Tumor-specific expression cassette and application thereof

Abstract

Provided herein is an expression cassette, the expression cassette comprising: 1) a chimeric promoter, the chimeric promoter comprising an hTERT promoter and a minimum promoter; 2) a coding sequence (CDS); and 3) a poly (A) sequence or a polyadenylation signal sequence. The CDS sequence in the expression cassette is only expressed in a tumor or a cancer cell, or the expression level in the tumor or the cancer cell is far higher than the expression level in a normal cell, so that the expression cassette can be used for treating cancer.

Description

Cross-reference to related applications

[0001] This application claims priority to PCT International Application PCT / CN2023 / 100812, filed on June 16, 2023, the contents of which are incorporated herein by reference in their entirety. Technical Field

[0002] This invention relates to tumor-specific expression vectors, and more particularly to heterozygous promoters that efficiently and specifically drive gene expression in cancer cells. The invention further relates to expression cassettes and vectors comprising heterozygous promoters and other transcriptional cis-elements. The invention also relates to the use of these vectors in the detection, diagnosis, or treatment of various cancers. Background Technology

[0003] One strategy for gene therapy against cancer involves novel treatments, namely, introducing genes into cancerous cells or surrounding tissues to induce cell death or slow cancer growth. In recent decades, the transcriptomes of various cancer cells have been studied to identify cancer-specific gene profiles. Alterations in transcriptional gene patterns are widely considered key to the uncontrolled proliferation of cancer cells and their evasion of programmed cell death. Dysregulated transcriptional mechanisms typically consist of overexpression, degeneration, and hyperfunction of pro-cancer transcription factors, as well as mutations in tumor suppressor factors. Ideally, cancer-specific killing can be achieved through the delivery of therapeutic genes under the control of cis-elements, which can interact with and be activated by overexpressed or constitutively activated tumor transcription factors. Whether the expression of therapeutic genes is controlled by tumor-specific promoters is a major question when administering anti-cancer gene molecules locally or systemically, and this determines the success of cancer gene therapy.

[0004] Tumor-specific promoters are considered promising genetic tools in cancer therapy. Well-used tumor-specific promoters include alpha-fetoprotein (AFP), thyroid transcription factor 1 (TTF-1), phosphatidylinositol proteoglycan-3 (GPC3), human secretory leukocyte protease inhibitor (hSLPI), ERBB2, mucin 1 (MUC1), L-filamentin, alpha-lactalbumin (LALBA), cyclooxygenase 2 (COX2), epithelial glycoprotein (EPG2), A33, uPAR, carcinoembryonic antigen (CEA), breast cancer 1 (BRCA1), BRCA2, and survival protein. To a large extent, the good tumor selectivity of these promoters ensures gene expression during malignant processes, but they lack specificity for certain tissue types. However, these initial tumor-specific promoters are active only in a limited number of cancer cell classes, or their transcriptional activity varies greatly across different tumors. For example, the activity of the human survival protein promoter ranges from 0.3% to 16% of that of the CMV promoter. How to efficiently express therapeutic genes in cancer cells remains a bottleneck for tumor-targeted gene therapy.

[0005] A growing body of research suggests that the efficiency of tumor-specific promoters can be improved by engineering promoter transcription factor binding sites and by hybridizing them with cis-elements containing other transcription factor binding motifs. Hybrid promoters can include combinations of known promoters with each other or with certain heterologous regulatory elements to increase the intensity and specificity of expression in cancer cells. Typically, researchers creating hybrid promoters aim to maximize expression efficiency and specificity in specific types of cancer cells. The advantage of using promoters and other regulatory elements that are strictly specific to a particular tumor type is that side effects are minimized due to reduced expression of therapeutic genes in normal tissues. However, a drawback of this approach is its lack of universality.

[0006] Unrestricted self-renewal is a hallmark of cancer and is achieved through telomere maintenance, for which the activity of telomerase (composed of the non-coding RNA component hTR and the catalytic subunit hTERT) is crucial. Consistently, hTERT expression has been identified in nearly 90% of primary cancers in humans. However, in normal tissues, hTERT is detected only in spermatogonia, colon crypt stem cells or progenitor cells, and some transitional epithelial basal cells, and not in major functional organs such as the liver, kidney, muscle, or placenta. Similar to most initial tumor-specific promoters, hTERT exhibits varying expression activity in different types of tumors. Overall, advanced cancer cells often exhibit higher telomerase activity and expression levels. Some early-stage cancers show only weak hTERT transcriptional activity, likely due to lower levels of oncogenic transcription factors such as c-Myc and ETS in these cells.

[0007] Reactive oxygen species (ROS) have been extensively studied over the past half-century and are believed to play a crucial role in tumorigenesis. In normal cells, excessive levels of cellular ROS cause damage to proteins, nucleic acids, lipids, membranes, and organelles, thereby triggering the activation of cell death processes such as apoptosis. Interestingly, high levels of ROS and restricted apoptosis have been observed in various cancer cells, suggesting that tumor-specific molecular mechanisms protect cancer cells from ROS-induced apoptosis. The transcription factor NRF2 is a well-studied major regulator of cellular antioxidant responses. NRF2 expression is often enhanced in various tumor types, including lung, breast, colon, and ovarian cancer; high NRF2 levels play a key role in tumor cell growth and chemotherapy resistance by enhancing ROS-inhibiting enzymes, detoxification factors, anti-apoptotic proteins, and drug transporters. NRF2 regulates these genes by binding to cis-elements called antioxidant response elements (AREs). Similarly, these ARE-containing genes are upregulated in cancer and involved in tumorigenesis. Summary of the Invention

[0008] To overcome the bottlenecks in expression efficiency and specificity in cancer therapy, we engineered and generated a series of hybrid promoters consisting of: antioxidant response elements, pruned hTERT and other tumor-specific core promoters, and poly(A) post-enhancers.

[0009] In one aspect, this disclosure provides an expression box that includes: 1) A chimeric promoter, wherein the chimeric promoter comprises an hTERT promoter and a minimal promoter; 2) Coded Sequence (CDS); and 3) Poly(A) sequence or polyadenylation signal sequence.

[0010] In some embodiments, the hTERT promoter is the hTERT core promoter, preferably comprising at least one of the sequences of SEQ ID NO: 1-7 or a sequence having at least 90% sequence identity with it.

[0011] In some embodiments, the minimal promoter is a minimal virus promoter or a minimal TATA box promoter.

[0012] In some embodiments, the minimum promoter is the minimum CMV promoter, preferably comprising the sequence of SEQ ID NO: 16 or a sequence having at least 90% sequence identity with it.

[0013] In some embodiments, the minimum TATA box promoter is an E1F TATA box promoter, which preferably contains the sequence of SEQ ID NO: 17 or a sequence having at least 90% sequence identity with it.

[0014] In some embodiments, the expression cassette further includes one or more antioxidant reactive elements.

[0015] In some embodiments, the antioxidant reactive element is derived from NQO1 or GCLM.

[0016] In some embodiments, the antioxidant reactive element comprises the sequence of SEQ ID NO: 8 or a sequence having at least 90% sequence identity with it, or the antioxidant reactive element comprises the sequence of SEQ ID NO: 10 or a sequence having at least 90% sequence identity with it.

[0017] In some embodiments, the expression box further includes one or more enhancers.

[0018] In some embodiments, the enhancer is an SV40 enhancer, preferably comprising the sequence of SEQ ID NO: 12 or a sequence having at least 90% sequence identity with it.

[0019] In some embodiments, the coding sequence encodes a protein that, once expressed by a cell, can induce cell death.

[0020] In some embodiments, the protein is selected from the group consisting of cytotoxins, tumor-associated antigens, tumor-specific antigens, cytokines, membrane permeators, checkpoint proteins, and antibodies.

[0021] In some embodiments, the protein is neutrophil elastase, diphtheria toxin, IL-2, or granzyme B.

[0022] In some embodiments, when the expression cassette is introduced into non-tumor cells, the expression cassette is not expressed in the non-tumor cells, or is expressed at a level lower than that in tumor cells.

[0023] On the other hand, this disclosure provides nucleic acid molecules containing expression cassettes.

[0024] On the other hand, this disclosure provides a vector containing an expression cassette or nucleic acid molecule.

[0025] In some embodiments, the vector is a viral vector, such as a lentiviral vector, a retroviral vector, an adeno-associated virus (AAV) vector, or an adenovirus vector.

[0026] In another aspect, this disclosure provides a composition comprising 1) Nucleic acid molecules or vectors; and 2) Pharmaceutically acceptable carriers and / or delivery agents.

[0027] In some embodiments, the delivery agent is a biodegradable polymer, preferably in vivo jetPEI (polyethyleneimine), hyperbranched poly(β-amino ester) (HPAE), lipid nanoparticles (LNP), liposomes, or exosomes.

[0028] In some embodiments, the composition further comprises one or more anticancer agents.

[0029] On the other hand, this disclosure provides the use of expression cassettes, nucleic acid molecules, or vectors in the manufacture of drugs for the treatment of cancer.

[0030] On the other hand, this disclosure provides a method for treating cancer, which includes administering a therapeutically effective amount of a nucleic acid molecule, carrier, or composition to a subject in need.

[0031] In some embodiments, the cancer is a solid tumor, preferably breast cancer, endometrial cancer, ovarian cancer, cervical cancer, lung cancer, gastric cancer, esophageal cancer, colorectal cancer, anal cancer, urothelial carcinoma, pancreatic cancer, salivary gland cancer, melanoma, skin cancer, head and neck cancer, sarcoma, or brain cancer.

[0032] In some embodiments, the cancer is a hematologic malignancy, preferably multiple myeloma (MM), lymphoma, chronic lymphocytic leukemia (CLL), B-cell acute lymphoblastic leukemia (B-ALL), or acute myeloid leukemia (AML), diffuse large B-cell lymphoma (DLBCL), non-Hodgkin lymphoma (NHL), extranodal NK / T-cell lymphoma (ENKL), Hodgkin lymphoma (HL), plasmablastic lymphoma, Burkitt lymphoma, marginal zone lymphoma (MZL), or mantle cell lymphoma (MCL). Attached Figure Description

[0033] Figure 1 The structure of tumor-specific regulatory elements is illustrated schematically. In each insert, the upper subplot depicts the vector name / ID and its components; the lower subplot depicts a simplified map of the individual regulatory elements.

[0034] Figure 2 The relative transcriptional activity of vectors containing hTERT and related heterozygous promoters in HEK293 cells was shown. Vectors containing hTERT elements exhibited stronger transcriptional activity in HEK293 cells than vectors containing tissue-specific elements.

[0035] Figure 3 A-3B shows the relative transcriptional activity of vectors containing hTERT and related heterozygous promoters in MC38 cells (A) or HCT116 cells (B). Vectors containing the ARE-hTERT heterozygous promoter exhibited transcriptional activity comparable to that of the strong CMV promoter.

