Deoxyribozyme probe for specifically distinguishing inosine and adenosine and application of deoxyribozyme probe
By designing deoxyribonuclease probes that specifically distinguish between inosine and adenosine, the problem of deoxyribonucleases being unable to target and alter RNA base pairing patterns in existing technologies has been solved, achieving highly efficient and specific recognition of inosine (I) modifications.
Patent Information
- Application Number
- CN202511638372.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-10
- Publication Date
- 2026-01-20
AI Technical Summary
Existing deoxyribonucleases cannot specifically target modifications that alter RNA base pairing patterns, especially the differentiation between inosine (I) and adenosine.
A deoxyribonuclease probe was designed to specifically distinguish between inosine and adenosine. The deoxyribonuclease obtained by in vitro screening has a specific nucleotide sequence and is combined with the fluorescent group FAM, the cofactor Mn2+ and the pH buffer reagent HEPES to specifically recognize inosine (I) modification.
The provided deoxyribonuclease probes exhibit high catalytic activity and stability when specifically recognizing inosine (I) modifications, which can significantly improve recognition efficiency in biosensing applications.
Smart Images
Figure CN121362757A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of deoxyribozyme probe, and particularly relates to a deoxyribozyme probe capable of specifically distinguishing between inosine and adenosine obtained by an in vitro screening method and application thereof. BACKGROUND
[0002] Cellular RNAs have a variety of chemical modifications during or after transcription. These modifications have gained increasing attention due to their key roles in gene regulation, cellular processes, metabolism, and health. Recent studies have discovered over 170 different RNA base modifications, which mainly modulate the stability of base pairing through the following mechanisms: (1) weakening or maintaining base pairing interactions, with representative examples including N 6 - methyladenosine (m 6 A), and N 1 - methyladenosine (m 1 A). Among them, m 6 A can retain or disrupt Watson-Crick base pairing in its anti-conformation; while m 1 A disrupts pairing through a combination of steric repulsion and proton-dependent electrostatic repulsion; (2) strengthening base pairing stability, with a typical example being N 4 - acetylcytosine (ac 4 C). In this modification, N - cytidine acetylation mediated by acetyltransferase 10 (NAT10) retains the traditional C-G pairing, while it stabilizes the conformation of cytidine due to the intramolecular hydrogen bond of the acetyl group, thereby improving its complementary pairing with guanosine, significantly enhancing the stability; (3) changing the pairing mode, taking inosine (I) as an example, the xanthine base of inosine reconfigures the hydrogen bond network, converting the traditional A-U pairing into the non-traditional I-C wobble pair.
[0003] Deoxyribozyme, also known as DNAzyme, is a catalytically active DNA molecule that does not exist in natural biological systems. It can be obtained by Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Since its initial discovery, many DNAzyme variants have been isolated from random sequence DNA libraries. Among them, RNA cleavage-type deoxyribozymes are the most widely studied, with 8-17 and 10-23 deoxyribozymes being two classic models. These deoxyribozymes all require metal ions and other cofactors, which not only stabilize their tertiary structures, but also directly participate in the catalytic cleavage of RNA phosphodiester bonds. Recent studies have found that RNA cleavage-type deoxyribozymes can specifically recognize and cleave m6 A, m 1 A and methylated cytidine variants and a variety of post-transcriptional modifications have catalytic activity. However, they all belong to the modification type of weakening or maintaining base pairing interaction, and there is no report on RNA modification of deoxyribozyme targeting to change the base pairing mode. SUMMARY
[0004] In view of this, the purpose of the present application is to provide a deoxyribozyme probe for specifically distinguishing between inosine and adenosine and application thereof.
[0005] To achieve the above-mentioned purpose, the present application provides the following technical solutions. In a first aspect, the present application provides a deoxyribozyme, the nucleotide sequence of which is as follows: ATCAGGTCCATCGAGTGGTAGGAAGACA CAATCTCCCTAGGGAGGCTCCGCAATATAACTAGTCAACT TCGCACTGCTCCTGAACGTAC.
