Use of miR-2355-3p in endometriosis

By overexpressing miR-2355-3p in endometriosis and using lentiviral vector transfection technology to inhibit the proliferation of ectopic endometrial cells and promote apoptosis, the problem of unclear function of miR-2355-3p was solved, and an effective treatment for endometriosis was achieved.

CN121370931BActive Publication Date: 2026-03-31SHIJIAZHUANG PEOPLES HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511598182.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-04
Publication Date
2026-03-31
Estimated Expiration
2045-11-04

AI Technical Summary

Technical Problem

The function of miR-2355-3p in endometriosis is unclear in the current technology. The RNA transcription level of miR-2355-3p is decreased in ectopic endometrial tissue, which leads to rapid proliferation and migration of ectopic endometrial tissue, and there is a lack of effective treatment methods.

Method used

By using a lentiviral vector, miR-2355-3p mimic RNA was cloned into a lentiviral vector and transfected into ectopic endometrial stromal cells. Overexpression of miR-2355-3p was used to inhibit the proliferation of ectopic endometrial stromal cells and promote their apoptosis.

Benefits of technology

Inhibiting the growth of ectopic endometrial tissue, reducing cell proliferation rate, increasing apoptosis index, reducing cell transmembrane number, and inducing a decrease in mitochondrial membrane potential provide a new possibility for the treatment of endometriosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses application of miR-2355-3p in endometriosis, and finds that the RNA transcription level of miR-2355-3p in ectopic endometrial tissue samples is significantly decreased for the first time; the mimics RNA of miR-2355-3p overexpression is cloned to a lentivirus vector and lentivirus packaging is carried out, miR-2355-3p mimic lentivirus is obtained, and ectopic endometrial stromal cells are transfected with the lentivirus, so that the proliferation of the ectopic endometrial stromal cells can be inhibited, and apoptosis of the ectopic endometrial stromal cells can be promoted, thereby the growth of ectopic endometrial tissue is inhibited, and a new possibility is provided for development of an endometriosis treatment drug.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to the application of miR-2355-3p in endometriosis. Background Technology

[0002] Endometriosis (EMs) is a common chronic inflammatory gynecological disease characterized by the abnormal growth of endometrial tissue outside the uterine cavity, primarily in the ovarian region. Although it is a benign disease, it exhibits biological characteristics similar to malignant tumors, such as invasive growth, distant metastasis, and high recurrence rate, and can occur in any part of the body. Endometriosis is a major cause of dysmenorrhea, infertility, and chronic pelvic pain, profoundly impacting the quality of life and fertility of women of reproductive age. Ovarian endometriosis is most common, directly related to the direct connection between the ovary and the endometrium via the fallopian tubes, allowing ectopic endometrial tissue to enter the ovary and form ectopic endometrial tissue. A significant characteristic of ectopic endometrial tissue is the rapid proliferation and migration of cells or tissue fragments, ultimately leading to fibrosis within the ectopic tissue.

[0003] Although the occurrence of endometriosis is closely related to multiple factors such as sex hormone dependence, immune response, inflammatory response and genetics, the value of miR-2355-3p, miR-337-3p and miR-99a-5p detection in early screening of head and neck squamous cell carcinoma [1] reported that miR-2355-3p and miR-337-3p are associated with the stage, size and lymph node metastasis of head and neck squamous cell carcinoma (HNSCC) tumors, and the combined detection of miR-2355-3p, miR-337-3p and miR-99a-5p may be used for early screening of HNSCC; the study on the correlation between lncRNA MIR100HG and malignant biological behavior of hepatocellular carcinoma and its relationship with hsa-miR-2355-3p regulation [2] reported that lncRNA Abnormally high expression of MIR100HG is closely related to the malignant biological behavior of hepatocellular carcinoma, and it may promote the migration and invasion of hepatocellular carcinoma by mediating hsa-miR-2355-3p; "Knockout of circRNA single stranded interacting protein 1 (circRBMS1) played a protective role in myocardial ischemia-reperfusion injury through inhibition of miR-2355-3p / Mammalian Sterile20-like kinase 1 (MST1) axis" [3] reported that: decreased expression level of miR-2355-3p can regulate the overexpression of target gene MST1, which promotes apoptosis, oxidative stress and inflammatory response in hypertrophic cardiomyopathy; "Diagnostic and prognostic value of microRNA-2355-3p and contribution to the progression in lung adenocarcinoma" [4] reported that: downregulation of miR-2355-3p promotes the migration and invasion of hepatocellular carcinoma by regulating the zinc finger CCHC protein 14 (Zinc Finger CCHC-Type Containing 14 (ZCCHC14) inhibits the proliferation, invasion, and migration of lung adenocarcinoma cells;The study "Silenced SOX2-OT alleviates ventricular arrhythmia associated with heart failure by inhibiting NLRP3 expression via regulating miR-2355-3p" [5] reported that miR-2355-3p can alleviate cardiac dysfunction in rats by downregulating the expression of the NLRP3 inflammasome. Although the role of miR-2355-3p in various diseases has been well-established, its specific function in endometriosis remains unclear.