[0036] Figure 4 A-4C shows the relative transcriptional activity of vectors containing tumor-specific promoters in A375 cells (A), G361 cells (B), or G361 cells (C). Vectors containing the ARE-hTERT heterozygous promoter exhibited transcriptional activity comparable to the strong CMV promoter. In contrast, vectors containing tumor-specific promoters used in clinical trials showed weak transcriptional activity, significantly lower than that of the ARE-hTERT promoter.

[0037] Figure 5 The relative transcriptional activity of vectors containing tumor-specific promoters in Pan02 cells was shown. Vectors containing the ARE-hTERT heterozygous promoter exhibited transcriptional activity comparable to the strong CMV promoter. In contrast, vectors containing the tumor-specific promoter used in clinical trials showed weak transcriptional activity, significantly lower than that of the ARE-hTERT promoter.

[0038] Figure 6 A-6D shows the relative transcriptional activity of vectors containing tumor-specific promoters in Bel 7402 cells (A, C) or HepG2 cells (B, D). Vectors containing the ARE-hTERT heterozygous promoter exhibited transcriptional activity comparable to the strong CMV promoter. In contrast, vectors containing tumor-specific promoters used in clinical trials showed weak transcriptional activity, significantly lower than that of the ARE-hTERT promoter.

[0039] Figure 7A-7B shows the relative transcriptional activity of vectors containing tumor-specific promoters in HUVEC cells (A) or smooth muscle cells (B). Vectors containing the ARE-hTERT heterozygous promoter showed little or no transcriptional activity in normal human cells. Detailed Implementation

[0040] Unless explicitly instructed otherwise, the practice of this invention will employ conventional methods of virology, immunology, microbiology, molecular biology, and recombinant DNA techniques within the scope of the art, many of which are described below for illustrative purposes. Such techniques are well explained in the literature. See, for example, Current Protocols in Molecular Biology or Current Protocols in Immunology, John Wiley & Sons, New York, NY (2009); Ausubel et al., Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons, 1995; Sambrook and Russell, Molecular Cloning: A Laboratory Manual (3rd ed., 2001); Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); DNA Cloning: A Practical Approach, Volumes I and II (edited by D. Glover); Oligonucleotide Synthesis (edited by N. Gait, 1984); Nucleic Acid Hybridization (edited by B. Hames & S. Higgins, 1985); Transcription and Translation (edited by B. Hames & S. Higgins, 1984); Animal Cell Culture (edited by R. Freshney, (1986); Perbal, A Practical Guide to Molecular Cloning (1984) and other similar references.

[0041] It must be noted that, unless the context clearly specifies otherwise, the singular forms “a / an” and “the” as used herein and in the appended claims include plural indicators.

[0042] Throughout this specification and the following claims, unless the context otherwise requires, the word “comprise” and variations such as “comprises” and “comprising” shall be understood to imply inclusion of the stated integer or step or group of integers or steps, but not to exclude any other integer or step or group of integers or steps. When used herein, the term “comprise” may be replaced by the terms “containing” or “including”, or sometimes by the term “having”.

[0043] When used herein, "consisting of" excludes any element, step, or component not specified in the elements of the claims. When used herein, "consisting substantially of" does not exclude materials or steps that do not substantially affect the essential and novel features of the claims. Any of the foregoing terms "comprising," "containing," "including," and "having," whenever used herein in the context of aspects or embodiments of this application, may be replaced with the terms "consisting of" or "substantially of" to change the scope of this disclosure.

[0044] As used herein, the connecting term “and / or” between multiple listed elements should be understood to encompass both individual and combined options. For example, when two elements are connected by “and / or”, the first option refers to the applicability of the first element in the absence of the second element. The second option refers to the applicability of the second element in the absence of the first element. The third option refers to the applicability of the first and second elements together. Any one of these options should be understood to fall within this meaning and thus satisfy the requirement of the term “and / or” as used herein. The simultaneous applicability of more than one of these options should also be understood to fall within this meaning and thus satisfy the requirement of the term “and / or”.

[0045] Unless otherwise stated, any numerical value (such as concentrations or concentration ranges as described herein) should be understood to be modified by the term “about” in all cases. Therefore, numerical values ​​generally include ±10% of the listed values. For example, a concentration of 1 mg / mL includes 0.9 mg / mL to 1.1 mg / mL. Similarly, a concentration range of 1 mg / mL to 10 mg / mL includes 0.9 mg / mL to 11 mg / mL. As used herein, the use of numerical ranges explicitly includes all possible subranges, all individual numerical values ​​within that range, including integers and fractions of values ​​within such ranges, unless the context clearly indicates otherwise.

[0046] The term "expression cassette" or "gene expression cassette" refers to a DNA sequence capable of guiding the expression of a specific nucleotide sequence in a suitable host cell. It contains a promoter operatively linked to the target nucleotide sequence, which in turn is operatively linked to a termination signal. It typically also contains the sequence required for the correct translation of the nucleotide sequence. The coding region typically encodes the target protein, but may also encode a target functional RNA, such as antisense RNA or untranslated RNA, in either the sense or antisense direction. Expression cassettes containing the target nucleotide sequence can be chimeric, meaning that at least one of its components is heterologous relative to at least one of its other components. Expression cassettes can also be naturally occurring but obtained in a recombinant form suitable for heterologous expression. Expression of the nucleotide sequence in the expression cassette can be controlled by either a constitutive or inducible promoter sequence, which initiates transcription only when the host cell is exposed to certain specific external stimuli. For multicellular organisms, the promoter may also be tissue- or organ- or developmental stage-specific. Generally, a gene expression cassette for expressing a target protein contains at least a promoter sequence, a coding sequence (CDS) of the target protein, and a poly-A addition sequence.

[0047] The term "promoter" or "promoter sequence" is a DNA sequence that RNA polymerase recognizes, binds to, and initiates transcription. Generally, promoters contain conserved sequences required for RNA polymerase binding and transcription initiation. Most promoters are located upstream of the transcription start site and are not transcribed themselves. Examples of promoters include, but are not limited to, the CMV, EF1A, CAG, CBh, and SFFV promoters.

[0048] The term "chimeric promoter" (also known as a "composite promoter" or "hybrid promoter") refers to a promoter comprising at least two parts derived from different natural or synthetic promoters. These two parts are not naturally adjacent to each other within a nucleic acid molecule. In some embodiments of the invention, the chimeric promoter comprises at least a first sequence derived from a tissue-selective promoter sequence or a tumor-selective promoter sequence, and a second sequence derived from a minimal promoter. Tumor-selective promoter sequences are defined herein as promoter sequences capable of driving gene transcription in tumor cells while remaining substantially "silent" or expressed at low or relatively low levels in other tissue types. For example, tumor-selective promoter sequences may be hTR promoter sequences, hTERT promoter sequences, CEA promoter sequences, PSA promoter sequences, probasin-inducible prostate cell promoter sequences, ARR2PB promoter sequences, or AFP promoter sequences. Telomerase is a ribonucleoprotein complex responsible for the complete replication of chromosome ends. Numerous studies have shown that most malignant tumors express telomerase activity, while most normal cells do not. Three major components associated with human telomerase activity have been identified: (a) the RNA component (hTER); (b) the telomerase-associated protein (hTEP1); and (c) the telomerase catalytic unit or human telomerase reverse transcriptase (hTERT). However, only hTER and hTERT are essential for the in vitro reconstitution of telomerase activity, thus representing the minimal catalytic core of human telomerase. The promoter region of hTERT has been previously cloned and characterized. Telomerase-specific expression of cytotoxic or pro-apoptotic genes (such as diphtheria toxin A chain, FADD, caspase, and Bax) via the hTERT promoter has been achieved and reported in various gene transfer systems, such as plasmids and adenoviruses. However, as with most other intrinsic mammalian promoters, the transcriptional facilitation strength of the hTERT promoter is generally much weaker than that of commonly used viral promoters (such as the CMV promoter and the SV40 early promoter). Therefore, its use in gene therapy is hampered by the problem of low transgenic expression. The inventors of this invention have developed novel chimeric promoters composed of an hTERT promoter sequence fused with a minimal promoter sequence. In some embodiments of the invention, the hTERT promoter sequence comprises any one of the sequences SEQ ID NO: 1-7. In particular embodiments, the hTERT promoter sequence comprises the sequence SEQ ID NO: 1. As used herein, a “minimal promoter sequence” refers to a portion of a promoter that contains a nucleotide sequence that maintains the ability to bind and localize transactivators or components of the transcription complex to a specific location in a nucleic acid (e.g., a DNA molecule). A promoter element (particularly a TATA element or analogue) that is inactive or has significantly reduced promoter activity in the absence of upstream activation is referred to as a minimal promoter.In the presence of suitable transcription factors, the minimal promoter functions to allow transcription. Therefore, the minimal promoter consists only of all the basic elements required for transcription initiation (e.g., the TATA box and / or the initiator). Any minimal promoter sequence known to those skilled in the art is considered to be included in the promoter sequences of this invention. For example, the minimal promoter sequence may be a minimal viral promoter, such as an adenovirus promoter sequence, a baculovirus promoter sequence, a CMV promoter sequence, a parvovirus promoter sequence, a herpesvirus promoter sequence, a poxvirus promoter sequence, an adeno-associated virus promoter sequence, a semiliki forest virus promoter sequence, an SV40 promoter sequence, a vacciniavirus promoter sequence, or a retrovirus promoter sequence. In some embodiments, the minimal promoter sequence is derived from a CMV promoter sequence and is therefore referred to herein as the "CMVmini promoter". In some embodiments, the CMVmini promoter comprises the sequence of SEQ ID NO: 16. Therefore, in some embodiments, the chimeric promoter comprises an hTERT promoter sequence of any one of the sequences of SEQ ID NO: 1-7, operably coupled to the CMVmini promoter of the sequence of SEQ ID NO: 16. In some embodiments, the minimal promoter sequence is a minimal TATA box promoter. As used herein, "minimal TATA box promoter" refers to the TATA region of the promoter, excluding other cis-acting elements. In some embodiments, the minimal TATA box promoter is an E1F TATA box promoter. In some embodiments, the E1F TATA box promoter comprises the sequence of SEQ ID NO: 17. Therefore, in some embodiments, the chimeric promoter comprises an hTERT promoter sequence of any one of the sequences of SEQ ID NO: 1-7, operably coupled to the E1F TATA box promoter of the sequence of SEQ ID NO: 17.