[0006] In a second aspect, the present application provides a deoxyribozyme probe, the nucleotide sequence of which is any one of the following sequences (1) and (2): (1) CAAATTGTGGAAIGCTGFCTTCGATATCAGGTCCATCGAGTGGTAGGAAGACA CAATCTCCCTAG GGAGGCTCCGCAATATAACTAGTCAACT TCGCACTGCTCCTGAACGTAC; (2) CAAATTGTGGAArAGCTGFCTTCGATATCAGGTCCATCGAGTGGTAGGAAGACA CAATCTCCCTA GGGAGGCTCCGCAATATAACTAGTCAACT TCGCACTGCTCCTGAACGTAC; Wherein, sequences (1) and (2) both constitute a cis-structure deoxyribozyme, and rA in the sequence represents an RNA base A, and F represents a T base containing a fluorescent group.
[0007] Based on the above technical solutions, further, the fluorescent group is FAM.
[0008] In a third aspect, the present application provides a kit for recognizing inosine (I) modification, comprising the above-mentioned deoxyribozyme or deoxyribozyme probe.
[0009] Based on the above technical solutions, further, the kit comprises an auxiliary factor and a pH buffer reagent.
[0010] Based on the above technical solutions, further, the auxiliary factor is Mn 2+ .
[0011] Based on the above technical scheme, further, the pH buffer reagent comprises a HEPES buffer.
[0012] The application also provides the use of the above deoxyribozyme, the above deoxyribozyme probe or the above kit in biosensing for specifically recognizing the inosine (I) modification.
[0013] Based on the above technical scheme, further, for distinguishing the inosine and the adenosine modification.
[0014] Based on the above technical scheme, further, the conditions for specifically recognizing the RNA modification site inosine (I) are that the pH is 7.0-8.5, the temperature is 25-37℃, the final concentration of Mn 2+ is 1-20 mM.
[0015] Compared with other prior arts, the application has the following beneficial effects: (1) The cleavage efficiency of the chain deoxyribozyme obtained in the application increases with time for the substrate containing the inosine (I) modification.
[0016] (2) The catalytic activity of the deoxyribozyme probe provided in the application is the highest among the reported deoxyribozyme probes for specifically recognizing the RNA modification.
[0017] (3) The deoxyribozyme probe provided in the application has good stability and specificity, and can play a significant advantage in the application of biosensing. BRIEF DESCRIPTION OF DRAWINGS
[0018] In order to more clearly illustrate the embodiments of the application, the drawings involved in the embodiments will be briefly introduced below.
[0019] Figure 1 is a schematic diagram of the screening process of the chain deoxyribozyme.
[0020] Figure 2 is a statistical diagram of the cleavage rate of the DNA library after each round of screening in the in vitro screening process.
[0021] Figure 3 is a result diagram of the catalytic activity and specificity verification experiment of the chain deoxyribozyme 11-1.
[0022] Figure 4 is a result diagram of the cleavage rate of the chain deoxyribozyme 11-1 under different pH.
[0023] Figure 5 is a result diagram of the cleavage rate of the chain deoxyribozyme 11-1 under different temperatures.
[0024] Figure 6 is a result diagram of the cleavage rate of the chain deoxyribozyme 11-1 under different concentrations of Mn 2+Cutting rate results plot at different concentrations.
[0025] Figure 7 Figure is the chain deoxyribozyme 11-1 specificity experiment results plot for divalent metal ions.
[0026] Figure 8 Figure is the kinetic characterization results plot of chain deoxyribozyme 11-1 for forward substrate strand S I (A) and reverse substrate strand S A (B). DETAILED DESCRIPTION
[0027] The present application will be described in detail below with reference to the embodiments, but the embodiments of the present application are not limited thereto. It is obvious that the embodiments described below are only part of the embodiments of the present application, and other similar embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.
[0028] The embodiments include construction of DNA library, reverse screening, forward screening, PCR amplification, etc. The nucleic acid names and sequences involved in the embodiments are shown in Table 1.