[0004] References

[0005] [1] Liu Jinghao1, Guo Haiyan1, Gan Guifang1, Chen Fuxiang1,2. Value of miR-2355-3p, miR-337-3p and miR-99a-5p detection in early screening of head and neck squamous cell carcinoma[J]. Diagnostics Theory and Practice, 2025, (No. 2).

[0006] [2] Wang Xia. Correlation between lncRNA MIR100HG and malignant biological behavior of hepatocellular carcinoma and its relationship with hsa-miR-2355-3p regulation [J]. International Journal of Laboratory Medicine, 2024, (Vol. 3).

[0007] [3]Liang Y, Jie H, Liu Q, et al. Knockout of circRNA single strandedinteracting protein 1 (circRBMS1) played a protective role in myocardialischemia-reperfusion injury though inhibition of miR-2355-3p / MammalianSterile20-like kinase 1 (MST1) axis[J]. Bioengineered, 2022, 13(5):12726-12737.

[0008] [4]Zhao Y, Zhang W, Yang Y, et al. Diagnostic and prognostic value of microRNA-2355-3p and contribution to the progression in lung adenocarcinoma[J]. Bioengineered, 2021, 12(1): 4747-4756.

[0009] [5]Liang Y, Wang B, Huang H, et al. Silenced SOX2-OT alleviates ventricular arrhythmia associated with heart failure by inhibiting NLRP3expression via regulating miR-2355-3p[J]. Immun Inflamm Dis, 2021, 9(1): 255-264. Summary of the Invention

[0010] This application is the first to discover that the RNA transcription level of miR-2355-3p is significantly decreased in ectopic endometrial tissue samples. By cloning miR-2355-3p overexpressing mimics RNA into a lentiviral vector and packaging it into a lentiviral agent, miR-2355-3p mimic lentivirus was obtained. Transfecting ectopic endometrial stromal cells with this lentivirus inhibited the proliferation of ectopic endometrial stromal cells and promoted their apoptosis, thereby inhibiting the growth of ectopic endometrial tissue. The specific technical solution of this invention is as follows:

[0011] First aspect: Sample collection

[0012] Ten patients with pathologically confirmed endometriosis (ovarian type) who were hospitalized at Shijiazhuang People's Hospital between June 2021 and October 2024 were selected. They were staged according to the American Fertility Society's revised staging criteria (r-AFS), and the case group was classified as stage III-IV endometriosis (ovarian type). Endometrial tissue (Ectopic endometrium, EC) from the patients' ovaries was collected as the ectopic endometrium group, and relatively normal endometrial tissue from the patients' ovaries was selected as the control.

[0013] The second aspect involves the purification, isolation, culture, passage, and identification of primary endometrial stromal cells.

[0014] (I) Isolation of primary endometrial stromal cells

[0015] Tissue processing and digestion: including cleaning, shearing, and enzymatic digestion;

[0016] Cell purification and separation: including filtration, centrifugation, resuspension, and differential adhesion separation of ESCs;

[0017] (II) Culture of primary endometrial stromal cells

[0018] Incubate the culture dishes at 37°C in a 5% CO2 incubator; change the medium every three days to remove dead cells that have not adhered to the walls and impurities;

[0019] (III) Cell passage and identification

[0020] Passaging: When cell confluence reaches 80%-90%, passage can be performed. Digest cells with 0.05% trypsin-EDTA and aliquot them into new culture dishes at a ratio of 1:2 or 1:3. Primary cells (P0) are usually designated as P1 after passage.

[0021] Identification includes morphological observation and detection of cell markers.

[0022] Thirdly, the RNA transcriptional expression level of miR-2355-3p in ectopic endometrial tissue and normal endometrial tissue.

[0023] Compared with normal endometrium, the RNA transcription level of miR-2355-3p in ectopic endometrial tissue was significantly decreased (P < 0.05).

[0024] Fourthly, we prepared mimics RNA overexpressing miR-2355-3p and verified the transfection efficiency.

[0025] (a) Preparation of mimics RNA overexpressing miR-2355-3p

[0026] A mimics RNA sequence that enables miR-2355-3p overexpression, namely miR-2355-3p mimics RNA, was designed, cloned into the lentiviral vector GV209, and packaged as a lentiviral agent. A control NC mimics RNA lentiviral agent was also packaged simultaneously. The miR-2355-3p mimic lentiviral agent and the NC mimic lentiviral agent were transfected into ectopic endometrial stromal cells and cultured.

