Use of CHRNA3 agonists in treatment of sleep disorders

Abstract

The invention discloses an application of a CHRNA3 agonist in treatment of sleep disorders. The application finds that the CHRNA3 agonist varenicline can effectively relieve the sleep disorder reaction for the first time, on this basis, the invention provides a new application of the CHRNA3 agonist varenicline in treating the sleep disorder, and meanwhile, provides a method for screening candidate drugs for treating diseases caused by hypoxia stress, and provides a new application of the CHRNA3 agonist varenicline in treating the sleep disorder. A new treatment means is provided for sleep disorder, especially sleep disorder caused by hypoxia stress.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological medicine, and particularly relates to application of CHRNA3 agonist in treatment of sleep disorders. BACKGROUND

[0002] Sleep disorders can cause body function disorder, and induce adverse reactions such as loss of appetite, mental debilitation, and decreased immunity. Long-term sleep disorders can cause irreversible brain function damage, and even induce serious diseases such as cardiovascular and cerebrovascular diseases and depression. It has become an urgent need to effectively relieve sleep disorders and improve sleep quality through drug treatment under hypoxic conditions to guarantee normal life and work. SUMMARY

[0003] In order to make up for the deficiency of the prior art, the application provides application of CHRNA3 agonist in treatment of sleep disorders.

[0004] In order to achieve the above object, the application adopts the following technical scheme: The first aspect of the application provides application of CHRNA3 agonist in preparation of a drug for treating sleep disorders.

[0005] Further, the CHRNA3 agonist is varenicline.

[0006] Further, the varenicline further includes a pharmaceutically acceptable salt thereof.

[0007] Further, the sleep disorder is a hypoxia-induced sleep disorder.

[0008] Further, the drug further includes other drugs for treating sleep disorders.

[0009] Further, the other drugs for treating sleep disorders include benzodiazepine drugs, melatonin receptor agonists, antidepressants, and antihistamines.

[0010] Further, the drug further includes a pharmaceutically acceptable excipient.

[0011] Further, the dosage form of the drug includes a solid preparation, a semi-solid preparation, or a liquid preparation.

[0012] Further, the solid preparation includes a tablet, a lozenge, a capsule, a pill, or a granule.

[0013] Further, the semi-solid preparation includes a cream, a gel, an ointment, or an emulsion.

[0014] Further, the liquid preparation includes a solution or a suspension.

[0015] The second aspect of the application provides a drug for treating sleep disorders, and the drug includes a CHRNA3 agonist.

[0016] Further, the CHRNA3 agonist is varenicline.

[0017] Further, the sleep disorder is a hypoxia-induced sleep disorder.

[0018] The third aspect of the present application provides use of CHRNA3 as a target in screening a candidate drug for treating a disease caused by hypoxia stress.

[0019] Further, the method for screening a candidate drug for treating a disease caused by hypoxia stress comprises: treating a culture system expressing or containing CHRNA3 gene or protein coded by the gene with a substance to be screened; and detecting expression or activity of CHRNA3 gene or protein coded by the gene in the system; wherein, when the substance to be screened promotes expression level or activity of CHRNA3 gene or protein coded by the gene, the substance to be screened is a candidate drug for treating a disease caused by hypoxia stress.

[0020] Further, the disease is a sleep disorder.

[0021] The fourth aspect of the present application provides a method for screening a candidate drug for treating a disease caused by hypoxia stress, which comprises: treating a culture system expressing or containing CHRNA3 gene or protein coded by the gene with a substance to be screened; and detecting expression or activity of CHRNA3 gene or protein coded by the gene in the system; wherein, when the substance to be screened promotes expression level or activity of CHRNA3 gene or protein coded by the gene, the substance to be screened is a candidate drug for treating a disease caused by hypoxia stress.

[0022] Further, the disease is a sleep disorder.