[0029] Table 1. Nucleic acid name, sequence and use description
[0030] Embodiment 1 Construction of DNA reverse library Mix DNA library L1 (SEQ ID NO: 1) with T4 polynucleotide kinase, incubate at 37℃ for 40 min~60 min (i.e. library L1 phosphorylation), then add equal molar amount of reverse substrate strand S A(SEQ ID NO: 3) and 1.2 times of the auxiliary chain (SEQ ID NO: 4) and T4 DNA ligase, and uniformly mixed, and reacted at room temperature for 2.5-3 h (construction of the DNA library-reverse substrate complex). After the reaction was completed, 2.5 times the volume of cold ethanol, 0.1 times the volume of 3 mol / L sodium acetate and 2 μL of 1 μg / μL glycogen were added, and the mixture was frozen in a -20 °C refrigerator for 30 min to perform a DNA precipitation reaction. The precipitated mixture was centrifuged at low temperature and high speed (4 °C, 14000 rpm, 20 min), the supernatant was removed, and after vacuum drying for 5 min, a solid powder, i.e. the ligation product, was obtained. 20 μL of ultrapure water was added for re-dissolution, and purified by 10% denatured polyacrylamide gel electrophoresis (dPAGE), the position of the target band was determined by a gel imager, and the gel was cut and recovered. Elution Buffer buffer solution (5M NaCl, 1M Tris (pH 7.5), 0.5M EDTA (pH 8.0)) was added to the recovered target band to perform DNA elution and extraction. After the eluate was precipitated by cold ethanol, vacuum dried and re-dissolved in ultrapure water, the library-reverse substrate complex required for reverse screening was obtained.
[0031] Table 2. DNA library L1 phosphorylation reaction component table
[0032] Table 3. Ligation reaction component table
[0033] Example 2 in vitro screening The in vitro screening was divided into reverse screening, enzyme digestion reaction, forward ligation library formation, forward screening, PCR amplification and other steps. After 11 rounds of screening, high-throughput sequencing was performed, and the specific screening steps included: 1. Reverse screening The purified chain library of Example 1 was dissolved in 20 μL of ultrapure water and reacted in a reaction buffer solution containing Mn 2+ .
[0034] Table 4. Reverse screening reaction component table
[0035] The dissolved library was heated at 90 °C for 2 min before the reaction, cooled to room temperature, and then 10x reaction buffer solution, Mn 2+ and water were added, and the reaction lasted for 15 h.
[0036] Wherein the 10x reaction buffer solution composition: HEPES: 500 mM (pH 7.5), NaCl: 1500 mM, KCl: 500 mM, Tween-20: 0.1% (volume fraction).
[0037] The reacted product was separated and purified by 10% denatured polyacrylamide gel electrophoresis, and the linear library without cleavage reaction was obtained by cold ethanol precipitation.
[0038] 2. Enzymatic cleavage reaction The linear library without cleavage reaction in the reverse screening was dissolved in 20 μL ultrapure water, and then EcoR V, 10x restriction endonuclease reaction buffer solution and water were added, and the reaction lasted for 3 h.
[0039] Table 5. Enzymatic cleavage reaction composition table
[0040] 3. DNA forward library system: (1) Library chain L1 phosphorylation The specific process is the same as that in Example 1 and Table 2; (2) Library connection forward substrate The specific process is the same as that in Example 1, except that the forward substrate chain S I is used, and the connection reaction composition table is shown in Table 6, to obtain the connected forward linear library.
[0041] Table 6. Connection reaction composition table
[0042] 4. Forward screening The connected forward linear library was dissolved in 20 μL ultrapure water, and reacted in a reaction buffer solution containing Mn 2+ .
[0043] Table 7. Forward screening reaction composition table
[0044] The dissolved library was heated at 90°C for 2 min before reaction, and then 10x reaction buffer solution, Mn 2+ and water were added, and the reaction lasted for 12 h.
[0045] Wherein the 10x reaction buffer solution composition: HEPES: 500 mM (pH 7.5), NaCl: 1500 mM, KCl: 500 mM, Tween-20: 0.1% (volume fraction).
[0046] The reacted product was separated and purified by 10% denatured polyacrylamide gel electrophoresis, and the cleaved linear library was obtained by cold ethanol precipitation.
[0047] 5. PCR amplification The DNA sequence capable of cleavage reaction recovered by forward screening was used as a template, and the upstream primer FP (SEQ ID NO: 5) and the downstream primer RP1 (SEQ ID NO: 6) and RP2 (SEQ ID NO: 7) were used for two-step PCR to amplify the target sequence. The PCR product was separated and purified by 10% dPAGE. Because the downstream primer RP2 has a space modification, different lengths of sense and antisense strands will be obtained after PCR amplification. The sense strand was recovered by gel cutting, and the concentration was determined.