[0027] (ii) RT-qPCR verification of transfection efficiency

[0028] Compared with NC mimics, transfection with miR-2355-3p mimic RNA significantly increased the transcription level of miR-2355-3p RNA (P < 0.0001), confirming the effectiveness of transfection.

[0029] Fifthly, the effects of miR-2355-3p overexpression on ectopic endometrial tissue were investigated.

[0030] EdU experiment results showed that, compared with the control group (NC mimics group), the proliferation rate of cells overexpressing miR-2355-3p was significantly reduced;

[0031] The results of the CCK-8 experiment showed that, compared with the control group (NC mimics group), the proliferation activity of cells overexpressing miR-2355-3p was significantly reduced.

[0032] The TUNEL assay results showed that, compared with the control group (NC mimics group), the apoptosis index of cells overexpressing miR-2355-3p was significantly increased.

[0033] Transwell assay results showed that, compared with the control group (NC mimics group), the number of cells that crossed the membrane in the miR-2355-3p overexpression group was significantly reduced;

[0034] JC-1 assay results indicated that, compared with the control group (NC mimics group), overexpression of miR-2355-3p could induce a decrease in mitochondrial membrane sites and apoptosis.

[0035] Compared with the prior art, the beneficial effects of this application are as follows:

[0036] This application is the first to discover that the RNA transcription level of miR-2355-3p is significantly reduced in ectopic endometrial tissue compared with eutopic endometrial tissue; overexpression of miR-2355-3p inhibits the proliferation of ectopic endometrial stromal cells and promotes their apoptosis, thereby inhibiting the growth of ectopic endometrial tissue, providing a new possibility for the treatment of endometriosis. Attached Figure Description

[0037] Figure 1 A statistical comparison of miR-2355-3p RNA expression in ectopic endometrial tissue (EC) and eutopic endometrial tissue (NC) of patients with endometriosis (ovarian type);

[0038] Figure 2 A schematic diagram of the structure of lentiviral plasmid GV290;

[0039] Figure 3 A statistical chart comparing the transfection efficiency of endometrial stromal cells between the miR-2355-3p mimics group and the control group (NC mimics group);

[0040] Figure 4The EdU experiment investigated the effects of miR-2355-3p mimics group (overexpression of miR-2355-3p group) and NC mimics group (control group) on the proliferation of ectopic endometrial stromal cells.

[0041] Figure 5 The CCK8 assay investigated the effects of miR-2355-3p mimics and NC mimics on the proliferative activity of ectopic endometrial stromal cells.

[0042] Figure 6 The TUNEL assay investigated the effects of miR-2355-3p mimics and NC mimics on apoptosis of ectopic endometrial stromal cells.

[0043] Figure 7 The Transwell assay examined the number of ectopic endometrial stromal cells that penetrated the membrane in the miR-2355-3p mimics group and the NC mimics group.

[0044] Figure 8 The results of JC-1 detection on the effects of miR-2355-3p mimics group and NC mimics group on mitochondrial membrane potential of ectopic endometrial stromal cells.

[0045] in Figures 1-8 middle,

[0046] *, **, ***, and **** represent P<0.05, P<0.01, P<0.001, and P<0.0001, respectively, indicating that the difference between the two groups is statistically significant. Detailed Implementation

[0047] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0048] Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions.

[0049] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0050] Reagents and Materials

[0051] reagents or materials Company or source Item number Lentiviral vector Shanghai Jikai Gene Medical Technology Co., Ltd. GV209 EdU-594 Cell Proliferation Detection Kit Shanghai Beyotime Biotechnology Co., Ltd. C0078S Collagenase IV Shanghai Beyotime Biotechnology Co., Ltd. Y296939 Cell coating fluid Zhejiang Meisen Cell Technology Co., Ltd. CTCC-120-0001 Enhanced Mitochondrial Membrane Potential Detection Kit (JC-1) Shanghai Beyotime Biotechnology Co., Ltd. C2003S 10% fetal bovine serum Hyclone SH30406.05 1% secondary antibody in DMEM-F12 medium Xiamen Yimo Biotechnology Co., Ltd. IM-209 0.125% trypsin Gibco 25200056 Trizol Beijing Solarbio Technology Co., Ltd. R1100 Chloroform Tianjin Huadong Reagent 67-66-3 Isopropanol Tianjin Huadong Reagent 67-63-0 Anhydrous ethanol Tianjin Huadong Reagent 64-17-5 Reverse transcription kit Tiangen Biotech (Beijing) Co., Ltd. KR118 SuperReal PreMix Plus (SYBR Green) SuperReal Quantitative Reagent Premix Reagent Tiangen Biotech (Beijing) Co., Ltd. FP205 CCK8 reagent kit Beijing Solarbio Technology Co., Ltd. CA1210 TUNEL Shanghai Beyotime Biotechnology Co., Ltd. C1090 Paraformaldehyde Beijing Solarbio Technology Co., Ltd. P1110 Triton-X Beijing Boao Tuoda Technology Co., Ltd. T6200G PBS Beijing Solarbio Technology Co., Ltd. P1022 Matrigel Beijing Solarbio Technology Co., Ltd. M8370 Crystal Violet Beijing Solarbio Technology Co., Ltd. G1063