[0023] Advantages and beneficial effects of the present application: The present application first discovers that CHRNA3 agonist varenicline can effectively relieve sleep disorder response, based on which, the present application provides a new application of CHRNA3 agonist varenicline in treating sleep disorder, and simultaneously provides a method for screening a candidate drug for treating a disease caused by hypoxia stress, thereby providing a new treatment means for sleep disorder, especially for sleep disorder caused by hypoxia stress. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1is a graph of experimental results of hypoxic stress inducing brown adipose tissue exosomes and up-regulating the expression level of miR-47119-24 in serum, wherein 1A is a graph of experimental results of hypoxic stress up-regulating the expression level of miR-47119-24 in serum, 1B is a graph of experimental results of hypoxic stress up-regulating the expression level of miR-47119-24 in brown adipose tissue, 1C is a graph of experimental results of hypoxic stress not changing the expression level of miR-47119-24 in neuron cells, and 1D is a graph of ROC curve of miR-47119-24 diagnosing hypoxic stress; Figure 2 is a graph of experimental results of hypoxic stress inducing rhythmic oscillation disorder of PC-5p-47119_24 expression; Figure 3 is a graph of experimental results of changes in the expression level of miR-47119-24 after hypoxic stress, wherein 3A is a graph of experimental results of changes in the expression level of miR-47119-24 in each brain region after hypoxic stress, and 3B is a graph of results of detecting exosome marker RFP signal in the hippocampus of mice; Figure 4 is a graph of experimental results of CHRNA3 being a potential target gene of miR-47119-24, wherein 4A and 4B are prediction results of the binding region of miR-47119_24 and CHRNA3, 4C is a graph of results of the influence of hypoxic stress at low temperature on the expression level of CHRNA3 mRNA in the first three brain regions and a graph of results of the influence of hypoxic stress on the expression level of CHRNA3 mRNA in the last brain region, and 4D is a graph of results of the influence of hypoxic stress on the expression level of CHRNA3 protein; Figure 5 is a graph of experimental results of miR-47119-24 secreted by brown adipose tissue being capable of targeting and regulating the expression of CHRNA3 in neuron cells, wherein 5A is a graph of results of changes in the expression of CHRNA3 gene in the hippocampus before and after hypoxic stress, 5B is a graph of results of changes in the expression of CHRNA3 protein in various types of neuron cells before and after hypoxic stress, and 5C is a graph of results of luciferase activity dependent on miRNA24 regulating CHRNA3-3’UTR; Figure 6 is a graph of experimental results of injecting GW4869 into brown adipose tissue being capable of reducing the content of miR-47119-24 in serum, wherein 6A is a graph of administration scheme of GW4869, 6B is a graph of results of hypoxic stress response being weakened in brown adipose tissue after injection of GW4869, and 6C is a graph of results of the content of miR-47119-24 in serum being significantly reduced after injection of GW4869; Figure 7Figure 7 is a graph showing that GW4869, a brown fat injection, antagonizes the response of the up-regulation of miR-47119-24 expression, the down-regulation of CHRNA3 expression and the decline of learning and memory ability induced by hypoxic stress in the hippocampus, wherein 7A is a graph showing the change of miR-47119-24 expression, 7B is a graph showing the change of CHRNA3 expression, and 7C is a graph showing the change of learning and memory ability; Figure 8 Figure 8 is a graph showing that varenicline, a CHRNA3 agonist, alleviates the response of sleep disorders induced by hypoxic stress. DETAILED DESCRIPTION

[0025] The following provides definitions of some terms used in the present specification. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs.

[0026] The present application provides use of a CHRNA3 agonist in the preparation of a medicament for treating sleep disorders.

[0027] In some embodiments, CHRNA3 is a cholinergic receptor nicotinic alpha 3 subunit encoding gene, and the corresponding human gene Gene ID is 1136. When the subject is a non-human species, the CHRNA3 gene refers to the orthologous gene of human CHRNA3.

[0028] In some embodiments, the CHRNA3 agonist includes but is not limited to varenicline, UA312.

[0029] In specific embodiments, the CHRNA3 agonist is selected from varenicline.

[0030] In some embodiments, varenicline also includes pharmaceutically acceptable salts thereof. Pharmaceutically acceptable salt forms, which can be formed, for example, by protonation of an atom (e.g., an amino group) carrying an electron lone pair susceptible to protonation, or as a salt of a physiologically acceptable cation with an acid group (e.g., a carboxylic acid group). Exemplary base addition salts include, for example: alkali metal salts such as sodium or potassium salts, alkaline earth metal salts such as calcium or magnesium salts, zinc salts, ammonium salts, fatty amine salts such as trimethylamine, triethylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine, procaine, meglumine, ethylenediamine, or choline salts, aralkylamine salts such as N,N-dibenzylethylenediamine, benzathine, phenethylbenzylamine salts, heterocyclic aromatic amine salts such as pyridine, methylpyridine, quinoline, or isoquinoline salts, quaternary ammonium salts such as tetramethylammonium, tetraethylammonium, benzyltrimethylammonium, benzyltriethylammonium, benzyltributylammonium, methyltrioctylammonium, or tetrabutylammonium salts, and basic amino acid salts such as arginine, lysine, or histidine salts. Exemplary acid addition salts include, for example: mineral acid salts such as hydrochloride, hydrobromide, hydroiodide, sulfate (such as, for example, sulfate or bisulfate), nitrate, phosphate (such as, for example, phosphate, hydrogen phosphate, or dihydrogen phosphate), carbonate, bicarbonate, perchlorate, borate, or thiocyanate salts, organic acid salts such as acetate, propionate, butyrate, valerate, hexanoate, heptanoate, octanoate, cyclopentanepropionate, decanoate, undecanoate, oleate, stearate, lactate, maleate, oxalate, fumarate, tartrate, malate, citrate, succinate, adipate, gluconate, glycolate, nicotinate, benzoate, salicylate, ascorbate, embonate, camphorate, glucoheptonate, or pivalate salts, sulfonic acid salts such as methanesulfonate (mesylate), ethanesulfonate (esylate), 2-hydroxyethanesulfonate (isethionate), benzenesulfonate (besylate), p-toluenesulfonate (tosylate), 2-naphthalenesulfonate (napsylate), 3-phenylsulfonate, or camphorsulfonate, glycerophosphonate, and acidic amino acid salts such as aspartate or glutamate.

[0031] In some embodiments, the sleep disorder includes a hypoxia-induced sleep disorder, an age-related sleep disorder, a sleep disorder caused by a chronic disease, a sleep disorder caused by an emotional disorder, a sleep disorder caused by light and sound, a sleep disorder caused by irregular work and rest, a sleep disorder caused by a drug, and the like.

[0032] In a specific embodiment, the sleep disorder is a hypoxia-induced sleep disorder.