[0049] As used herein, the term "operably linked" refers to the functional association of two or more polynucleotide or nucleic acid sequences. A nucleic acid is "operably linked" when it is in a functional relationship with another nucleic acid sequence. For example, if a promoter or enhancer affects the transcription of a coding sequence, then the promoter or enhancer is operably linked to that coding sequence. Operablely linked means that the linked DNA sequences are typically contiguous, and when it is necessary to link two protein-coding regions, they are contiguous and within the reading frame. However, because enhancers can generally function even when separated from promoters by thousands of bases, and the length of intron sequences can vary, some polynucleotide elements can be operably linked but not contiguous.

[0050] As used herein, “nucleic acid” will generally refer to a molecule (i.e., a chain) of DNA, RNA, or a derivative or analog thereof (containing nucleobases). Any tumor-selective promoter sequences and minimal promoter sequences described above may be incorporated into the nucleic acid sequences of this invention. In certain specific embodiments, the tissue-selective promoter sequence is the hTERT promoter sequence, for example, the sequence shown in SEQ ID NO: 1. Further, in some embodiments, the nucleic acid comprises one or more additional promoter sequences that may or may not be operatively coupled to the tumor-selective promoter sequence.

[0051] The term "coding sequence (CDS)" is a region or nucleic acid sequence that encodes a target protein or RNA (e.g., siRNA). This region or sequence typically begins with a start codon at the 5' end and ends with a stop codon at the 3' end. In some embodiments, the target protein is a cytotoxic (or cell proliferation inhibitory) agent that directly or indirectly stimulates cell death. The cytotoxic agent can be a cytotoxic protein or peptide, or an apoptosis-inducing protein or peptide. The cytotoxic protein or peptide can be a bacterial cytotoxin, such as α-pore-forming toxin (e.g., from *Escherichia coli*). E. coliCytolysin A), β-pore-forming toxins (such as α-hemolysin, PVL-panton Valentine leukocidin, aerolysin, clostridial epoxide, Clostridium perfringens enterotoxin), and binary toxins. (Anthrax toxin, edema toxin, botulinum toxin C2 toxin, Clostridium spiralis toxin, Clostridium perfringens I toxin, Clostridium difficile cell lethal toxin (A and B)), prions, parasporin, cholesterol-dependent cytolysins (e.g., Streptococcus pneumoniae hemolysin), small pore-forming toxins (e.g., bacitracin A), cyanotoxins (e.g., microcystin, nodularin), hemotoxins, neurotoxins (e.g., botulinum toxin), cytotoxins, cholera toxin, diphtheria toxin, Pseudomonas exotoxin A, tetanus toxin or immunotoxins (idarubicin, ricin A, CRM9, Pokeweed antiviral protein, DT). Exemplary apoptosis-inducing proteins or peptides include apoptosis protease activator-1 (Apaf-1), cytochrome c, caspase initiation proteins (CASP2, CASP8, CASP9, CASP10), apoptosis-inducing factor (AIF), p53, p73, p63, Bcl-2, Bax, granzyme B, poly-ADP-ribose polymerase (PARP), and p21-activated kinase 2 (PAK2). The target protein can be any protein that exhibits tumor-suppressive activity (i.e., greater toxicity) against tumor cells compared to non-tumor cells.

[0052] The term "polyadenylation" refers to the covalent bonding of a polyadenylated moiety or its modified variants to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' poly(A) tail is added to the pre-mRNA by the action of an enzyme—polyadenylate polymerase—to a long adenine nucleotide sequence (e.g., 50, 60, 70, 100, 200, 500, 1000, 2000, 3000, 4000, or 5000). In higher eukaryotes, the poly(A) tail is added to transcripts containing a specific sequence (i.e., the polyadenylation signal sequence or "poly(A) sequence") that triggers endonuclease cleavage of the mRNA and the addition of a series of adenosines to the 3' end of the cleaved mRNA. The poly(A) tail and the proteins bound to it help protect the mRNA from degradation by exonucleases. Polyadenylation is also important for transcription termination, mRNA export from the nucleus, and translation. Polyadenylation occurs immediately in the nucleus after DNA is transcribed into RNA, but can also occur later in the cytoplasm. After transcription termination, the mRNA chain is cleaved by an endonuclease complex associated with RNA polymerase. The cleavage site is typically characterized by the presence of the base sequence AAUAAA near the cleavage site. After mRNA cleavage, adenosine residues are added to the free 3' end of the cleavage site. As used herein, the term "poly(A) addition sequence" refers to a sequence downstream of the coding sequence used to add a poly(A) sequence to the RNA transcript. The poly(A) addition sequence can be the poly(A) sequence itself or the polyadenylation signal sequence described above. In some embodiments, the polyadenylation signal sequence is derived from a growth hormone gene-derived polyadenylation signal sequence (e.g., a bovine growth hormone gene-derived polyadenylation signal sequence and a human growth hormone gene-derived polyadenylation signal sequence), an SV40 virus-derived polyadenylation signal sequence, and a human or rabbit β-globin gene-derived polyadenylation signal sequence. In some embodiments, the polyadenylation signal sequence comprises the sequence of SEQ ID NO: . Incorporating the polyA addition sequence into the gene expression cassette can improve transcription efficiency.

[0053] The term "enhancer" refers to a sequence that promotes promoter activity. Enhancers can promote transcription regardless of sequence orientation. The enhancers used in this invention may include one type of enhancer, but multiple enhancers comprising two or more identical enhancers may also be used, or a combination of multiple enhancers that are different from each other may be used. Their order is not particularly limited. For example, CMV enhancers, SV40 enhancers, hTERT (telomerase reverse transcriptase) enhancers, etc., may be used. As an example, hTERT enhancers, SV40 enhancers, and CMV enhancers may be linked in the order described. Enhancers may be arranged downstream of the poly-A addition sequence.

[0054] The term "antioxidant response element (ARE)" refers to a cis-acting enhancer sequence located in the regulatory regions of several antioxidant and detoxification genes. AREs can be activated by redox cycle phenols and electrophiles. Some studies have shown that a protein called nuclear factor erythroid 2-associated factor 2 (Nrf2) is likely the primary transcription factor required for ARE activation, although many other transcription factors also bind to ARE sequences. Upon exposure to toxicity, glutathione depletion, or chemical activation, the transcription factor Nrf2 translocates to the nucleus and dimers with small Maf proteins to form a transactivation complex that binds to AREs. Thus, Nrf2-induced ARE activation coordinates the expression of many genes involved in combating oxidative stress and toxicity in various tissues and cell types. In some embodiments, AREs are derived from the NQO1 gene. In some embodiments, AREs comprise the sequence of SEQ ID NO: 8. In some embodiments, AREs comprise the sequence of SEQ ID NO: 10.

[0055] The term "vector" is intended to refer to a polynucleotide molecule capable of transporting another polynucleotide to which it is linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which an additional DNA fragment can be linked. Another type of vector is a viral vector, in which an additional DNA fragment can be linked into the viral genome. Some vectors are capable of autonomous replication in the host cell to which they are introduced (e.g., bacterial vectors with bacterial origins of replication and attachable mammalian vectors). Other vectors (e.g., non-attached mammalian vectors) can be integrated into the host cell's genome after introduction into the host cell, thereby replicating along with the host genome. Furthermore, some vectors are capable of directing the expression of genes operatively linked to them. Such vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors"). Generally, expression vectors useful in recombinant DNA technology are typically in plasmid form. In this specification, "plasmid" and "vector" are used interchangeably because plasmids are the most commonly used form of vector. However, this disclosure is intended to include other forms of expression vectors, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses), which perform equivalent functions.

[0056] As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes both prenatal and postnatal forms. In many embodiments, the subject is a human. A subject can be a patient, which is a person seeking diagnosis or treatment for a disease from a healthcare provider. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may have or be susceptible to a disease or condition, but may or may not exhibit symptoms of that disease or condition.

[0057] As used herein, the phrase “pharmaceutically acceptable carrier” refers to a pharmaceutically acceptable material, composition, or medium, such as a liquid or solid filler, diluent, carrier, manufacturing aid (e.g., lubricant, magnesium talc, calcium stearate, or zinc or stearic acid), solvent, or encapsulation material, that carries or transports a therapeutic compound intended for administration to a subject. Each excipient should be “acceptable” in the sense that it is compatible with the other components of the formulation and does not harm the subject.

[0058] As used herein, the term "delivery agent" refers to a transporter carrying a therapeutic agent (e.g., the nucleic acid molecule or carrier of the present invention), whether the transporter is attached to some element on the surface of the therapeutic agent, directly attached to the surface of the therapeutic agent, embedded in the surface of the therapeutic agent, or partially or completely contained within the surface of the therapeutic agent, or located inside the therapeutic agent. Non-limiting examples of delivery agents that may be used include lipids, liposomes, cationic lipid complexes, lipid nanoparticles, microspheres, nanospheres, microcapsules, nanocapsules, peptides, proteins, cells, nanoparticle mimics, nanotubes, microclusters, or polymer compounds (e.g., polyglycolic acid, polylactic acid, hyaluronic acid, modified polysaccharides, chitosan, cellulose, dextran, polyurethane, polyacrylic acid, pseudopoly(amino acids), polyhydroxybutyrate-related copolymers, polyanhydride, polymethyl methacrylate, poly(ethylene oxide)). Preferably, the delivery agent is a biodegradable polymer, such as in vivo jetPEI (polyethyleneimine), hyperbranched poly(β-amino ester) (HPAE), lipid nanoparticles (LNP), liposomes, or exosomes.

[0059] As used herein, the term "effective amount" refers to an amount of agent or combination of agents sufficient to treat a specified condition, symptom, or disease, such as improving, alleviating, reducing, and / or delaying one or more of its symptoms. In the context of cancer, an effective amount includes an amount sufficient to shrink a tumor and / or reduce its growth rate (e.g., inhibit tumor growth) or prevent or delay other unwanted cell proliferation. In some embodiments, an effective amount is an amount sufficient to delay development. In some embodiments, an effective amount is an amount sufficient to prevent or delay recurrence. An effective amount may be administered in one or more doses. An effective amount of a drug or composition may: (i) reduce the number of cancer cells; (ii) reduce tumor size; (iii) inhibit, delay, slow, and preferably terminate the infiltration of cancer cells into surrounding organs to a certain extent; (iv) inhibit (i.e., slow, and preferably terminate) tumor metastasis; (v) inhibit tumor growth; (vi) prevent or delay the occurrence and / or recurrence of tumors; and / or (vii) alleviate one or more symptoms associated with cancer to a certain extent.

[0060] As used herein, “treatment” is a method for achieving a beneficial or desired outcome (including clinical outcomes). For the purposes of this invention, beneficial or desired clinical outcomes include, but are not limited to, one or more of the following: relieving one or more symptoms caused by a disease; reducing the severity of the disease; stabilizing the disease (e.g., preventing or delaying the worsening of the disease); preventing or delaying the spread of the disease (e.g., metastasis); preventing or delaying the recurrence of the disease; delaying or slowing the progression of the disease; improving the disease state; providing partial or complete remission of the disease; reducing the dosage of one or more other medications required to treat the disease; delaying the progression of the disease; increasing quality of life and / or prolonging survival. “Treatment” also encompasses reducing the pathological outcomes of the disease. The methods of this invention are contemplated in relation to any one or more of these treatment aspects.