[0052] instrument

[0053] Instrument Name company model Laser confocal microscope Nikon Corporation, Japan Ti2 optical microscope Nanjing Jiangnan Yongxin Optics Co., Ltd. XD-202 37℃ constant temperature chamber bluepard BPN-150CW(UV) 96-well plate microplate reader Thermo Fisher Scientific Varioskan LUX Micro UV-Vis spectrophotometer Eppendorf Biospectrometer basic Gradient PCR instrument Lept Scientific Instruments (Beijing) Co., Ltd. L9800E Real-time PCR instrument Singapore Life StepOnePlus

[0054] Example 1, Sample Collection

[0055] Ten patients with pathologically confirmed endometriosis (ovarian type) who were hospitalized at Shijiazhuang People's Hospital between June 2021 and October 2024 were selected. They were staged according to the American Fertility Society's revised staging criteria (r-AFS), and the case group was classified as stage III-IV endometriosis (ovarian type). Ectopic endometrium (EC) tissue was collected. The control group consisted of relatively normal endometrial tissue in situ. "Situ" refers to endometrial tissue in patients with endometriosis that has not migrated to the ovaries or other sites; this tissue remains in the endometrium without abnormal proliferation or migration activity, and therefore serves as a control for ectopic tissue.

[0056] 1. Ethics and Informed Consent

[0057] This study has been approved by the Medical Research Ethics Committee of Shijiazhuang People's Hospital (Hospital Ethics Review). <2021> (No. 402) All participants signed written informed consent forms.

[0058] 2. Patient screening and information recording

[0059] 2.1 Inclusion criteria:

[0060] —The surgical indications are clear (cyst diameter ≥4cm, combined with infertility, pain symptoms and ineffective drug treatment);

[0061] —Her menstrual cycle has been regular in the past, and she has no other medical or surgical complications;

[0062] —No hormone therapy (such as GnRH-a, progesterone, etc.) was received within 6 months prior to the operation to avoid interference with cell state by the drugs;

[0063] —All patients included in the study underwent surgery during the secretory phase of their menstrual cycle (determined based on the date of their last menstrual period and pathological characteristics) and were diagnosed with ovarian endometriotic cysts [patients with endometriosis (ovarian type)];

[0064] —When the age difference is within 3 years, the clinical indications, examinations and pathological degrees are similar. This is because the cell activity and growth capacity of samples from different patients and different menstrual cycles vary greatly.

[0065] 2.2 Information Recording: Record detailed patient information, menstrual cycle, surgery date, pathological diagnosis, rASRM staging, etc.

[0066] 3. Intraoperative sample collection

[0067] 3.1 Timing: Immediately after complete laparoscopic dissection or removal of the ovarian chocolate cyst.

[0068] 3.2 Aseptic technique: Strictly follow aseptic principles and prepare physiological saline and culture medium containing penicillin and streptomycin.

[0069] 3.3 Obtaining a sample: A typical piece of cyst wall tissue rich in ectopic endometrium is excised from the removed cyst wall by a gynecologist. Usually, the area with the thickest lining and the most typical color of the cyst wall is selected.

[0070] 4. Avoid contamination: Avoid contact with tissues damaged by energy devices such as electrocoagulation or ultrasonic scalpels, as the cells in these areas have become inactive. Also, avoid contamination with blood or ovarian cortex tissue.

[0071] 5. Labeling: Place the sample in a sterile, pre-labeled container. The label should include: patient ID, sample type ("ectopic ovarian endometrium"), collection date and time.

[0072] 6. Sample transportation

[0073] 6.1 Transport Solution: Immediately immerse the sample in pre-cooled (4°C) sterile transport solution / culture medium or physiological saline. (Transport solution: phosphate-buffered saline containing 1% penicillin-streptomycin or Hank's balanced salt solution.)

[0074] Note: Do not use serum-containing culture medium as a transport medium, as components in serum may activate cells during transport and affect subsequent separation.

[0075] 6.2 Timeliness: Samples should be sent to the laboratory immediately after collection. The entire process should ideally be completed within 1 hour, and at most within 2 hours, to ensure cell viability.

[0076] This part is the cornerstone of the entire experiment; the quality of the sample directly determines the success or failure of subsequent experiments.