[0033] The drug also includes other drugs for treating sleep disorders.

[0034] In some embodiments, the other drug for treating sleep disorders includes benzodiazepines (such as triazolam, midazolam, estazolam, alprazolam, diazepam, flurazepam, etc.), melatonin receptor agonists (such as ramelteon, agomelatine, etc.), antidepressants (such as mirtazapine, trazodone, doxepin, etc.), antihistamines (such as doxylamine, diphenhydramine, etc.).

[0035] The pharmaceutical composition further includes a pharmaceutically acceptable excipient.

[0036] In some embodiments, a pharmaceutically acceptable excipient is used to refer to a material that is compatible with the recipient, preferably a mammal, more preferably a human, and is suitable for delivering an active agent to a target site without terminating the activity of the agent. Toxicity or side effects (if any) associated with the pharmaceutically acceptable excipient are preferably commensurate with a reasonable risk / benefit ratio for the intended use of the active agent. Pharmaceutically acceptable excipients include, but are not limited to, excipients, buffers, surfactants, and / or preservatives.

[0037] Examples of excipients include one or more viscosity-imparting agents. Viscosity-imparting agents refer to one or more relatively non-toxic chemical compounds or agents that alter the viscosity of a pharmaceutical composition and / or formulation. Representative examples of viscosity-imparting agents include petrolatum, liquid paraffin, light liquid paraffin, castor oil, mineral oil, cottonseed oil, soybean oil, sesame oil, corn oil, petroleum resin, polyethylene glycol, glycerin, polybutene, rosin, polyvinyl alcohol, polystyrene, polyacrylic acid, propylene glycol, piperonyl butoxide, hydroxypropyl methylcellulose, talc, gelatin, hydrogenated rosin glycerides, aliphatic hydrocarbon resins, benzyl acetate, copaiba balsam, silicic acid, dimethyl polysiloxane, magnesium aluminum silicate, xanthan gum, sodium chondroitin sulfate, cyclodextrin, carboxyvinyl polymer, sodium alginate, propylene glycol alginate, carrageenan, sodium carboxymethylcellulose, gluconolactone, squalene, stearyl alcohol, aluminum stearate, lanolin, cetyl alcohol, gelatin, sorbitol, dextran, dextrin, tragacanth gum, palmitic acid, hyaluronate, hydroxyethyl cellulose, hydroxyethyl methyl cellulose, hydroxypropyl cellulose, butylene glycol, polyoxyethylene polyoxypropylene glycol, polysorbate ester, sodium metaphosphate, methyl cellulose, methyl vinyl ester maleic anhydride copolymer, locust bean gum, or a cellulose polymer, etc.

[0038] Other representative examples of excipients include one or more antioxidants (sulfites, sodium sulfite, sodium formaldehyde sulfoxylate, sodium formaldehyde sulfoxylate dihydrate, and a tonicity adjusting agent (sodium chloride, etc.

[0039] Examples of buffering agents include, but are not limited to, acetic acid, boric acid, citric acid, lactic acid, phosphoric acid, hydrochloric acid-potassium chloride, glycine, aconitic acid, citric acid-phosphoric acid, succinic acid, phthalic acid, maleic acid, cacodylic acid, tris (tris-hydroxymethyl aminomethane), barbituric acid, borax, 2-amino-2-methyl-l,3-propanediol, sodium carbonate-sodium bicarbonate, HEPES (4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid), ACES (N-(2-acetamido)-2-aminoethanesulfonic acid), ADA (N-(2-acetamido)iminodiacetic acid), BES (N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid), Bicine (N,N-bis(2-hydroxyethyl)glycine), Bis-tris (bis(2-hydroxyethyl)iminotris(hydroxymethyl)methane), CAPS (N-cyclohexyl-3-aminopropanesulfonic acid), CAPSO (N-cyclohexyl-2-hydroxy-3-aminopropanesulfonic acid), CHES (N-cyclohexyl-2-aminoethanesulfonic acid), DIPSO (3-[N,N-bis(2-hydroxyethyl)amino]-2-hydroxypropanesulfonic acid), EPPS (3-[4-(2-hydroxyethyl)-l-piperazinyl]propanesulfonic acid), HEPES-Na (2-[4-(2-hydroxyethyl)-l-piperazinyl]ethanesulfonic acid sodium salt), HEPPSO (2-hydroxy-3-[4-(2-hydroxyethyl)-l-piperazinyl]propanesulfonic acid monohydrate), MES (2-morpholinoethanesulfonic acid monohydrate), MOPS (3-morpholinopropanesulfonic acid), MOPSO (2-hydroxy-3-morpholinopropanesulfonic acid), PIPES (piperazine-l,4-bis(2-ethanesulfonic acid)), POPS0 (piperazine-l,4-bis(2-hydroxy-3-propanesulfonic acid) dihydrate), TAPSO (2-hydroxy-N-tris(hydroxymethyl)methyl-3-aminopropanesulfonic acid), TES (N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid), Tricine (N-[tris(hydroxymethyl)methyl]glycine), hydrochloric acid; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, and sodium lactate; and buffers such as citrate / dextrose, sodium bicarbonate, and ammonium chloride, and citrate, phosphate, borate, bicarbonate, sodium, or potassium salts, including combinations thereof.