[0061] The "percentage of amino acid sequence identity (%)", "homology", or "homology to" for peptide, polypeptide, or antibody sequences is defined as the percentage of amino acid residues in a candidate sequence that are identical to amino acid residues in a specific peptide or polypeptide sequence, after alignment and, where necessary, the introduction of vacancies to achieve the maximum percentage of sequence identity, without considering any conserved substitutions as part of sequence identity. For the purpose of determining the percentage of amino acid sequence identity, alignment can be performed in various ways as is known in the art, such as using publicly available computer software like BLAST, BLAST-2, ALIGN, or MEGALIGN™ (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms required to achieve maximum alignment across the full length of the sequences being compared.

[0062] This invention provides a genetic engineering strategy for achieving novel heterozygous promoters with cancer cell selectivity. These heterozygous promoters can be used in gene therapy to treat a variety of cancer types. These novel heterozygous promoters are based on combinations of one or more antioxidant response enhancers / elements (AREs) operatively linked to engineered human telomerase reverse transcriptase and other tumor-specific core promoters. Studies have shown that when the heterozygous promoter contains an ARE element and an enhancer element following the poly(A) sequence, transgene expression is significantly increased in a variety of cancer cells. Cytotoxins driven by the ARE-hTERT promoter efficiently kill cancer cells and exhibit good safety in primary normal cells.

[0063] One aspect of the present invention relates to nucleic acid molecules comprising one or more antioxidant response enhancers linked to hTERT or other tumor-specific promoters.

[0064] To achieve both excellent transcriptional efficiency and specificity in cancer cells, we integrated the hTERT promoter, antioxidant response elements from NQO1 or GCLM, and the SV40 enhancer to generate expression cassettes or expression constructs. The preferred hTERT promoter is a 243 bp nucleotide fragment (-190...53 bp, with the transcript start site as 0) cloned from the 5' flanking region of the hTERT gene and a portion of the transcript sequence. We proposed an antioxidant response cis-element to amplify the transcriptional activity of the hTERT promoter, generating sufficient mRNA to achieve anticancer efficacy.

[0065] The nucleotide sequence of the hTERT promoter is shown in SEQ ID NO: 1: GCACAGACGCCCAGGACCGCGCTCCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCAGGCAGCGCTGCGTCCTGCTGCGCACGTGGGA (SEQ ID NO: 1, hereinafter referred to as the "hTERT core promoter"). In another embodiment, the hTERT sequence is a homology of SEQ ID NO: 1. In another embodiment, the hTERT sequence is a variant of SEQ ID NO: 1. In another embodiment, the hTERT sequence is a fragment of SEQ ID NO: 1. In another embodiment, the hTERT sequence is a homology of a fragment of SEQ ID NO: 1. In another embodiment, the hTERT sequence is a variant of a fragment of SEQ ID NO: 1. Various possibilities represent individual embodiments of the invention. In another embodiment, the hTERT sequence is at least 60% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 65% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 70% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 72% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 74% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 76% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 78% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 80% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 82% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 84% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 88% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 94% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 96% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 98% homologous to SEQ ID NO: 1. In another embodiment, the hTERT sequence is at least 99% homologous to SEQ ID NO: 1.In another embodiment, the hTERT sequence is at least 60%, 65%, 70%, 72%, 74%, 76%, 78%, 80%, 82%, 84%, 88%, 94%, 96%, 98%, or 99% homologous to any one of SEQ ID NO: 2-7.

[0066] The nucleotide sequence of the ARE cis element from NQO1 (hereinafter referred to as "ARE1") is shown in SEQ ID NO: 8: GATCCAGTCACAGTGACTCAGCAGAATCTG (SEQ ID NO: 8). In another embodiment, the ARE1 sequence is a homolog of SEQ ID NO: 8. In another embodiment, the ARE1 sequence is a variant of SEQ ID NO: 8. In another embodiment, the ARE1 sequence is a fragment of SEQ ID NO: 8. In another embodiment, the ARE1 sequence is a homolog of a fragment of SEQ ID NO: 8. In another embodiment, the ARE1 sequence is a variant of a fragment of SEQ ID NO: 8. Various possibilities represent separate embodiments of the invention. In another embodiment, ARE1 is at least 60% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 65% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 70% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 72% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 74% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 76% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 78% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 80% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 82% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 84% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 88% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 94% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 96% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 98% homologous to SEQ ID NO: 8. In another embodiment, ARE1 is at least 99% homologous to SEQ ID NO: 8. In another embodiment, the ARE1 sequence is at least 60%, 65%, 70%, 72%, 74%, 76%, 78%, 80%, 82%, 84%, 88%, 94%, 96%, 98%, or 99% homologous to SEQ ID NO: 9. In another embodiment, the ARE1 sequence comprises the sequence TCCAGTCA (ARE1-a).

[0067] The nucleotide sequence of the ARE cis element (hereinafter referred to as ARE2) from GCLM is shown in SEQ ID NO: 10.

[0068] CCGCGGGATGAGTAACGGTTACGAAGCACTTTCTCGGCTACGATTTCTGCTTAGTCATTGTCT (SEQ ID NO: 10). In another embodiment, the ARE2 sequence is a homolog of SEQ ID NO: 10. In another embodiment, the ARE2 sequence is a variant of SEQ ID NO: 10. In another embodiment, the ARE2 sequence is a fragment of SEQ ID NO: 10. In another embodiment, the ARE2 sequence is a fragment homolog of SEQ ID NO: 10. In another embodiment, the ARE2 sequence is a fragment variant of SEQ ID NO: 10. Various possibilities represent individual embodiments of the invention. In another embodiment, ARE2 is at least 60% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 65% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 70% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 72% homologous to SEQ ID NO: 01. In another embodiment, ARE2 is at least 74% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 76% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 78% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 80% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 82% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 84% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 88% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 94% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 96% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 98% homologous to SEQ ID NO: 10. In another embodiment, ARE2 is at least 99% homologous to SEQ ID NO: 10. In another embodiment, the ARE2 sequence is at least 60%, 65%, 70%, 72%, 74%, 76%, 78%, 80%, 82%, 84%, 88%, 94%, 96%, 98%, or 99% homologous to SEQ ID NO: 11 (ARE2-b). In another embodiment, the ARE1 sequence comprises the sequence TTAGTCA (ARE2-a) or TGAGTAA (ARE2-c).

[0069] The nucleotide sequence of the SV40 enhancer element (following the poly(A) sequence or polyadenylation signal sequence) is shown in SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is a homolog of SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is a variant of SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is a fragment of SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is a homolog of a fragment of SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is a variant of a fragment of SEQ ID NO: 12. Various possibilities represent separate embodiments of the invention. In another embodiment, the SV40 enhancer sequence is at least 60% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 65% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 70% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 72% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 74% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 76% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 78% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 80% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 82% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 84% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 88% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 94% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 96% homologous to SEQ ID NO: 12. In another embodiment, the SV40 enhancer sequence is at least 98% homologous to SEQ ID NO: 12. In yet another embodiment, the SV40 enhancer sequence is at least 99% homologous to SEQ ID NO: 12.

[0070] The nucleotide sequence of the SCGB2A2 enhancer element cloned from the 5' flanking regulatory region of the SCGB2A2 gene is shown in SEQ ID NO: 13:

[0071] The nucleotide sequence of the SCGB2A2 core promoter cloned from the SCGB2A2 promoter is shown in SEQ ID NO: 14: CTAGGCCCACTGCTGGGATAAGCTGGCACAGATACACGGGACATGATGCTTTCATTCTCACCTTAAAGAAAGAGACAGAGAAGAAAAGGAAGGGGAGCAAGTGGAGAAGGAATACAAGAAAGAGGAAGAGAAGCAGGAAGATTCTACATACAGGCTGGCTGTGTTTCCCCTGGGGCATGCTCCTGTTTACTGGTCCCATGCCAGGTTGACTCATTGCCTCGTTCATGGGTGGAATTAAGATGCCTACCTGGGGAATAAATAGAGCAAGGCTGGGTGCTCA (SEQ ID NO: 14). In another embodiment, the SCGB2A2 promoter sequence is a homology of SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is a variant of SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is a fragment of SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is a homolog of the fragment of SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is a variant of the fragment of SEQ ID NO: 14. Various possibilities represent separate embodiments of the invention. In another embodiment, the SCGB2A2 promoter sequence is at least 60% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 65% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 70% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 72% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 74% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 76% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 78% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 80% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 82% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 84% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 88% homologous to SEQ ID NO: 14.In another embodiment, the SCGB2A2 promoter sequence is at least 94% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 96% homologous to SEQ ID NO: 14. In another embodiment, the SCGB2A2 promoter sequence is at least 98% homologous to SEQ ID NO: 14. In yet another embodiment, the SCGB2A2 promoter sequence is at least 99% homologous to SEQ ID NO: 14.

[0072] The nucleotide sequence of the hCCRK promoter cloned from the hCCRK promoter is shown in SEQ ID NO: 15: ACCCAGGTACCTATGTTCAAAAGTGCCTCAATCCTAGTTAACAAGGGCAGAGACCACGAGAAACAACACTGTGTTTAGTAGCAACTTAACAACCAGCCAGCAGTTCTGTCCACACACACACCACCGGGCATGGTTCCAAAGCTAAAAAGGCACTAATTGCTTTTCTATAAGGAGGTAGAACACAGTCCCTCCGTGTTCTTTAGGCCTGATGGTCTGCATTATCGGATCTGTTACCGTGTTAATTGTTCCTGTCTCACACAGCCGGTTTGGGCTTTCTTCTGCATATGTCTGGGATGGTGACGGGTTCCTATATAGAGGAGTACTGGGGAAGCCTCTGTGTGTGTGTGTG TGTCCGTGCATATGTACACATGTGTGTAAAAAGCAGCCACACGCTGAGAATGGTTAACGGGTAGCCAGGCTGTCTGTACTCAGGGCCCTAAGACTGGCCCAGGAAAGGGCCGGGGGAGGTGGGGCGGGGTGAAGGTGGAGCGGGCTTGGCTTGTGCTCACTGCCTTTTCCACAACAG GAGTACAAATGCTGGAGTGAGTGAGGTGAACTCAAGTCGCCTTTAGGAATGGCTGAAAAAGCCCACACCTGGAAATCACTCCCTCCCTGCTCCTCCACGGCAGGTTGCATCTGCGAGACGCTTCGGTCATTAGAGGAATGAGCCGGGAGTGAGCAATTCACCAGCTCTCCAGCACTTG GTGGAAAGCAGCAGGCAACC (SEQ ID NO: 15). In another embodiment, the hCCRK promoter sequence is a homolog of SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is a variant of SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is a fragment of SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is a homology of a fragment of SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is a variant of a fragment of SEQ ID NO: 15. These various possibilities represent separate embodiments of the invention.In another embodiment, the hCCRK promoter sequence is at least 60% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 65% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 70% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 72% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 74% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 76% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 78% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 80% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 82% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 84% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 88% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 94% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 96% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 98% homologous to SEQ ID NO: 15. In another embodiment, the hCCRK promoter sequence is at least 99% homologous to SEQ ID NO: 15.