[0048] Table 8. PCR amplification conditions
[0049] PCR reaction system: (1) PCR1 Table 9. PCR1 reaction conditions
[0050] (2) PCR2 Table 10. PCR2 reaction conditions
[0051] 6. Reverse connection to library The sense strand (enzyme chain, PCR2 product) after PCR amplification was mixed with T4 polynucleotide kinase, incubated at 37°C for 40-60 min, and then equal molar amount of reverse substrate chain S A , 1.2 times of auxiliary chain and T4 DNA ligase were added, mixed uniformly, and reacted at room temperature for 2.5-3 h. After separation and purification, the DNA sequence for the next round of reverse screening was obtained.
[0052] The cleavage percentage (clv%) was calculated using the following formula, which was used to characterize the enrichment degree of the DNA library after each round of screening, and the results are shown in Figure 2 After multiple rounds of screening, the cleavage percentage of forward screening has a significant increasing trend with time, and the cleavage rate of the linear library of the 11th round of forward screening is about 17%, and the DNA library enrichment is completed.
[0053]
[0054] Where clv% is the cleavage percentage, clv is the library amount that occurs cleavage reaction, and unclv is the library amount that does not occur cleavage reaction.
[0055] The top four sequences were selected for experimental verification by high-throughput sequencing, and the deoxyribozyme sequence meeting the target requirements was found. After being connected with the forward substrate strand, the sequence is shown as SEQ ID NO: 8, and after being connected with the reverse substrate strand S A , the sequence is shown as SEQ ID NO: 9.
[0056] Example 3: Performance characterization of deoxyribozyme 1. Catalytic activity and substrate specificity characterization Take the chain deoxyribozyme 11-1I (SEQ ID NO: 8) and the chain deoxyribozyme 11-1A (SEQ ID NO: 9) as examples, incubate in the reaction buffer (50 mM HEPES, 150 mM NaCl, 50 mM KCl, 0.01% Tween-20, 5 mM Mn 2+ ) for 1 h, and separate by 10% dPAGE gel, and calculate the cleavage rate.
[0057] The results are shown in Figure 3 . The experimental results show that the cleavage rate of deoxyribozyme 11-1I is 61%, and the cleavage rate of deoxyribozyme 11-1A is 0%, i.e. the deoxyribozyme exhibits high catalytic activity and high specificity for inosine, indicating that the deoxyribozyme specifically recognizing inosine is successfully obtained by in vitro screening.
[0058] 2. pH characterization Take the chain deoxyribozyme 11-1I (SEQ ID NO: 8) as an example, under the condition that the metal ion concentration remains the same, prepare 7 different pH reaction buffers with pH in the range of 3.5-8.5, the other components and contents in the reaction system are the same as those in the above catalytic activity and substrate specificity characterization experiment, incubate in each reaction buffer for 1 h, and separate by 10% dPAGE gel, and the results are shown in Figure 4 . It can be found from the experimental results that there is no catalytic activity at pH 3.5 and 4.5; the catalytic activity is moderate at pH 5.5 and 6.5; and the cleavage rate reaches the highest in the range of pH 7.0-8.5.
[0059] 3. Reaction temperature characterization Take the chain deoxyribozyme 11-1I (SEQ ID NO: 8) as an example, keep the Mn 2+ concentration (final concentration 5 mM) unchanged, and the other components and contents in the reaction system are the same as those in the above catalytic activity and substrate specificity characterization experiment, incubate at different temperatures for 1 h, and then separate by 10% dPAGE gel. As shown in Figure 5 , the cleavage rate is the highest at 25°C and 37°C, and as the temperature gradually increases, the cleavage rate of the deoxyribozyme decreases.