[0040] Examples of surfactants include, but are not limited to, sorbitan esters of oleic acid (e.g., polysorbate 80 or Tween 20 and 80), polyoxyethylene castor oil, polyoxyethylene hydrogenated castor oil, cremophore, sodium alkylbenzene sulfonate, glycerin, lecithin, sucrose ester, polyoxyethylene alkyl ether, polyoxyethylene stearate, polyethylene glycol 40 stearate, ethylene glycol monostearate, polyethylene glycol monostearate, polymers of oxyethylated octyl phenol (tyloxapol), propylene glycol, benzyl alcohol, macrogol, cyclodextrin, butylated hydroxytoluene, sorbitol, trometamol, propylene glycol, mannitol, and polyoxyethylene polyoxypropylene glycol (e.g., polyoxyethylene (160) polyoxypropylene (30) glycol, or polyoxyethylene (200) polyoxypropylene (70) glycol), or combinations thereof. In some embodiments, the ophthalmic compositions of the present application comprise, consist essentially of, or further consist of, polysorbate 80, polyoxyethylene hydrogenated castor oil, lecithin, or combinations thereof.

[0041] Examples of preservatives include, but are not limited to, imidazolidinyl urea, methylparaben, propylparaben, phenoxyethanol, disodium EDTA, benzalkonium chloride, thiomersal, chlorobutanol, sorbic acid, and combinations thereof.

[0042] In some embodiments, the pharmaceutical composition is in a dosage form that is a solid formulation, a semi-solid formulation, or a liquid formulation. The solid formulation includes a tablet, a lozenge, a capsule, a pill, or a granule; the semi-solid formulation includes a cream, a gel, an ointment, or a lotion; and the liquid formulation includes a solution or a suspension.

[0043] The pharmaceuticals of the present application can be administered to a patient orally, rectally, parenterally, intraperitoneally, topically (e.g., as by powders, ointments, or drops), bucally, or as an oral or nasal spray. The term "parenterally" as used herein refers to modes of administration, which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous, intraarticular injection and infusion.

[0044] Pharmaceuticals for parenteral injection include sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include, but are not limited to, water, ethanol, polyols (propylene glycol, polyethylene glycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0045] These compositions also can contain adjuvants such as preservatives, wetting agents, emulsifying agents, dispersing agents, lubricants and dispersing agents. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. It can also be desirable to include isotonic agents, for example, sugars, sodium chloride, and the like. Prolonged absorption of injectable pharmaceuticals can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0046] In some cases, in order to prolong the effect of a drug, it is often desirable to slow its absorption from subcutaneous or intramuscular injection. This can be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution which, in turn, can depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.

[0047] In some embodiments, the appropriate dosage of the drug can be varied depending on the method of administration, the formulation, the age, body weight, sex, disease state, diet, time of administration, route of administration, rate of excretion, and reaction sensitivity of the patient, and the like, and a skilled medical doctor can easily determine the appropriate dosage and the dosage effective for the desired treatment or prevention. The therapeutically effective amount and the specific treatment regimen for a subject (e.g., a mammal: a human) can be influenced by many factors, including the pharmacodynamic activity of the drug used, the age, body weight, general condition, sex, diet, time of administration, disease susceptibility, disease progression, and judgment of the attending medical doctor, and in addition, it is clear to those skilled in the art that the method of administration, the dosage form, and the dosage of the drug are influenced by many factors, including the age, body weight, sex, disease state, diet, time of administration, rate of excretion, and reaction sensitivity of the patient, and thus, the method of administration, the dosage form, and the dosage of the ophthalmic preparation or the pharmaceutical composition described in the present application are not limited to the method of administration, the dosage form, and the dosage described in the examples of the present application.

[0048] The application will be further described in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are presented by way of example and not as limitations to the present application. The principal features of the present application can be employed in various embodiments without departing from the scope of the present application.

[0049] Example 1 1. Experimental materials The specific experimental materials are shown in Table 1.

[0050] Table 1 Experimental reagents

[0051] 2. Experimental methods 2.1 Induced differentiation culture of mouse brown adipocytes First, the interscapular brown adipose tissue (BAT) of a mouse within five days after birth is dissected. After the tissue is cut into small pieces, it is then placed in a 37°C digestion incubator for oscillation digestion with collagenase (Collagenase I, Collagenase II) for 40-70 min. After filtering the digestion solution, it is centrifuged at 700 r / min at room temperature for 10 min. The supernatant and floating cells are discarded, and the red blood cell lysis solution is repeatedly blown and mixed, and then placed in an incubator for 10 min. Again, centrifuge at 700 r / min at room temperature for 10 min. Discard the supernatant, add 4-5 mL of cell culture solution, and then blow and mix, and inoculate into a culture bottle and place it in a culture box for culture. When the precursor adipocytes grow to 70% confluence, they are passaged for use. Select the second generation of precursor adipocytes, and when they are fully confluent and in a contact inhibition state, use standard induction differentiation solution for induced differentiation culture, and finally obtain a brown adipocyte line.