[0073] The nucleotide sequence of the CMV mini promoter is shown in SEQ ID NO: 16: GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGCATTCGAGCTCGGTACCCGG (SEQ ID NO: 16). In another embodiment, the CMV mini promoter sequence is a homolog of SEQ ID NO: 16. In another embodiment, the CMV mini promoter sequence is a variant of SEQ ID NO: 16. In another embodiment, the CMV mini promoter sequence is a fragment of SEQ ID NO: 16. In another embodiment, the CMV mini promoter sequence is a homolog of a fragment of SEQ ID NO: 16. In another embodiment, the CMV mini promoter sequence is a variant of a fragment of SEQ ID NO: 16. These various possibilities represent separate embodiments of the invention. In another embodiment, the CMVmini promoter sequence is at least 60% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 65% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 70% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 72% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 74% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 76% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 78% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 80% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 82% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 84% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 88% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 94% homologous to SEQ ID NO: 16. In yet another embodiment, the CMVmini promoter sequence is at least 96% homologous to SEQ ID NO: 16.In another embodiment, the CMVmini promoter sequence is at least 98% homologous to SEQ ID NO: 16. In another embodiment, the CMVmini promoter sequence is at least 99% homologous to SEQ ID NO: 16.

[0074] The nucleotide sequence of an H19 814 promoter is referenced in patent US_9173964_B2; the nucleotide sequences of other tumor-specific elements (including TYR, TRP1, and AFP) are referenced in in vivo gene product literature.

[0075] In some embodiments, the expression cassette from 5' to 3' includes an SV40 enhancer, an hTERT promoter, a CMVmini promoter, a CDS sequence, and an SV40 poly-A addition sequence. Figure 1 (CG010201). In some embodiments, the SV40-hTERT-CMVmini region of the expression cassette contains the sequence of SEQ ID NO: 18 or a sequence having at least 90% sequence identity with it.

[0076] In some embodiments, the expression cassette from 5' to 3' contains the hTERT promoter, the CMVmini promoter, the CDS sequence, and the SV40 polyA addition sequence. Figure 1 (CG010301). In some embodiments, the hTERT-CMVmini region of the expression cassette contains the sequence of SEQ ID NO: 19 or a sequence having at least 90% sequence identity with it.

[0077] In some embodiments, the expression cassette from 5' to 3' includes the hTERT promoter, the E1F TATA promoter, the CDS sequence, the SV40 polyA addition sequence, and the SV40 enhancer. Figure 1 (CG010401). In some embodiments, the hTERT-E1FTATA region of the expression cassette contains the sequence of SEQ ID NO: 20 or a sequence having at least 90% sequence identity with it.

[0078] In some embodiments, the expression cassette from 5' to 3' includes the ARE1 sequence, the hTERT promoter, the CMVmini promoter, the CDS sequence, the SV40 poly-A addition sequence, and the SV40 enhancer. Figure 1 (CG010501). In some embodiments, the ARE1-hTERT-CMVmini region of the expression cassette contains the sequence of SEQ ID NO: 21 or a sequence having at least 90% sequence identity with it.

[0079] In some embodiments, the expression cassette from 5' to 3' includes the ARE2 sequence, the hTERT promoter, the CMVmini promoter, the CDS sequence, the SV40 poly-A addition sequence, and the SV40 enhancer. Figure 1 (CG010601). In some embodiments, the ARE2-hTERT-CMVmini region of the expression cassette contains the sequence of SEQ ID NO: 22 or a sequence having at least 90% sequence identity with it.

[0080] The expression box of the present invention may contain one or more ARE cis elements (ARE1 or ARE2), such as 1, 2, 3 or more ARE1 sequences, which may be directly connected or spaced apart by one or more short connectors.

[0081] The CDS sequence of any one of the expression cassettes of the present invention can encode any gene product that can be used as a cytotoxic (or cell proliferation inhibitor) agent against tumor cells. Gene products include, but are not limited to: cytotoxins such as DTA, tk-HSV, GZMA, GZMB, precursor and cleaved caspases 1, 3, 8 and 11, Bcl-2, FADD and their variants; membrane permeators such as perforin, GSDMA, GSDMB, GSDMD, GSDME and related proteins and N-terminal or active mutant variants in various species, MLKL and its variants; siRNAs targeting, for example, EGFR, HER2, Kras, c-Myc, hTERT, IGFR, AKT1, AKT2, AKT3, mTOR, cAMPK, YAP, NRF2, ESCRT subunits or NQO1; intracellular and membrane weight... Histones, such as p53 and its mutant variants, MDM2 / 4 and its mutant variants, p21, PTEN, NOTCH1, NOTCH2, NOTCH3, NOTCH4, CD44, DR3, CD40L, CD83; antibodies targeting, for example, PD-1, PD-L1, VEGF, CTLA-4, CD40, 4-1BB, CD80, CD83, CD86, CD3, CXCR4, CXCL1, HSP, HMGB1, IL-1β, TGF-β, FAP, CLDN18.2, CD47, CD16, TIGIT, CD28; cytokines, such as IFN-γ, IL-2, IL-12, p40, p35, p70, IL-18, IL-1 α and β, IL4, IL13, GM-CSF. When introduced into a subject, the CDS sequence in the expression cassette of the present invention is expressed only in tumors or cancer cells, or at a level in tumors or cancer cells that is much higher than the level in normal cells.

[0082] In the expression cassette of the present invention, the site where the CDS sequence or target gene is to be inserted can serve as a multiple cloning site. In this case, the target gene can be inserted into the multiple cloning site (insertion site) using a sequence recognized by a restriction endonuclease. The present invention also covers gene expression cassettes that do not contain the DNA of the target gene itself, but contain a portion thereon to which DNA will be inserted as a multiple cloning site as described above.

[0083] The expression cassette of the present invention can be used by incorporating it into a gene expression vector. The present invention also covers vectors containing the gene expression cassette of the present invention.

[0084] Examples of vectors into which the gene expression cassette of the present invention is inserted include: plasmids; viral vectors, such as adenovirus (Ad) vectors, adeno-associated virus (AAV) vectors, lentiviral vectors, retroviral vectors, herpesvirus vectors, and Sendai virus vectors; and non-viral vectors, such as biodegradable polymers. Vectors in which the gene expression cassette has been introduced can be introduced into cells by known methods (such as infection or electroporation). Further, commercially available vectors can be modified to include the expression cassette of the present invention. Further, the present invention also covers viral vectors containing the expression cassette of the aforementioned target gene. In viral vectors, for example, Ad vectors and AAV vectors each enable specific diagnosis or treatment of diseases (such as cancer), but the gene expression cassette of the present invention enables stable and continuous expression of genes, and therefore these viral vectors can be used appropriately according to the application desired for gene expression. Viral vectors can be generated by inserting the expression cassette of the aforementioned target gene into a viral genome that can be used as a vector.

[0085] In some embodiments, the present invention relates to formulations of one or more gene expression cassettes disclosed herein in pharmaceutically acceptable carriers or in association with delivery agents for administration, alone or in combination with one or more other therapeutic modalities, to cells or animals. Therefore, compositions comprising: 1) one or more gene expression cassettes and 2) a pharmaceutically acceptable carrier and / or delivery agent are contemplated. In particular, the present invention contemplates formulations comprising one or more viral vectors, viral particles, or viral particles (or plural forms thereof) comprising one or more of the disclosed gene expression cassettes. In such compositions, it should also be understood that, if desired, the gene expression cassettes disclosed herein or the vectors containing such gene expression cassettes may also be administered in combination with other agents (e.g., peptides, proteins, or polypeptides or multiple pharmaceutically active agents). In fact, there are few limitations on other components that may be included, provided that the additional agents do not cause significant adverse effects upon contact with normal cells or host tissues. Thus, viral vector compositions may be delivered together with a variety of other agents as needed for specific situations. Such compositions may be purified from host cells or other biological sources, or alternatively, may be chemically synthesized as described herein. Similarly, such compositions may further comprise substituted or derivatized RNA, DNA, or PNA compositions. Pharmaceutically acceptable formulations of excipients and carrier solutions are well known to those skilled in the art, as are the specific compositions described herein used to develop suitable dosing and treatment regimens in a variety of therapeutic options, including, for example, oral, topical, sublingual, subcutaneous, transdermal, parenteral, intravenous, intranasal, and intramuscular administration, intratumoral, lymph node administration, and formulations.

[0086] Further embodiments of the present invention generally relate to a method of treating a subject suffering from a hyperproliferative disease, the method comprising: (1) obtaining a pharmaceutical composition comprising a polynucleotide containing any of the gene expression cassettes described above; and (2) administering a pharmaceutically effective amount of the composition to the subject. As described above, the subject can be any subject, such as a mammal. A mammal can be a human, such as a patient suffering from a disease. A disease can be any disease that can affect the subject. In certain specific embodiments, the subject is a human, and the disease is a hyperproliferative disease, such as a tumor or cancer. Cancer can be any cancer, such as breast cancer, lung cancer, prostate cancer, ovarian cancer, brain cancer, liver cancer, cervical cancer, colon cancer, kidney cancer, skin cancer, head and neck cancer, bone cancer, esophageal cancer, bladder cancer, uterine cancer, lymphoma, stomach cancer, pancreatic cancer, testicular cancer, lymphoma, or leukemia. In some embodiments, the subject is receiving a second anticancer therapy. Any second anticancer therapy known to those skilled in the art, such as chemotherapy, surgery, radiation therapy, immunotherapy, or other gene therapy, is considered.

[0087] In another embodiment, the present invention provides a method for treating a tumor in a subject of need, the method comprising administering a gene expression cassette, vector, or pharmaceutical composition of the present invention to the subject, thereby treating the tumor in the subject of need. In another embodiment, the present invention provides a method for inhibiting tumor progression in a subject of need, the method comprising administering a gene expression cassette, vector, or pharmaceutical composition of the present invention to the subject, thereby inhibiting tumor progression in the subject of need. In another embodiment, the present invention provides a method for inhibiting tumor metastasis in a subject of need, the method comprising administering a gene expression cassette, vector, or pharmaceutical composition of the present invention to the subject, thereby inhibiting tumor metastasis in the subject of need.

