample was identified as a soybean line with low resistance to soybean mosaic virus. The detection accuracy of the SNP molecular markers and amplification primers for soybean materials reached 100%, indicating that SNP molecular markers are indeed effective for soybean-assisted selection.
[0064] Example 4: Application of SNP molecular markers and related primer sets for soybean mosaic virus resistance-assisted selection in the auxiliary identification of soybean mosaic virus resistance.
[0065] Soybean samples used for testing: 57 soybean germplasm resources (from Jilin Academy of Agricultural Sciences). Following Example 3, a method for detecting soybean mosaic virus resistance using SNP markers was established using soybean materials with known phenotypic data.
[0066] The results are shown in Table 4. Of the 57 soybean samples tested, 29 varieties were sensitive and 41 varieties were resistant. Overall, soybean varieties with genotype C were susceptible to soybean mosaic virus, while those with genotype A were resistant. Accuracy: 77.19%, Sensitivity: 96.67%, Specificity: 93.75%.
[0067] Table 4
[0068] Serial Number Soybean varieties genotype Resistance identification 1 Tonghua green beans C feel 2 Swan eggs C feel 3 Mutton Test No. 9 C feel 4 Linjiang Large Grain Yellow C feel 5 93 Black 05-59 C feel 6 Group No. 5 C feel 7 Jilin No. 28 C feel 8 Huanren early soybean C feel 9 Black navel C feel 10 Black beans C feel 11 Hefeng 39 C feel 12 Red Bean No. 1 C feel 13 Northern Xinjiang 91 C feel 14 Adachi White Eyebrows C feel 15 HE10 (Heihe No. 10) C feel 16 Changnong 29 C anti- 17 Suinong 75 C anti- 18 Suinong 22 C anti- 19 Saint Bean 41 C anti- 20 Longqing Beans 2-2 C anti- 21 Kenfeng No. 22 C anti- 22 Kenfeng No. 18 C anti- 23 Jin Yuan No. 1 C anti- 24 Jiyu 47 C anti- 25 Heihe No. 6 C anti- 26 North Bean 40 C anti- 27 Beidou No. 3 C anti- 28 Dongda No. 2 A feel 29 Zhonghuang 55 A anti- 30 Changnong 15 A anti- 31 Iron Bean No. 37 A anti- 32 Qi Nong 9 A anti- 33 Liaoning soybean 37 A anti- 34 Kenjian No. 17 A anti- 35 Kenfeng No. 16 A anti- 36 36g of Beans A anti- 37 Jiyu No. 97 A anti- 38 Jiyu 89 A anti- 39 Jiyu 504 A anti- 40 Jiyu 321 A anti- 41 Jiyu 102 A anti- 42 Jinong No. 17 A anti- 43 Jihuang Xiaoli No. 8 A anti- 44 Jihuang Small Grain No. 5 A anti- 45 Jilin-Heilongjiang 61 A anti- 46 Jilin-Heilongjiang No. 4 A anti- 47 Hujiao 2117 A anti- 48 Heinong No. 68 A anti- 49 Black Farmer 56 A anti- 50 Heihe No. 53 A anti- 51 He Nong 95 A anti- 52 Fendou 65 A anti- 53 Dongshi 94-2-890 A anti- 54 Dongshi 94-2(3)-1 A anti- 55 Dongnong 57 A anti- 56 Dedu Pingdingxiang A anti- 57 HE11 (Heihe No. 11) A anti-
[0069] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A SNP molecular marker for soybean mosaic virus resistance-assisted selection, characterized in that, The SNP molecular marker is located at position 29327608 bp on chromosome 13 of the soybean genome, and its polymorphism is A / C.
2. The SNP molecular marker for soybean mosaic virus resistance-assisted selection according to claim 1, characterized in that, The chromosome and locus of the SNP molecular marker were determined based on the soybean genome version number Glycine maxWm82.a4.v1.
3. A primer set for detecting the SNP molecular marker for soybean mosaic virus resistance auxiliary selection as described in claim 1, characterized in that, The sequence information of this primer set is as follows: F: 5' - TTTGGCCACACAGACTTGTTA -3'; R: 5' - TCCTTCCGGAAGATTTTGGAC -3'.
4. The application of the SNP molecular marker as described in claim 1 and / or the primer set as described in claim 3 in the auxiliary selection of soybeans resistant to soybean mosaic virus.
5. The application according to claim 4, characterized in that, This includes auxiliary selection for soybean mosaic virus resistance traits and early prediction of soybean mosaic virus resistance.
6. The application according to claim 4, characterized in that, The polymorphism of the SNP molecular marker for soybean mosaic virus resistance auxiliary selection as described in claim 1 in the soybean genome of the test subject was detected using the primer set described in claim 3, and the soybean mosaic virus resistance was identified based on the polymorphism of the SNP molecular marker.
7. The application according to claim 4, characterized in that, The genotype of the SNP molecular marker locus at position 29327608 bp on chromosome 13 of the soybean genome was detected. Soybeans with genotype A were selected for breeding, and soybean offspring resistant to soybean mosaic virus were harvested.