[0077] Example 2: Isolation and Culture of Primary Endometrial Stromal Cells

[0078] 1. Tissue processing and digestion

[0079] 1.1 Cleaning: Place the tissue sample in a sterile culture dish containing PBS and rinse 2-3 times with PBS to remove residual blood and dirt.

[0080] 1.2 Cutting: Using sterile ophthalmic scissors or a scalpel, cut the tissue into tiny pieces of about 1 mm³. The smaller the tissue, the higher the digestion efficiency.

[0081] 1.3 Enzymatic Digestion: Transfer the minced tissue to sterile 15 mL or 50 mL centrifuge tubes. Add preheated collagenase solution. Formulation: 0.1%-0.2% (w / v) type I or type IV collagenase, dissolved in DMEM / F12 medium, and add 0.01%-0.02% DNase I (used to degrade DNA released from cell death and reduce cell clumping).

[0082] 1.4 Digestion conditions: Place the centrifuge tubes in a 37°C water bath or a constant temperature shaker and gently shake or rotate for 60-90 minutes to digest.

[0083] 1.5 Observation: Remove the tissue block every 20 minutes and observe the digestion process under a microscope. Stop digestion when the tissue block is basically dispersed into a cell suspension.

[0084] 2. Cell purification and separation: The digested mixture contains endometrial stromal cells and endometrial glandular epithelial cells.

[0085] 2.1 Termination of digestion: Add an equal volume of complete culture medium containing 10% fetal bovine serum. The components in the serum will inhibit collagenase activity.

[0086] 2.2 Filtration: The cell suspension was filtered through a 70μm sterile cell sieve to remove large, undigested tissue fragments.

[0087] 2.3 Centrifugation: Centrifuge the filtrate at 300-400g (about 1000rpm) for 5 minutes at room temperature.

[0088] 2.4 Resuspension: Discard the supernatant and gently resuspend the cell pellet in 5-10 mL of complete culture medium (e.g., DMEM / F12 + 10% FBS + 1% P / S).

[0089] 2.5 Differential wall-attaching method for ESC separation

[0090] 2.5.1 Principle: Interstitial cells adhere to the wall faster than glandular epithelial cells.

[0091] 2.5.2 Procedure: Inoculate the cell suspension into a culture dish and incubate at 37°C in a 5% CO2 incubator for 30-60 minutes.

[0092] 2.5.3 Collecting ESCs: At this point, most of the stromal cells have adhered to the culture medium, while the glandular epithelial cells remain suspended in the medium. Gently aspirate the culture medium (which is rich in glandular epithelial cells) and discard it or use it for other studies.

[0093] 2.5.4 Washing: Gently rinse the culture dish twice with PBS to remove any remaining unattached cells.

[0094] 2.5.5 Add fresh culture medium: Add fresh complete culture medium to the adherent mesenchymal cells.

[0095] 3. Primary cell culture

[0096] 3.1 Culture conditions: Place the petri dishes back into the incubator and culture them at 37℃ and 5% CO2.

[0097] 3.2 First medium change: After 24 hours of culture, perform the first medium change to remove non-adherent dead cells and impurities.

[0098] 3.3 Subsequent medium changes: Thereafter, the culture medium should be changed every 3 days.

[0099] 3.4 Observation: Observe cell morphology and growth daily under an inverted microscope. Healthy ESCs are usually spindle-shaped, spreading out like fibroblasts.

[0100] 4. Cell passage and identification

[0101] 4.1 Passaging: When the cell confluence reaches 80%-90%, passage can be performed. Digest the cells with 0.05% trypsin-EDTA and aliquot them into new culture dishes at a ratio of 1:2 or 1:3. Primary cells (P0) are usually designated as P1 after passage.

[0102] 4.2 Identification: To confirm that the cultured cells are indeed endometrial stromal cells, cell identification is performed. Morphology: Observe the typical spindle-shaped morphology. Immunocytochemistry / immunofluorescence: Detect cell markers. Positive markers: Vimentin, CD10. Negative markers: Cytokeratin (epithelial cell marker).

[0103] 5. Key Considerations and Challenges

[0104] 5.1 Record the proliferation time and cycle of isolated cells, and select cells with basically the same proliferation cycle for experiments.

[0105] 5.2 Cell Purity: Differential adhesion cannot achieve 100% purification, and a small amount of glandular epithelial cell contamination may still remain. During cell processing, the research group improved purity by repeatedly performing differential adhesion or flow cytometry sorting. Simultaneously, during the amplification process, glandular epithelial cell contamination was further removed by adjusting cell amplification and trypsin digestion times, and a culture system specific to mesenchymal cells was selected for amplification of mesenchymal cells.