[0088] In some embodiments, the tumor is, but is not limited to, the following solid tumors: breast cancer, endometrial cancer, ovarian cancer, cervical cancer, lung cancer, gastric cancer, esophageal cancer, colorectal cancer, anal cancer, urothelial carcinoma, pancreatic cancer, salivary gland cancer, melanoma, skin cancer, head and neck cancer, sarcoma, and brain cancer. In some embodiments, the cancer is, but is not limited to, the following hematologic malignancies: multiple myeloma (MM), lymphoma, chronic lymphocytic leukemia (CLL), B-cell acute lymphoblastic leukemia (B-ALL), or acute myeloid leukemia (AML), diffuse large B-cell lymphoma (DLBCL), non-Hodgkin lymphoma (NHL), extranodal NK / T-cell lymphoma (ENKL), Hodgkin lymphoma (HL), plasmablastic lymphoma, Burkitt lymphoma, marginal zone lymphoma (MZL), or mantle cell lymphoma (MCL).

[0089] In some embodiments, cis-elements or expression cassettes are constructed or packaged in a vector. In some embodiments, the vector is a viral vector, such as an adenovirus (Ad) vector, an adeno-associated virus (AAV) vector, a lentiviral vector, a retroviral vector, a herpesvirus vector, or a Sendai virus vector. In another embodiment, the vector is a non-viral vector, such as in vivo jetPEI (polyethyleneimine), hyperbranched poly(β-amino ester) (HPAE), lipid nanoparticles (LNP), liposomes, or exosomes.

[0090] Example Example 1. Expression efficiency driven by the ARE-hTERT promoter in the immortalized HEK293FT cell line. First, considering the crucial role of hTERT in unlimited proliferation and stem cell-like characteristics, transcriptional efficiency, including tumor-specific promoters linked to luciferase (including the hTERT core promoter and hybrid promoters), was tested in vitro in the immortalized cell line HEK293FT. Transcriptional activity was determined by measuring luminescence values ​​24 hours after plasmid transfection with the tumor-specific promoter, following manufacturer (Vazyme, Bio-Lite™ luciferase assay system) recommendations. HEK293FT cells were seeded into each well of a 96-well plate and transfected when 60% to 80% confluence was achieved. Each well used 0.1 μg pDNA loaded with jetPrime in 100 μL jetPRIME buffer. All transient transfections were performed using jetPRIME at 2 x 10⁻⁶ ppm as recommended by the manufacturer (Polyplus). 4 The procedure was performed on HEK293FT cells. Tumor-specific plasmids were constructed via GIBSON recombination by engineering tumor-specific promoters (CG010201, CG010301, CG010401, CG010501, CG010601, CG010801, CG010A01, CG010C01, CG011001, CG011101, CG011201, CG011301, CG010D01, CG010E01, and CG010F01, synthesized and purified by GenScript) and luciferase into the pcDNA3.4 backbone (GenScript). The structure of the control group is described in [reference needed]. Figure 1 In CMV-CDS-poly(A), CG010501 (ARE1-hTERT) and CG010601 (ARE2-hTERT) are able to drive relatively high levels of luciferase ( Figure 2 ).

[0091] Therefore, vectors containing the hTERT heterozygous promoter efficiently drive gene expression in immortalized human cell lines, showing potential for further analysis in cancer cells.

[0092] Example 2. High gene expression efficiency driven by the ARE-hTERT promoter in colorectal cancer cell lines To further investigate expression efficiency in various cancers, hTERT and its derived heterozygous promoter candidates described in Example 1 were tested in vitro on mouse and human colorectal cancer cell lines MC38 and HCT116. The experimental procedures were performed as described in Example 1. As observed in immortalized HEK293T renal epithelial cells, CG010501 (ARE1-hTERT) and CG010601 (ARE2-hTERT) showed superior performance compared to the hTERT single promoter construct in both colorectal cancer cell lines. Figure 3 The expression efficiency of AB, CG010301 and CG101401.

[0093] Therefore, vectors containing the ARE-hTERT heterozygous promoter efficiently drive gene expression in colorectal cancer cell lines and show potential for anti-tumor gene therapy.

[0094] Example 3. High gene expression efficiency driven by the ARE-hTERT promoter in melanoma cell lines To further investigate expression efficiency in various cancers, the aforementioned hTERT and its derived heterozygous promoter candidates were tested in vitro on human melanoma cell lines A375 and G361. The experimental procedures were performed as described above. As observed in the aforementioned cancer cell lines, CG010501 (ARE1-hTERT) and CG010601 (ARE2-hTERT) showed superior performance compared to the hTERT single promoter construct in both melanoma cell lines. Figure 4 AB, CG010301 and CG101401) and melanoma-specific promoters ( Figure 4 The expression efficiency of C, CG011001, CG011101, CG011201 and CG011301.

[0095] Example 4. High gene expression efficiency driven by the ARE-hTERT promoter in pancreatic adenocarcinoma cell lines To further investigate expression efficiency in various cancers, the aforementioned hTERT and its derived heterozygous promoter candidates were tested in vitro on mouse and human pancreatic adenocarcinoma cell lines Pan02. The experimental procedures were performed as described above. As observed in the aforementioned cancer cell lines, CG010601 (ARE2-hTERT) showed higher expression efficiency than both the hTERT single promoter construct and the pancreatic cancer-specific promoter in both pancreatic adenocarcinoma cell lines. Figure 5 The expression efficiency of CG010A01 and CG010C01.

[0096] Therefore, vectors containing the ARE-hTERT heterozygous promoter efficiently drive gene expression in pancreatic adenocarcinoma cell lines and show potential for anti-tumor gene therapy.

[0097] Example 5. High gene expression efficiency driven by the ARE-hTERT promoter in hepatocellular carcinoma cell lines To further investigate expression efficiency in various cancers, the aforementioned hTERT and its derived heterozygous candidates were tested in vitro on mouse and human hepatocellular carcinoma lines Bel7402 and HepG2. The experimental procedures were performed as described above. As observed in the aforementioned cancer cell lines, CG010601 (ARE2-hTERT) showed higher expression efficiency than the hTERT single promoter construct in both hepatocellular carcinoma lines. Figure 6 AB, CG010301 and CG101401) and liver cancer-specific promoters ( Figure 6 The expression efficiency of CD, CG010D01, CG010E01 and CG010F01.

[0098] Therefore, vectors containing the ARE-hTERT heterozygous promoter efficiently drive gene expression in hepatocellular carcinoma cell lines and show potential for anti-tumor gene therapy.

[0099] Example 6. Gene expression driven by hTERT and ARE-hTERT promoters is ineffective or extremely inefficient in various primary cell lines. To investigate the tumor selectivity of heterozygous promoters, hTERT and its derived heterozygous candidates were tested in primary cells. Human umbilical vein endothelial cells and smooth muscle cells were used. The experimental procedures were performed as described above. CG010601 (ARE2-hTERT) exhibited extremely low transcriptional activity in both primary cell lines. Figure 7 AB). In contrast, CG010501 (ARE1-hTERT) showed higher luciferase expression in human smooth muscle cells, but the expression level was still extremely poor (AB). Figure 7 B). These data indicate that the ARE-hTERT heterozygous promoter did not alter the tumor specificity of the single hTERT promoter.

[0100] Therefore, vectors containing the ARE-hTERT heterozygous promoter exhibit excellent tumor selectivity to prevent the target gene from producing undesirable side effects in normal tissues, which means that the ARE-hTERT heterozygous promoter has good safety in clinical applications.

[0101] Example 7. Neutrophil elastase driven by the ARE-hTERT heterozygous promoter exhibits excellent anti-colorectal adenocarcinoma activity. The antitumor therapeutic potential of the heterozygous promoter construct ARE2-hTERT-ELANE relative to the CMV promoter was further tested in vitro by determining its ability to induce apoptosis in mouse and human colorectal adenocarcinoma cell lines. Antitumor activity was determined using cell viability assays (CTG) measuring ATP levels in hepatocytes, followed by transfection of MC38 and HCT116 colorectal adenocarcinoma cell lines with ARE2-hTERT-ELANE, ARE2-hTERT-luci, and CMV-ELANE at concentrations of 1, 2, and 5 μg / ml for 24 hours. ARE2-hTERT-ELANE exhibited comparable cytotoxicity to CMV-ELANE in the MC38 mouse colorectal cancer cell line, while ARE2-hTERT-luci showed no antitumor effect. Similar results were obtained when the experiment was repeated with the human HCT116 colorectal cancer cell line. The results showed that the vector containing the ARE-hTERT heterozygous promoter and expressing neutrophil elastase exhibited a significantly superior ability to induce apoptosis in colorectal adenocarcinoma cell lines.

[0102] Example 8. Diphtheria toxin driven by the ARE-hTERT heterozygous promoter exhibits excellent anti-colorectal adenocarcinoma activity. The anticancer therapeutic potential of the heterozygous promoter construct ARE-hTERT-DTA relative to the CMV promoter was further tested in vitro by determining its ability to lyse mouse and human colorectal adenocarcinoma cell lines (MC38 and HCT116). Antitumor activity was determined using cell lysis assays based on LDH, which measured the activity of released extracellular lactate dehydrogenase. The transfection procedure was largely the same as in Example 7 above, except that the concentration of the transfected plasmid was changed to 0.5 μg / ml. ARE2-hTERT-ELANE exhibited comparable cell lysis capacity to CMV-ELANE in both colorectal cancer cell lines.

[0103] Therefore, vectors containing the ARE-hTERT heterozygous promoter and expressing diphtheria toxin showed a significantly superior ability to induce cell lysis in colorectal adenocarcinoma cell lines.

[0104] Example 9. Diphtheria toxin driven by the ARE-hTERT heterozygous promoter exhibits excellent anti-melanoma activity. The anticancer therapeutic potential of the heterozygous promoter construct ARE-hTERT-DTA relative to the CMV promoter was further tested in vitro by determining its ability to lyse two human colorectal adenocarcinoma cell lines (G361 and A375 melanoma cell lines). Antitumor activity was determined using cell lysis assays using LDH, which measured the activity of released extracellular lactate dehydrogenase. The transfection procedure was primarily based on Example 8. ARE2-hTERT-DTA exhibited comparable cell lysis capacity to CMV-DTA in both colorectal cancer cell lines.

[0105] Therefore, vectors containing the ARE-hTERT heterozygous promoter and expressing diphtheria toxin showed a significantly superior ability to induce cell lysis in melanoma cell lines.