[0052] 2.2 Isolation and primary culture of mouse hippocampal neurons Under a stereomicroscope, the hippocampus of a fetal mouse is isolated from a mouse E14-16 embryo. The dura mater is removed, and the hippocampus is dissected into small pieces and digested in 0.025% trypsin in a 37°C water bath for 30 min. The cell suspension is filtered through a cell filter, and then the cells are transferred to Neurobasal medium supplemented with B-27 (#17504-044; Gibco) and L-glutamine (2 mM; Gluta MAX, Invitrogen) and seeded at a density of 5 x 10 4 cells per well in a 24-well plate coated with polylysine for neuron immunofluorescence staining. Or the primary cells are directly planted in a 6-well plate for protein extraction. The primary neurons need to be cultured for 7-10 days before downstream experiments.

[0053] 2.3 Extraction of exosomes from culture supernatant of mature brown adipocytes Supernatants of brown adipose tissue with and without hypoxic stimulation were collected and centrifuged at 3,000 x g for 15 min to remove tissue debris. Then, they were centrifuged at 10,000 x g for 30 min to remove large vesicles. Then, the supernatants were centrifuged at 110,000 x g for 70 min. The precipitated extracellular vesicle vesicles were collected and resuspended in PBS.

[0054] 2.4 Injection of mouse brown adipose AVVs virus First, the mice were anesthetized, and a total of 1 x 10 9 v.g of AAVs virus was injected into the left and right lobes of the brown adipose tissue at the scapular of the back of the mice using a HAMILTON syringe, 3 injection sites for each lobe (1 μΐ per site), and the needle was left in place for 1 minute.

[0055] 2.5 Exogenous verification of miR-47119-24 targeting to the Chrna 3’UTR region The miR-47119-24-mimic (RiboBio) was constructed with miR-47119-24 as the target. The 3’UTR region of mouse CHRNA3 was cloned into the luciferase reporter vector psiCHECK-2 (Promega) and co-transfected into HEK293T cells with the miR-47119-24-mimic and negative control mimic to verify the down-regulation efficiency of the luciferase signal after the introduction of miR-47119-24, and further determine the targeting effect on CHRNA3. For the rigor of the experiment, the mutant ( Figure 4 C) of the Chrna 3’UTR region miR-47119-24 predicted binding region ( Figure 5 C) was added as a control.

[0056] 2.6 Injection of mouse brown adipose extracellular vesicles inhibitor GW4869 First, the mice were anesthetized, and 100 μΐ of GW4869 solution (injection dose 2.5 μg / g) was injected into the left and right lobes of the brown adipose tissue at the scapular of the back of the mice using a syringe, 50 μΐ for each lobe, and the needle was left in place for 10 s, and injected for five days.

[0057] 2.7 Injection of varenicline into the abdomen of mice First, the mice were fixed, and 120 μΐ of varenicline solution (injection dose 3 μg / g) was injected into the abdominal cavity of the mice using a syringe, and injected for 14 days.

[0058] 2.8 Stereotactic injection of mouse miR-47119-24-blocker into the brain First, anesthetize the mouse, put the mouse's upper incisors into the horizontal bar, and adjust the knob to press the nose bar; insert the ear bar into the mouse's ear canal, balance the left and right ear bars, and make the line between the two ears and the ear bar on the same straight line, and then adjust the knob to lock the ear bar. Select the middle position of the brain. After cutting off the mouse's top hair, disinfect with alcohol, cut the scalp vertically, separate the skin left and right with hemostats, and completely remove the periosteum to make the Bregma point appear. Use the brain positioning instrument to read the Bregma point value as the three-dimensional coordinate origin O. The stereotactic coordinates relative to the Bregma point are as follows: AP value (Y axis), 2.4 mm; ML value (X axis), ±2.2 mm; DV value (Z axis), 2.5 mm below the surface. Use a microsyringe to stereotactically inject a total of 2 μL (50 μM / L) into the hippocampal region.

[0059] 2.9 miRNA extraction (1) Sample processing (soak small steel balls in DEPC water in advance), take out the sample stored in the -80°C refrigerator, take 50 mg of tissue and add 1 ml of lysis solution MZ, add two small steel balls soaked in DEPC water, and use a homogenizer for homogenization treatment. The sample volume should not exceed one-tenth of the volume of the lysis solution MZ.

[0060] (2) Place the homogenized sample at room temperature for 5 min to completely separate the nucleic acid protein complex.

[0061] (3) Centrifuge at 4°C 12,000 rpm (~13,400 x g) for 5 min, take the supernatant and transfer it to a new RNase-free centrifuge tube (the precipitate obtained by centrifugation includes the outer membrane, polysaccharides, and high molecular weight DNA, and the RNA is present in the supernatant solution).

[0062] (4) Add 200 μl of chloroform, cover the tube cap, and shake vigorously for 15 sec, and stand at room temperature for 5 min.

[0063] (5) Centrifuge at 4°C 12,000 rpm (~13,400 x g) for 15 min, the sample will be divided into three layers: yellow organic phase, middle layer, and colorless aqueous phase, the RNA is mainly in the aqueous phase, and the volume of the aqueous phase is about 50% of the lysis solution MZ reagent used. Transfer the aqueous phase to a new tube and proceed to the next step.

[0064] (6) Measure the volume of the transfer solution, slowly add 0.43 times the volume of the transfer solution of absolute ethanol (e.g. 500 μΐ of transfer solution plus 215 μΐ of absolute ethanol), mix well (at this time, a precipitate may appear). Transfer the resulting solution and precipitate into the adsorption column miRspin, centrifuge at room temperature at 12,000 rpm (~ 13,400 x g) for 30 sec, if the entire solution and mixture cannot be added into the adsorption column miRspin at one time, please transfer in two times, after centrifugation, discard the adsorption column miRspin, and retain the effluent.