[0106] 5.3 Cell senescence: Primary cells isolated from this disease have a limited number of passages (usually cells at passages 5-8 are most suitable for subsequent experimental studies). As the number of passages increases, they enter a senescent state and are no longer suitable for experiments. Therefore, the research group chose to use low-passage cells (P2-P4 passages) for experiments.

[0107] 5.4 Contamination Control: Strict aseptic techniques are maintained throughout the entire process to prevent bacterial, fungal, or mycoplasma contamination, which is crucial for successful cell culture. Therefore, from clinical sample collection to aseptic processing in the laminar flow hood, we add penicillin and streptomycin antibiotics at higher concentrations than those used in cell culture to reduce the risk of tissue contamination.

[0108] Example 3: RT-qPCR detection of miR-2355-3p RNA transcription levels in ectopic endometrial tissue and normal endometrial tissue in ovarian endometriosis.

[0109] Tissue samples were placed in a glass homogenizer, 1 mL of physiological saline was added, and the homogenizer was used on ice to grind the tissue into small pieces. Total RNA was extracted from the tissue samples using Trizol reagent. RNA was quantified using a micro-volume UV-Vis spectrophotometer. 2000 ng of RNA was reverse transcribed into cDNA using Tiangen's reverse transcription kit. cDNA, qPCR primers, 2x SuperReal PreMix Plus reagent (Tiangen's SuperReal PreMix Plus (SYBR Green) SuperReal PCR premixed reagent), and RNase-free dd H2O were added to a 96-well plate. The 96-well plate was then placed in a qPCR instrument, the parameters were set, and the instrument was started.

[0110] RT-qPCR was used to detect the RNA transcription level of miR-2355-3p in 10 normal endometrial tissues (NC) and 10 ectopic endometrial tissues (EC) from patients with endometriosis (ovarian type). The results showed that the relative expression level of miR-2355-3p in the NC group was (1.21±1.03), while that in the EC group was (0.3±0.36). Compared with normal endometrium, the RNA transcription level of miR-2355-3p in ectopic endometrial tissue was significantly decreased, and the difference was statistically significant (P<0.05). Figure 1 .

[0111] Example 4: Overexpression of miR-2355-3p and verification of transfection efficiency

[0112] 1. miR-2355-3p primers

[0113] The miR-2355-3p primers were synthesized by Shanghai Sangon Biotech Co., Ltd., and the primer sequences are as follows:

[0114] miR-2355-3p

[0115] F:5'-CGCGATTGTCCTGCTGTTT-3' (SEQ ID NO:3)

[0116] R:5'-GTCGTATCCAGTGCTCCGAGGTATTCGCACTGGATACGACA

[0117] TCTCC-3' (SEQ ID NO:4)

[0118] GAPDH

[0119] F:5'-AGGGGGAGCGAGATCCCTCCAAAAT-3' (SEQ ID NO:5)

[0120] R:5'-GGCTGTTGTCATACTTCTCATGG-3' (SEQ ID NO:6)

[0121] 2. Cell Culture

[0122] Primary endometrial stromal cells isolated from ectopic endometrial tissue of patients with endometriosis were cultured in DMEM-F12 medium containing 10% fetal bovine serum and 1% secondary antibody at 37°C in a 5% CO2 incubator. Cells were digested with 0.125% trypsin and passaged. The medium was changed according to growth status, and cells in the logarithmic growth phase were used for subsequent experiments. The experimental method was the same as in Example 1.

[0123] 3. Cell transfection

[0124] We designed a mimics RNA sequence targeting miR-2355-3p to overexpress miR-2355-3p. The nucleotide sequence of the miR-2355-3p mimics RNA is: ATTGTCCTTGCTGTTTGGAGAT (SEQ ID NO:1). It was cloned into the lentiviral vector GV209. A schematic diagram of the structure of the lentiviral vector GV209 is shown below. Figure 2 As shown, the virus was packaged into a lentivirus to obtain miR-2355-3pmimic lentivirus; a control NC mimics RNA lentivirus was packaged simultaneously, and the nucleotide sequence of the control NC mimics was: TTCTCCGAACGTGTCACGT (SEQ ID NO:2), thus obtaining the NC mimic lentivirus.

[0125] The day after cell seeding, miR-2355-3p mimic lentivirus and NC mimic lentivirus were transfected into endometrial stromal cells, respectively. According to the calculated viral load, the virus was added to serum-free medium. The old medium was discarded and replaced with serum-free medium containing the virus. The cells were cultured in an incubator for 24 hours. After 24 hours, the virus-containing medium was discarded and replaced with fresh serum-containing complete medium. The cells were cultured for another 48 hours before the samples were collected for subsequent experiments.

[0126] 4. RT-qPCR to verify transfection efficiency

[0127] The experimental method is the same as in Example 2.