[0106] Example 10. Diphtheria toxin driven by the ARE-hTERT heterozygous promoter exhibits excellent anti-hepatocellular carcinoma activity. The anticancer therapeutic potential of the heterozygous promoter construct ARE-hTERT-DTA relative to the CMV promoter was further tested in vitro by determining its ability to lyse two human colorectal adenocarcinoma cell lines (Bel7042 and HepG2 hepatocellular carcinoma cell lines). Antitumor activity was determined using cell lysis assays using LDH, which measured the activity of released extracellular lactate dehydrogenase. The transfection procedure was primarily based on Example 8. ARE2-hTERT-DTA exhibited comparable cell lysis capacity to CMV-DTA in both hepatocellular carcinoma cell lines.

[0107] Therefore, vectors containing the ARE-hTERT heterozygous promoter and expressing diphtheria toxin showed a significantly superior ability to induce cell lysis in hepatocellular carcinoma cell lines.

[0108] Example 11. Effective expression of interleukin-2 driven by the ARE-hTERT heterozygous promoter in different cancer cells. The anticancer therapeutic potential of the heterozygous promoter construct ARE2-hTERT-hIL-2 relative to the CMV promoter was further tested in vitro by determining its ability to secrete functional recombinant hIL-2 in different cancer cell lines. IL-2 expression levels were determined by ELISA (which measures tagged extracellular recombinant human IL-2). The transfection procedure was largely the same as described above, but the concentration of the IL-2-expressing vector was changed to 5 μg / ml. ARE2-hTERT-IL-2 exhibited comparable IL-2 levels in culture media to CMV-IL-2 in various cancer cell lines. For functional analysis, culture medium from transfected cancer cells was used to proliferate CSFE-labeled isolated CD3 T cells. T cell isolation and CSFE assay procedures were performed according to the manufacturer's protocol. After 48 hours of co-culture, cells were collected for flow cytometry analysis. ARE2-hTERT-hIL-2 showed a similar ability to promote T cell proliferation compared to the CMV-IL-2 group.

[0109] Therefore, vectors containing the ARE-hTERT heterozygous promoter and expressing recombinant human IL-2 have shown remarkable ability to activate T cell immune responses.

[0110] Example 12. Effective expression of antibodies driven by the ARE-hTERT heterozygous promoter in different cancer cells. The anticancer therapeutic potential of the heterozygous promoter construct ARE2-hTERT-αPD1 relative to the CMV promoter was further tested in vitro by determining its ability to secrete functional recombinant hIL-2 in different cancer cell lines. The expression level of αPD1 antibody was determined by ELISA (which measures tagged extracellular recombinant αPD1 antibody). The transfection procedure was primarily based on Example 11. ARE2-hTERT-αPD1 exhibited antibody levels in culture media comparable to CMV-αPD1 in various cancer cell lines. For functional analysis, culture medium from transfected cancer cells was used for the proliferation of CSFE-labeled isolated CD3 T cells. T cell isolation and CSFE assay procedures were performed according to the manufacturer's protocol. After 48 hours of co-culture, cells were collected for flow cytometry analysis. ARE2-hTERT-αPD1 showed a similar ability to promote T cell proliferation compared to the CMV-αPD1 group.

[0111] Therefore, vectors containing the ARE-hTERT heterozygous promoter and expressing recombinant human αPD1 have shown remarkable ability to activate T cell immune responses.

[0112] Example 13. Granulase B driven by the ARE-hTERT heterozygous promoter exhibits excellent anti-hepatocellular carcinoma activity. The anticancer therapeutic potential of the heterozygous promoter construct ARE2-hTERT-GZMB relative to the CMV promoter was further tested in vitro by determining its ability to kill different cancer cell lines. Antitumor activity was determined using cell lysis assays using LDH, which measured the activity of released extracellular lactate dehydrogenase. The transfection procedure was mainly based on Example 7 above. ARE2-hTERT-GZMB exhibited comparable cell lysis to CMV-GZMB in both colorectal cancer cell lines.

[0113] Therefore, vectors containing the ARE-hTERT heterozygous promoter and expressing recombinant human GZMB exhibit significantly superior ability to kill cancer cells.

[0114] Sequences mentioned or used in this invention: hTRET core bootloader: GCACAGACGCCCAGGACCGCGCTCCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCAGGCAGCGCTGCGTCCTGCTGCACGTGGGA (SEQ ID NO: 1) hTERT-a: CCACGTGGCGGAGGGACTGGGGA (SEQ ID NO: 2) hTERT-b: CTCCCGGGTCCCCGGCCCAGCCCCCTCCGGG (SEQ ID NO: 3) hTERT-c: CCCGGGCACCCGTCCTGCCCCTTC (SEQ ID NO: 4) hTERT-d: CCCCGCCCCGTCCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCC (SEQ ID NO: 5) hTERT-e: CGCCCCGTCCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCTCC (SEQ ID NO: 6) hTERT-f: CAGCCCCTCCGGGCCCTCCCAGCCCCTCCCTCCTTTCCGCGGCCCCGC (SEQ ID NO: 7) ARE1 cis-type components from NQO1: GATCCAGTCACAGTGACTCAGCAGAATCTG (SEQ ID NO: 8) ARE1-a: TCCAGTCA ARE1-b: AGCAGAATCTG (SEQ ID NO: 9) ARE2 cis-components from GCLM: CCGCGGGATGAGTAACGGTTACGAAGCACTTTCTCGGCTACGATTTCTGCTTAGTCATTGTCT (SEQ ID NO: 10) ARE2-a: TTAGTCA ARE2-b: TGCTTAGTCAT (SEQ ID NO: 11) ARE2-c: TGAGTAA SV40 Enhanced Sub-element: GATCTGAACCATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGAGCCTGGGGACTTTCCACACCCTAACTG ACACACATTCCAC (SEQ ID NO: 12) SCGB2A2 enhancer: SCGB2A2 core promoter: CTAGGCCCACTGCTGGGATAAGCTGGCACAGATACACGGGACATGATGCTTTCATTCTCACCTTAAAGAAAGAGACAGAGAAGAAAAGGAAGGGGAGCAAGTGGAGAAGGAATACAAGAAAGAGGAAGAGAAGCAGGAAGATTCTACATACAGGCTGGCTGTGTTTCCCCTGGGGCATGCTCCTGTTTACTGGTCCCATGCCAGGTTGACTCATTGCCTCGTTCATGGGTGGAATTAAGATGCCTACCTGGGGAATAAATAGAGCAAGGCTGGGTGCTCA (SEQ ID NO: 14) hCCRK promoter: ACCCAGGTACCTATGTTCAAAAGTGCCTCAATCCTAGTTAACAAGGGCAGAGACCACGAGAAACAACACTGTGTTTAGTAGCAACTTAACAACCAGCCAGCAGTTCTGTCCACACACACACCACCGGGCATGGTTCCAAAGCTAAAAAGGCACTAATTGCTTTTCTATAAGGAGGTAGAACACAGTCCCTCCGTGTTCTTTAGGCCTGATGGTCTGCATTATCGGATCTGTTACCGTGTTAATTGTTCCTGTCTCACACAGCCGGTTTGGGCTTTCTTCTGCATATGTCTGGGATGGTGACGGGTTCCTATATAGAGGAGTACTGGGGAAGCCTCTGTGTGTGTGTGTGTGTCCGTGCATATGTACACATGTGTGTAAAAAGCAGCCACACGCTGAGAATGGTTAACGGGTAGCCAGGCTGTCTGTACTCAGGGCCCTAAGACTGGCCCAGGAAAGGGCCGGGGGAGGTGGGGCGGGGTGAAGGTGGAGCGGGCTTGGCTTGTGCTCACTGCCTTTTCCACAACAGGAGTACAAATGCTGGAGTGAGTGAGGTGAACTCAAGTCGCCTTTAGGAATGGCTGAAAAAGCCCACACCTGGAAATCACTCCCTCCCTGCTCCTCCACGGCAGGTTGCATCTGCGAGACGCTTCGGTCATTAGAGGAATGAGCCGGGAGTGAGCAATTCACCAGCTCTCCAGCACTTGGTGGAAAGCAGCAGGCAACC (SEQ ID NO: 15) CMVmini promoter GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGCATTCGAGCTCGGTACCCGG (SEQ ID NO: 16) E1F TATA promoter AATTCGTGTAGTGTATTTATACCCGGTGAGTAGATCTG(SEQ ID NO: 17) CG010201: SV40-hTERT-CMVmini: GATCTGAACCATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCCACGCACAGACGCCCAGGACCGCGCTCCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCAGGCAGCGCTGCGTCCTGCTGCGCACGTGGGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGCATTCGAGCTCGGTACCCGG(SEQ ID NO: 18) CG010301: hTERT-CMVmini: GCACAGACGCCCAGGACCGCGCTCCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCAGGCAGCGCTGCGTCCTGCTGCGCACGTGGGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGCATTCGAGCTCGGTACCCGG(SEQ ID NO: 19) CG010401: hTERT-E1F TATA: GCACAGACGCCCAGGACCGCGCTCCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCAGGCAGCGCTGCGTCCTGCTGCGCACGTGGGAAATTCGTGTAGTGTATTTATACCCGGTGAGTAGATCTG(SEQ ID NO: 20) CG010501: ARE1-hTERT-CMVmini: GATCCAGTCACAGTGACTCAGCAGAATCTGGATCCAGTCACAGTGACTCAGCAGAATCTGGATCCAGTCACAGTGACTCAGCAGAATCTGGCACAGACGCCCAGGACCGCGCTCCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCAGGCAGCGCTGCGTCCTGCTGCGCACGTGGGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGCATTCGAGCTCGGTACCCGG(SEQ ID NO: 21) CG010601: ARE2-hTERT-CMVmini: TGAGTAACGGTTACGAAGCACTTTCTCGGCTACGATTTCTGCTTAGTCATTGTCTTGCACAGACGCCCAGGACCGCGCTCCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCAGGCAGCGCTGCGTCCTGCTGCGCACGTGGGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGCATTCGAGCTCGGTACCCGG(SEQ ID NO: 22) CG010801: SCGB2A2-SCGB2A2-CMVmini: CG010A01: hCCRK: ACCCAGGTACCTATGTTCAAAAGTGCCTCAATCCTAGTTAACAAGGGCAGAGACCACGAGAAACAACACTGTGTTTAGTAGCAACTTAACAACCAGCCAGCAGTTCTGTCCACACACACACCACCGGGCATGGTTCCAAAGCTAAAAAGGCACTAATTGCTTTTCTATAAGGAGGTAGAACACAGTCCCTCCGTGTTCTTTAGGCCTGATGGTCTGCATTATCGGATCTGTTACCGTGTTAATTGTTCCTGTCTCACACAGCCGGTTTGGGCTTTCTTCTGCATATGTCTGGGATGGTGACGGGTTCCTATATAGAGGAGTACTGGGGAAGCCTCTGTGTGTGTGTGTGTGTCCGTGCATATGTACACATGTGTGTAAAAAGCAGCCACACGCTGAGAATGGTTAACGGGTAGCCAGGCTGTCTGTACTCAGGGCCCTAAGACTGGCCCAGGAAAGGGCCGGGGGAGGTGGGGCGGGGTGAAGGTGGAGCGGGCTTGGCTTGTGCTCACTGCCTTTTCCACAACAGGAGTACAAATGCTGGAGTGAGTGAGGTGAACTCAAGTCGCCTTTAGGAATGGCTGAAAAAGCCCACACCTGGAAATCACTCCCTCCCTGCTCCTCCACGGCAGGTTGCATCTGCGAGACGCTTCGGTCATTAGAGGAATGAGCCGGGAGTGAGCAATTCACCAGCTCTCCAGCACTTGGTGGAAAGCAGCAGGCAACC(SEQ ID NO: 24) CG010C01: H19: CCAGTCTCCACTCCACTCCCAACCGTGGTGCCCCACGCGGGCCTGGGAGAGTCTGTGAGGCCGCCCACCGCTTGTCAGTAGAGTGCGCCCGCGAGCCGTAAGCACAGCCCGGCAACATGCGGTCTTCAGACAGGAAAGTGGCCGCGAATGGGACCGGGGTGCCCAGCGGCTGTGGGGACTCTGTCCTGCGGAAACCGCGGTGACCAGCACAAGCTCGGTCAACTGGATGGGAATCGGCCTGGGGGGCTGGCACCGCGCCCACCAGGGGGTTTGCGGCACTTCCCTCTGCCCCTCAGCACCCCACCCCTACTCTCCAGGAACGTGAGGTCTGAGCCGTGATGGTGGCAGGAAGGGGCCCTCTGTGCCATCCGAGTCCCCAGGGACCCGCAGCTGGCCCCCAGCCATGTGCAAAGTATGTGCAGGGCGCTGGCAGGCAGGGAGCAGCAGGCATGGTGTCCCCTGAGGGGAGACAGTGGTCTGGGAGGGAGAAGTCCTGGACCCTGAGGGAGGTGATGGGGCAATGCTCAGCCCTGTCTCCGGATGCCAAAGGAGGGGTGCGGGGAGGCCGTCTTTGGAGAATTCCAGGATGGGTGCTGGGTGAGAGAGACGTGTGCTGGAACTGTCCAGGGCGGAGGTGGGCCCTGCGGGGGCCCTCGGGAGGGCCCTGCTCTGATTGGCCGGCAGGGCAGGGGCGGGAATTCTGGGCGGGGCCACCCCAGTTAGAAAAAGCCCGGGCTAGGACCGAGGAGCAGGGTGAGGGAGGGGGTGGGATGGGTGGGGGGTAACGGGGGAAACTGGGGAAGTGGGGAACCGA(SEQ ID NO: 25) CG011001: TYR: GACCTTTATTCATAAGAGATGATGTATTCTTGATACTACTTCTCATTTGCAAATTCCAATTATTATTAATTTCATATCAATTAGAATAATATATCTTCCTTCAATTTAGTTACCTCACTATGGGCTATGTACAAACTCCAAGAAAAAGTTAGTCATGTGCTTTGCAGAAGATAAAAGCTTAGTGTAAAACAGGCTGAGAGTATTTGATGTAAGAAGGGGAGTGGTTATATAGGTCTTAGCCAAAACATGTGATAGTCACTCCAGGGGTTGCTGGAAAAGAAGTCTGTGACACTCATTAACCTATTGGTGCAGAATTTGAATGATCTAAAGGAGACC(SEQ ID NO: 26) CG011101: TYR-TYR: (SEQ ID NO: 27) CG011201: SV40-TYR: CCTGCAGGGCCTGAAATAACCTCTGAAAGAGGAACTTGGTTAGGTACCTTCTGAGGCTGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCA TCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCACTGCGACCTTTTCATAAGAGATGATGTATTCTTGATACTACT TCTCATTTGCAAATTCCAATTATTTAATTCATATCCAATTAGAATAATATATCTTCCTTCAATTTAGTTACCTCACTATGGGCTATGTACAAACTCCAAGAAAAAGTTAGTCATGTGCTTTGCAGAAGATAAAAGCTTAGTG TAAAACAGGCTGAGAGTATTTGATGTAAGAAGGGGAGTGGTTATAGGTCTTAGCCAAAACATGTGATAGTCACTCCAGGGGTTGCTGGAAAAGAAGTCTGACACTCATTAACCTATTGGTGCAGAATTTGAATTTGAATTCTAA AGGAGACC(SEQ ID NO: 28) CG011301: TRP1: CG010D01: AFP-: AGTTTGAGGAGAATATTTGTTATATTTGCAAAATAAAATAAGTTTGCAAGTTTTTTTTTTCTGCCCCAAAGAGCTCTGTGTCCTTGAACATAAAATACAAATAACCGCTATGCTGTTAATTATTGGCAAATGTCCCATTTTCAACCTAAGGAAATACCATAAAGTAACAGATATACCAACAAAAGGTTACTAGTTAACAGGCATTGCCTGAAAAGAGTATAAAAGAATTTCAGCATGATTTTCCATATTGTGCTTCCACCACTGCCAATAACAC(SEQ ID NO: 30) CG010E01: AFP-AFP: CG010F01: SV40-AFP: CCTGCAGGGCCTGAAATAACCTCTGAAAGAGGAACTTGGTTAGGTACCTTCTGAGGCTGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCACTGCAGTTTGAGGAGAATATTTGTTATATTTGCAAAATAAAATAAGTTTGCAAGTTTTTTTTTTCTGCCCCAAAGAGCTCTGTGTCCTTGAACATAAAATACAAATAACCGCTATGCTGTTAATTATTGGCAAATGTCCCATTTTCAACCTAAGGAAATACCATAAAGTAACAGATATACCAACAAAAGGTTACTAGTTAACAGGCATTGCCTGAAAAGAGTATAAAAGAATTTCAGCATGATTTTCCATATTGTGCTTCCACCACTGCCAATAACAC(SEQID NO: 32)