[0065] (7) Measure the volume of the effluent, slowly add 0.75 times the volume of the effluent of absolute ethanol (e.g. 700 μΐ of effluent plus 525 μΐ of absolute ethanol), mix well (at this time, a precipitate may appear). Transfer the resulting solution and precipitate into the adsorption column miRelute, centrifuge at room temperature at 12,000 rpm (~ 13,400 x g) for 30 sec, if the entire solution and mixture cannot be added into the adsorption column miRelute at one time, please transfer in two times, after centrifugation, discard the effluent, and retain the adsorption column miRelute.

[0066] (8) Add 500 μΐ of the deproteinization solution MRD (please first check whether ethanol has been added) into the adsorption column miRelute, stand at room temperature for 2 min, centrifuge at room temperature at 12,000 rpm (~ 13,400 x g) for 30 sec, discard the waste liquid.

[0067] (9) Add 500 μΐ of the rinse solution RW (please first check whether ethanol has been added) into the adsorption column miRelute, stand at room temperature for 2 min, centrifuge at room temperature at 12,000 rpm (~ 13,400 x g) for 30 sec, discard the waste liquid.

[0068] (10) Repeat the operation step (9).

[0069] (11) Place the adsorption column miRelute into a 2 ml collection tube, centrifuge at room temperature at 12,000 rpm (~ 13,400 x g) for 1 min, remove the residual liquid.

[0070] Note: The purpose of this step is to remove the residual rinse solution in the adsorption column, after centrifugation, place the adsorption column miRelute at room temperature for a while, or place it on the clean bench for a while to fully dry. If there is residual rinse solution, it may affect the subsequent RT experiment operation.

[0071] (12) Transfer the adsorption column miRelute into a new RNase-Free 1.5 ml centrifuge tube, add 15-30 μl RNase-Free ddH2O, and let it stand at room temperature for 2 min, then centrifuge at 12,000 rpm (~13,400 x g) for 2 min at room temperature.

[0072] Note: The volume of elution buffer should not be less than 15 μl, and too small volume will affect the recovery efficiency. The RNA should be stored at -70°C to prevent degradation. Note: If you want to improve the RNA yield, repeat the above operation once.

[0073] 2.10 miRNA reverse transcription Table 2 miRNA reverse transcription reagents

[0074] The miRNA reverse transcription reagents are shown in Table 2. This process can also use small molecule RNA as a template, and the amount added is 2-5 μl. The amount added is determined according to the abundance of the miRNA of interest, but for low abundance miRNA samples (such as serum plasma extract), the maximum volume added is 8 μl.

[0075] Reverse transcription procedure Gently mix the above prepared reaction solution with a pipette, and perform the miRNA reverse transcription reaction according to the procedure in Table 3.

[0076] Table 3 miRNA reverse transcription reaction procedure

[0077] 2.11 miRNA fluorescent quantitative detection Dilute the cDNA appropriately by 10 times, and prepare the reagents according to Table 4.

[0078] Table 4 miRNA fluorescent quantitative detection reagents

[0079] Forward Primer: CCCAGGAAGCCAGATACCCGTC (SEQ ID NO: 1) The PCR reaction procedure is shown in Table 5.

[0080] Table 5 PCR reaction procedure

[0081] 2.12 Water maze First, a 5-day "platform hidden training period" was conducted. Fresh water was injected into the barrel, the water depth was 26 cm, the water temperature was 20-22℃, a circular solid platform with a diameter of 10 cm was placed in the barrel, and the platform was 0.5-1 cm out of the water. The pool was divided into four quadrants, and before the experiment, the water was whitened with edible titanium dioxide to prevent the animals from seeing the solid platform. Open the water maze test program, calibrate the capture view, solid platform, virtual platform and water entry point parameters, and put the animals into the water from the four different quadrants with their heads against the barrel wall. The mice freely swim in the barrel to find the solid platform, and the video system above the water barrel captures their swimming trajectory and records the platform search latency. Training is done once a day for 5 consecutive days. If the mouse finds the platform within 60 seconds, it will stay on the platform for 20 seconds; if the mouse fails to find the platform within 60 seconds, it will be guided to the platform and allowed to stay for 20 seconds, remembering the platform location. The time it takes for the mouse to find the platform during training is recorded as the escape latency.

[0082] After training, the mice were randomly divided into control and experimental groups. The control group was placed in a normal oxygen environment for 72 hours; the experimental group was placed in a hypoxic chamber for 72 hours (10.3% O2). During the mouse modeling period, food and water supply was ensured, and the incubation chamber was kept at a suitable temperature and humidity (23±0.5℃, 40% humidity). After the hypoxic stress ended, the mice were subjected to spatial exploration experiments.

[0083] After the hypoxic stress, the mice were subjected to spatial exploration experiments. First, remove the hidden platform, then put the mouse into the water from the third quadrant, record the mouse's swimming path within 60 seconds, record the mouse's stay time and crossing frequency in the original platform quadrant, and the latency.