[0128] Transfection efficiency was verified by RT-qPCR 48 h post-transfection. The results showed that the relative expression level of miR-2355-3p in the NC mimics group was (1±0.08), and the relative expression level of miR-2355-3p in the mimics group was (31.52±1.71).

[0129] Compared with NC mimics, transfection with miR-2355-3p mimics significantly increased the transcriptional level of miR-2355-3p RNA (P < 0.0001). Figure 3 This confirms that the transfection was effective.

[0130] Example 5: EdU experiment to investigate the effect of miR-2355-3p overexpression on the proliferation rate of ectopic endometrial tissue cells.

[0131] 1. Method

[0132] 1) Transfect ectopic endometrial stromal cells with miR-2355-3p mimic lentivirus and NC mimic lentivirus respectively. After 48 hours of transfection, the cells were seeded into 6-well plates and cultured overnight until they returned to normal (density of about 70%). An equal volume of 2X EdU working solution (20 μM) preheated at 37ºC was added to the 6-well plates to make the final EdU concentration in the 6-well plates 1X. The cells were incubated for another 2 hours. The transfection method was the same as in Example 4.

[0133] 2) Fixation and permeabilization: After incubation, remove the culture medium and add 1 mL of PBS containing 4% paraformaldehyde to each well. Incubate at room temperature for 15 min, then wash each well three times with 1 mL of PBS for 3-5 min each time. Remove the PBS and incubate each well with 1 mL of PBS containing 0.3% Triton X-100 at room temperature for 10-15 min. Remove the permeabilization solution again and wash each well 1-2 times with 1 mL of PBS for 3-5 min each time.

[0134] 3) Fluorescent labeling: Remove PBS, add 0.5 mL of the prepared Click reaction solution to each well, gently shake the culture plate to ensure the reaction mixture can evenly cover the sample, and incubate at room temperature for 30 min without contraception. Aspirate the Click reaction solution and wash three times with PBS, 3-5 min each time.

[0135] 4) Nuclear staining: Add 1 ml of prepared 1×Hoechst 33342 solution to each well and incubate at room temperature for 10 min. Discard the supernatant and wash three times with PBS for 3-5 min each time.

[0136] 5) Subsequently, fluorescence detection was performed. Hoechest33342 showed blue fluorescence with a maximum excitation wavelength of 346 nm and a maximum emission wavelength of 460 nm.

[0137] 2. Results

[0138] EdU experimental results are as follows Figure 4 As shown, compared with the control group (NC mimics group), the proliferation rate of miR-2355-3p mimic group (overexpressing miR-2355-3p group) was significantly reduced, P<0.001.

[0139] Example 6: CCK-8 assay to investigate the effect of miR-2355-3p overexpression on the proliferative activity of ectopic endometrial tissue cells.

[0140] 1. Method

[0141] The ectopic endometrial stromal cells were transfected with miR-2355-3p mimic lentivirus and NCmimic lentivirus, respectively, using the same transfection method as in Example 4. The transfected cells were seeded at an average density of 2 × 10³ cells per well in a 96-well plate. After cell adhesion, CCK8 working solution (10 μL CCK8 stock solution + 100 μL serum-free medium) was prepared, and 110 μL of CCK8 working solution was added to each well at 0 h, 24 h, 48 h, and 72 h. The cells were incubated at 37°C for 1.5 h, and the absorbance was read at 450 nm using a 96-well plate reader.

[0142] 2. Results

[0143] The results of the CCK-8 experiment are as follows: Figure 5 At 450 nm, compared with the control group (NC mimics group), the proliferation activity of miR-2355-3p mimic group cells was significantly reduced at 72 hours (P < 0.0001).

[0144] Example 7: TUNEL assay to investigate the effect of miR-2355-3p overexpression on the apoptosis index of ectopic endometrial tissue cells.

[0145] 1. Method

[0146] Ectopic endometrial stromal cells layered on slides were transfected with miR-2355-3p mimic lentivirus and NC mimic lentivirus, respectively, using the same transfection method as in Example 4. After transfection, cells were washed with PBS, fixed with 4% paraformaldehyde for 30 min, washed again with PBS, and incubated at room temperature for 5 min with PBS containing 0.3% Triton X-100. 50 μL of TUNEL assay solution was added, and the cells were incubated at 37°C in the dark for 60 min. The cells were washed three times with PBS. The excitation wavelength of Cy3 was 550 nm, and the emission wavelength was 570 nm (red fluorescence). After mounting with anti-fluorescence quenching mounting medium, the cells were observed under a laser confocal microscope.

[0147] 2. Results

[0148] The results of the TUNEL experiment are as follows: Figure 6 Compared with the NC mimics group, the apoptosis index of cells in the miR-2355-3p mimic group was significantly increased (P < 0.0001).

[0149] Example 8: Transwell assay to investigate the effect of miR-2355-3p overexpression on the number of ectopic endometrial tissue cells that have crossed the membrane.