Claims

1. An expression cassette comprising: 1) a chimeric promoter comprising a hTERT promoter and a minimal promoter; 2) a coding sequence (CDS); and 3) a poly(A) sequence or a polyadenylation signal sequence.

2. The expression cassette of claim 1, wherein the hTERT promoter is a hTERT core promoter, preferably comprising at least one of the sequences of SEQ ID NOs: 1-7 or a sequence having at least 90% sequence identity thereto.

3. The expression cassette of claim 1 or 2, wherein the minimal promoter is a minimal viral promoter or a minimal TATA box promoter.

4. The expression cassette of any one of claims 1-3, wherein the minimal promoter is a minimal CMV promoter, preferably comprising the sequence of SEQ ID NO: 16 or a sequence having at least 90% sequence identity thereto.

5. The expression cassette of any one of claims 1-4, wherein the minimal TATA box promoter is an ElF TATA box promoter, preferably comprising the sequence of SEQ ID NO: 17 or a sequence having at least 90% sequence identity thereto.

6. The expression cassette of any one of claims 1-5, further comprising one or more antioxidant response elements.

7. The expression cassette of any one of claims 1-6, wherein the antioxidant response element is from NQOl or GCLM.

8. The expression cassette of any one of claims 1-7, wherein the antioxidant response element comprises the sequence of SEQ ID NO: 8 or a sequence having at least 90% sequence identity thereto, or the antioxidant response element comprises the sequence of SEQ ID NO: 10 or a sequence having at least 90% sequence identity thereto.

9. The expression cassette of any one of claims 1-8, further comprising one or more enhancers.

10. The expression cassette of any one of claims 1-9, wherein the enhancer is an SV40 enhancer, preferably comprising the sequence of SEQ ID NO: 12 or a sequence having at least 90% sequence identity thereto.

11. The expression cassette of any one of claims 1-10, wherein the coding sequence encodes a protein that is capable of inducing cell death once expressed by a cell.

12. The expression cassette of any one of claims 1-11, wherein the protein is selected from the group consisting of a cytotoxin, a tumor-associated antigen, a tumor-specific antigen, a cytokine, a membrane-penetrating agent, a checkpoint protein, and an antibody.

13. The expression cassette of any one of claims 1-12, wherein the protein is neutrophil elastase, diphtheria toxin, IL-2, or granzyme B.

14. The expression cassette of any one of claims 1-13, wherein the expression cassette is not expressed in, or is expressed at a lower level in, a non-tumor cell when the expression cassette is introduced into the non-tumor cell than in a tumor cell.

15. A nucleic acid molecule comprising the expression cassette of any one of claims 1-14.

16. A vector comprising the expression cassette of any one of claims 1-14 or the nucleic acid molecule of claim 15.

17. The vector of claim 16, wherein the vector is a viral vector, preferably a lentiviral vector, a retroviral vector, an adeno-associated viral (AAV) vector, or an adenoviral vector.

18. A composition comprising 1) the nucleic acid molecule of claim 15 or the vector of any one of claims 16-18; and 2) a pharmaceutically acceptable carrier and / or delivery agent.

19. The composition of claim 18, wherein the delivery agent is a biodegradable polymer, preferably in vivo jetPEI (polyethylenimine), hyperbranched poly(beta-amino ester) (HPAE), a lipid nanoparticle (LNP), a liposome, or an exosome.

20. The composition of claim 18 or 19, further comprising one or more anti-cancer agents.

21. Use of the expression cassette of any one of claims 1-14, the nucleic acid molecule of claim 15, or the vector of claim 16 or 17 in the manufacture of a medicament for the treatment of cancer.

22. A method of treating cancer, comprising administering to a subject in need thereof a therapeutically effective amount of the nucleic acid molecule of claim 15, the vector of claim 16 or 17, or the composition of any one of claims 18-20.

23. The method of claim 22, wherein the cancer is a solid tumor, preferably breast cancer, endometrial cancer, ovarian cancer, cervical cancer, lung cancer, gastric cancer, esophageal cancer, colorectal cancer, anal cancer, urothelial cancer, pancreatic cancer, salivary gland cancer, melanoma, skin cancer, head and neck cancer, sarcoma, or brain cancer.

24. The method of claim 22, wherein the cancer is a hematological malignancy, preferably multiple myeloma (MM), lymphoma, chronic lymphocytic leukemia (CLL), B-cell acute lymphoblastic leukemia (B-ALL), or acute myeloid leukemia (AML), diffuse large B-cell lymphoma (DLBCL), non-Hodgkin lymphoma (NHL), extranodal NK / T-cell lymphoma (ENKL), Hodgkin lymphoma (HL), plasmablastic lymphoma, Burkitt lymphoma, marginal zone lymphoma (MZL), or mantle cell lymphoma (MCL).

Images