[0084] 2.13 Y maze New and different arms (1) Randomly close the door at the entrance of one arm, allowing the animal to freely explore the remaining two arms for 5 minutes. Then remove the experimental animal from the maze, and after two hours, perform the second part of the experiment.

[0085] (2) Open the previously closed arm door and allow the animal to freely move within the three arm space for 5 minutes. Observe whether the animal enters the previously closed maze arm during free movement, as well as the number of entries and time.

[0086] Spontaneous alternation (1) The Y maze device is made of three opaque plastic arms (labeled I, II, and III), with an angle of 120° between the two arms.

[0087] (2) Gently place the mouse in the center of the maze and allow it to freely explore for 5 minutes. The standard for a mouse entering each arm is complete entry with all four limbs. Sequential entry of the mouse into three different arms (e.g., I II III, I III II, II III I, II I III, III I II, III II I) is considered an alternation.

[0088] (3) Both mice experiments need to wipe the maze with 75% alcohol and make the alcohol evaporate completely to ensure that the smell does not interfere with the experiment. The Y maze experiment records the detection indicators through the image acquisition system.

[0089] 3 Experimental results 3.1 Hypoxia-responsive adipose tissue exosome miRNA screening and its tissue / serum expression level research The mice were placed in a hypoxia and low temperature combined stress environment simulation cabin (simulating an altitude of 6000 meters, -12 degrees) for 72 hours, and the brown adipose tissue of the model animals after exposure was collected for exosome miRNA sequencing analysis. Significant exosome miRNAs responsive to hypoxic stress were screened, and their adipose tissue and serum expression levels were jointly verified and analyzed to determine the miRNA expression profile that meets the screening criteria.

[0090] The results found that the expression level of miR-47119-24 (also known as PC-5p-47119_24, miR-24-5p, miRNA-24, miRNA24) in the exosomes of brown fat after stress was up-regulated, and its expression level in BAT and serum under hypoxic stress conditions was up-regulated (A-B), but no similar phenomenon was found in neurons treated under the same hypoxic stress conditions (C). Figure 1 A-B), but no similar phenomenon was found in neurons treated under the same hypoxic stress conditions (C). Figure 1 C), 20 non-high altitude control samples and 43 high altitude samples were collected to detect the expression of miR-47119-24 in serum, and the ROC curve is shown in Figure 1 D. And it was found that under hypoxic stress conditions, the expression of miR-47119-24 in BAT showed a significant circadian rhythm characteristic, and this rhythm oscillation completely disappeared after hypoxic stress (D). Figure 2 ), suggesting that the function of miR-47119-24 may be related to the rhythm disorder effect induced by hypoxic stress (such as sleep).

[0091] 3.2 Screening of adipose tissue exosome miRNA with brain function regulation potential and its brain target gene Bioinformatics methods were used to predict adipose tissue exosome miRNAs with brain function regulation potential and their potential target molecules. The expression level changes of exosome miRNAs and their potential target molecules in important sleep, rhythm and cognitive function regulation brain regions such as basal forebrain, hypothalamus, cortex and hippocampus before and after hypoxic stress (Western blot and dual luciferase reporter gene experiments, etc.) were detected to determine the "exosome miRNA-brain target molecule" signal transduction pathway.

[0092] To explore whether PC-5p-47119_24 derived from adipose tissue has the function of brain regulation, we detected the expression level of PC-5p-47119_24 in different regions of the brain, including cortex, hippocampus, hypothalamus, basal forebrain and other brain regions. The results showed that the expression level of PC-5p-47119_24 was up-regulated in each of the above brain regions except cortex after hypoxic stress Figure 3 A). To explore whether miR-47119-24 in the brain is derived from exosome secretion and delivered to different regions of the brain, we performed a mouse in vivo brown adipose exosome tracing experiment. We injected rAVV-CMV-palm-mCherry-WPRE-hGHpA into the mouse brown adipose tissue to label exosome vesicles. Two weeks later, we found that exosome-labeled RFP signal was indeed detected in the hippocampus of mice Figure 3 B), indicating that brown adipose exosomes can indeed reach the hippocampus.

[0093] To explore the mechanism of miR-47119-24 entering the brain from the periphery, we used bioinformatics tools to predict the target genes of miR-47119_24, and found that CHRNA3 was a potential target molecule regulated by miR-47119_24 Figure 4 A-B). In the subsequent detection of CHRNA3 expression level in each brain region, we found that the mRNA expression level of CHRNA3 in hippocampus, hypothalamus and basal forebrain was down-regulated after hypoxic stress, but the expression level in cortex was unchanged Figure 4 C). The protein level detection results were consistent with the mRNA Figure 4 D).

[0094] Finally, we selected a brain region to further explore the functional relationship between miRNA24 and CHRNA3. We first found that the down-regulation of CHRNA3 expression in the hippocampus mainly occurred in neuronal cells Figure 5 A), but the response in astrocytes and microglial cells was not significant. At the same time, we transfected miR-24 mimics into different types of neural cells, and the results showed that the down-regulation of CHRNA3 expression only occurred in neuronal cells, and the response in astrocytes and microglial cells was not significant Figure 5 B), which was consistent with the in vivo results. To further confirm the expression regulation relationship between miRNA24 and CHRNA3, we constructed a reporter gene expression plasmid containing the 3'UTR region of CHRNA3 gene containing the miRNA24 binding site, and the results showed that after co-transfecting the above reporter gene expression plasmid and miR-24 mimics in neuronal cells, CHRNA3-3'UTR-dependent luciferase activity was significantly down-regulated Figure 5C). The above results collectively indicate that miRNA24 from adipose tissue exosomes can enter the brain after hypoxic stress and inhibit CHRNA3 gene expression in specific brain regions. The down-regulation of acetylcholine receptor subunit expression in the hypothalamus, basal forebrain, and hippocampus may play a role in mediating the hypoxic stress-induced rhythm disorder, sleep disorder, and cognitive dysfunction response.