[0060] 4, Mn 2+ Concentration-dependent characterization For example, chain deoxyribozyme 11-1I (SEQ ID NO: 8), under the conditions of pH 7.5 and temperature 25℃, other components and contents in the reaction system are the same as the above-mentioned catalytic activity and substrate specificity characterization experiments, and the concentration of Mn 2+ is increased to characterize the concentration dependence of the deoxyribozyme. The experimental results are shown in Figure 6 As the concentration of Mn 2+ increases, the cleavage rate of the deoxyribozyme increases accordingly, and when it reaches 5 mM, the cleavage rate reaches a maximum of 61%.
[0061] 5, divalent metal ion specificity characterization For example, chain deoxyribozyme 11-1I (SEQ ID NO: 8), keeping pH 7.5 and temperature 25℃ unchanged, other components and contents in the reaction system are the same as the above-mentioned catalytic activity and substrate specificity characterization experiments, changing different divalent metal ions, incubating for 1h and separating by 10% dPAGE gel, the experimental results are shown in Figure 7 . The deoxyribozyme only responds to Mn 2+ with the highest activity, responds to Mg 2+ , Zn 2+ and Co 2+ three metal ions, but its catalytic activity is negligible, and has no response to other divalent metal ions.
[0062] According to the above experimental results, pH 7.5, 25℃ and 5 mM Mn 2+ are selected as the optimal reaction conditions for the deoxyribozyme.
[0063] 6, deoxyribozyme kinetics characterization For example, chain deoxyribozyme 11-1I (SEQ ID NO: 8) and chain deoxyribozyme 11-1A (SEQ ID NO: 9), under the optimal reaction conditions, the kinetics characterization is carried out, other components and contents in the reaction system are the same as the above-mentioned catalytic activity and substrate specificity characterization experiments, and the time gradient is set to 0, 0.5, 1, 3, 5, 10, 15, 20, 30, 60 min. After the reaction is completed, the reaction sample is characterized by 10% dPAGE gel, and the cleavage rate is calculated, and the results are shown in Figure 8 . The deoxyribozyme only shows high catalytic activity to inosine, and has no catalytic activity to adenosine, which further indicates that the deoxyribozyme with high specificity and high catalytic activity to inosine is successfully obtained by in vitro screening.
[0064] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions recorded in the above embodiments can be modified, or some or all of the technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.
Claims
1. A deoxyribozyme, characterized in that, The nucleotide sequence of the deoxyribozyme is as follows: ATCAGGTCCATCGAGTGGTAGGAAGACA CAATCTCCCTAGGGAGGCTCCGCAATATAACTAGTCAACT TCGCACTGCTCCTGAACGTAC.
2. A deoxyribozyme probe, characterized in that, The nucleotide sequence of the deoxyribozyme probe is any one of the following sequences (1)~(2): (1) CAAATTGTGGAAIGCTGFCTTCGATATCAGGTCCATCGAGTGGTAGGAAGACA CAATCTCCCTAGGGAG GCTCCGCAATATAACTAGTCAACT TCGCACTGCTCCTGAACGTAC; (2) CAAATTGTGGAArAGCTGFCTTCGATATCAGGTCCATCGAGTGGTAGGAAGACA CAATCTCCCTAGGGA GGCTCCGCAATATAACTAGTCAACT TCGCACTGCTCCTGAACGTAC; In the sequences (1)~(2), rA represents RNA base A, and F represents a T base containing a fluorescent group.
3. The deoxyribozyme probe of claim 2, wherein, The fluorescent group is FAM.
4. A kit for specifically recognizing inosine (I) modification, comprising the deoxyribozyme of claim 1 or the deoxyribozyme probe of claim 2 or 3.
5. The kit of claim 4, wherein The kit comprises a cofactor and a pH buffer reagent.
6. The kit of claim 5, wherein The co-factor is Mn 2+ .
7. The kit of claim 5, wherein The pH buffer reagent comprises HEPES buffer.
8. Use of the deoxyribozyme of claim 1, the deoxyribozyme probe of claim 2 or 3, or the kit of any one of claims 4-7 in biosensing for specifically recognizing inosine (I) modification.
9. Use according to claim 8, characterized in that, For distinguishing inosine and adenosine modification.
10. Use according to claim 8, characterized in that, The conditions for specifically recognizing the RNA modification site inosine (I) are: pH 7.0-8.5, 25-37°C, and a final concentration of 1-20 mM of Mn 2+ .