[0150] 1. Method

[0151] Ectopic endometrial stromal cells were transfected with miR-2355-3p mimic lentivirus and NCmimic lentivirus, respectively, using the same transfection method as in Example 4. Cell migration assays (2 × 10⁵ cells / well) were performed using Transwell chambers. 100-200 μL of diluted Matrigel was vertically added to the center of the bottom of the upper chamber and incubated at 37°C for 5 h until it dried into a gel. Cells were suspended in serum-free medium (200 μL) in the upper chamber, while the lower chamber contained medium supplemented with FBS. After incubation for 24 h and 48 h, cells that had migrated through the membrane were washed with PBS, fixed in 4% paraformaldehyde for 30 min, and stained with 0.1% crystal violet for 30 min. The stained chambers were washed twice with double-distilled water, excess cells were scraped off with cotton swabs, and the chambers were inverted on absorbent paper to air dry. The outer walls of the chambers were marked. Cells were observed and counted using an optical microscope.

[0152] 2. Results

[0153] Transwell experimental results are as follows: Figure 7Compared with the NC mimics group, the number of cells that penetrated the membrane in the miR-2355-3p mimic group was significantly reduced (P < 0.0001).

[0154] Example 9: JC-1 assay to detect the effect of miR-2355-3p overexpression on mitochondrial membrane potential

[0155] 1. Method

[0156] The prepared ectopic endometrial stromal cells were transfected with miR-2355-3p mimic lentivirus and NC mimic lentivirus, respectively, using the same transfection method as in Example 4. After aspirating the culture medium, the cells were washed with PBS, and 1 mL of JC-1 staining working solution was added and thoroughly mixed. The cells were incubated at 37°C for 20 min. The supernatant was aspirated, and the cells were washed twice with JC-1 staining buffer. 2 mL of cell culture medium was added, and images were taken using a laser confocal microscope.

[0157] 2. Results

[0158] JC-1 test results are as follows Figure 8 Compared with the NC mimics group, the red fluorescence intensity (JC-1 focus) in the miR-2355-3p mimic group was significantly weakened, while the green fluorescence intensity (JC-1 monomer) was significantly enhanced, suggesting that miR-2355-3p mimics can induce a decrease in mitochondrial membrane potential and apoptosis.

[0159] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

[0160] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. The use of mimics RNA for overexpressing miR-2355-3p in the preparation of a drug for treating endometriosis, characterized in that, The nucleotide sequence of the mimics RNA is shown as SEQ ID NO:

1.

2. Use according to claim 1, wherein The application adopts a lentivirus transfection method, and steps of the lentivirus transfection method are as follows: the mimics RNA is cloned into a lentivirus vector GV209, lentivirus packaging is performed, miR-2355-3p mimic lentivirus is obtained, and the miR-2355-3p mimic lentivirus is used for transfecting ectopic endometrial stromal cells.

3. The use according to claim 1, wherein The endometriosis includes ovarian endometriosis.

4. The use according to claim 1, wherein The mimics RNA reduces a proliferation rate of ectopic endometrial stromal cells.

5. The use according to claim 1, wherein the compound is ###0002### The mimics RNA reduces proliferation activity of ectopic endometrial stromal cells.

6. The use according to claim 1, wherein The mimics RNA promotes apoptosis of ectopic endometrial stromal cells.

7. The use according to claim 1, wherein The mimics RNA reduces a number of ectopic endometrial stromal cells penetrating a membrane.

8. The use according to claim 1, wherein The mimics RNA induces a decrease of a mitochondrial membrane potential of ectopic endometrial stromal cells. The nucleotide sequence of the mimics RNA is shown as SEQ ID NO:

1. The application adopts a lentivirus transfection method, and steps of the lentivirus transfection method are as follows: the mimics RNA is cloned into a lentivirus vector GV209, lentivirus packaging is performed, miR-2355-3p mimic lentivirus is obtained, and the miR-2355-3p mimic lentivirus is used for transfecting ectopic endometrial stromal cells. The endometriosis includes ovarian endometriosis. The mimics RNA reduces a proliferation rate of ectopic endometrial stromal cells. The mimics RNA reduces proliferation activity of ectopic endometrial stromal cells. The mimics RNA promotes apoptosis of ectopic endometrial stromal cells. The mimics RNA reduces a number of ectopic endometrial stromal cells penetrating a membrane. The mimics RNA induces a decrease of a mitochondrial membrane potential of ectopic endometrial stromal cells.

Citation Information

Patent Citations

  • Biomarker for diagnosis and treatment of renal clear cell carcinoma

    CN107586842A

  • Method for revealing action mechanism of miRNA on liver cancer by using Small RNA sequencing technology

    CN113528669A