[0095] 3.3 Role and contribution of the adipobrain axis in mediating hypoxic stress-induced abnormal changes in brain function The use of miRNA inhibitors and mimics further confirms the neural cell expression source of miRNA target molecules in the brain; and by specifically regulating the expression / activation level of miRNA or its target molecules in the brain through viral infection, drug treatment, etc., the cognitive function and emotional state changes of the model animals after hypoxic stress are analyzed synchronously to confirm the role and contribution of the "exosome miRNA-brain target molecule" information transmission pathway in mediating hypoxic stress-induced abnormal changes in brain function.

[0096] After confirming the gene expression regulation relationship between miR-47119-24 and CHRNA3, we began to verify the biological function of this adipobrain response pathway. We injected exosome inhibitor GW4869 into BAT ( Figure 6 A), and found that the hypoxic stress response intensity in BAT was weakened ( Figure 6 B); at the same time, the content of miR-47119-24 in serum was significantly down-regulated ( Figure 6 C).

[0097] Subsequently, we analyzed the expression changes of miRNA24 and its target gene CHRNA3 in the brain. The results showed that the injection of GW4869 in BAT not only blocked the hypoxic stress-induced secretion and expression of miR-47119_24, but also reduced the expression level of this miRNA in the hippocampus ( Figure 7 A). More importantly, the expression of CHRNA3 was significantly inhibited ( Figure 7 B). Under the same conditions, the hypoxic stress-induced learning and memory ability decreased, and the memory of mice could be restored to almost the same level as that of healthy mice ( Figure 7 C). The above results indicate that exosome-secreted miR-47119-24 can affect the expression of target genes in the hippocampus through the adipobrain axis pathway and mediate the hypoxic stress-induced cognitive dysfunction response.

[0098] Previous results showed that hypoxic stress can cause sleep disorder response in mice. We found that the CHRNA3 agonist varenicline pretreatment alleviated the hypoxic stress-induced sleep disorder response ( Figure 8 ). This provides a new intervention strategy for sleep disorders caused by environmental stress.

[0099] The above description of the embodiments is only for understanding the method of the present application and its core idea. It should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and modifications can be made to the present application, and these improvements and modifications will also fall within the protection scope of the claims of the present application.

Claims

1. Use of a CHRNA3 agonist in the preparation of a medicament for treating sleep disorders.

2. Use according to claim 1, characterized in that, The CHRNA3 agonist is varenicline; Preferably, the varenicline further comprises a pharmaceutically acceptable salt thereof.

3. Use according to claim 1, characterized in that, The sleep disorder is a hypoxia-induced sleep disorder.

4. Use according to claim 1, characterized in that, The medicament further comprises other drugs for treating sleep disorders; Preferably, the other drugs for treating sleep disorders comprise benzodiazepines, melatonin receptor agonists, antidepressants, antihistamines.

5. Use according to claim 4, characterized in that, The medicament further comprises pharmaceutically acceptable adjuvants.

6. Use according to claim 5, characterized in that, The dosage form of the medicament comprises a solid preparation, a semi-solid preparation or a liquid preparation.

7. Use according to claim 6, characterized in that, The solid preparation comprises tablets, troches, capsules, pills or granules; Preferably, the semi-solid preparation comprises creams, gels, ointments or emulsions; Preferably, the liquid preparation comprises solutions or suspensions.

8. A medicament for treating sleep disorders, characterized by comprising a compound of the formula (I) or a pharmaceutically acceptable salt thereof. The medicament comprises a CHRNA3 agonist; Preferably, the CHRNA3 agonist is varenicline; Preferably, the sleep disorder is a hypoxia-induced sleep disorder.

9. Use of CHRNA3 as a target in screening candidate drugs for treating diseases caused by hypoxic stress; Preferably, the method of screening candidate drugs for treating a disease caused by hypoxic stress comprises: treating a culture system expressing or containing CHRNA3 gene or protein coded by the gene with a substance to be screened; and detecting the expression or activity of CHRNA3 gene or protein coded by the gene in the system; wherein, when the substance to be screened promotes the expression level or activity of CHRNA3 gene or protein coded by the gene, the substance to be screened is a candidate drug for treating diseases caused by hypoxic stress; Preferably, the disease is a sleep disorder.

10. A method of screening for a candidate drug for treating a disease caused by hypoxic stress, characterized by, The method comprises: treating a culture system expressing or containing CHRNA3 gene or protein coded by the gene with a substance to be screened; and detecting the expression or activity of CHRNA3 gene or protein coded by the gene in the system; wherein, when the substance to be screened promotes the expression level or activity of CHRNA3 gene or protein coded by the gene, the substance to be screened is a candidate drug for treating diseases caused by hypoxic stress; Preferably, the disease is a sleep disorder.

Images