Molecular marker and primer group for detecting high-molecular-weight glutenin subunit of wheat and application of molecular marker and primer group

Abstract

The invention discloses a molecular marker and a primer group for detecting high-molecular-weight glutenin subunits of wheat and application of the molecular marker and the primer group, and belongs to the technical field of molecular marker-assisted breeding. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.3, and T / A mutation exists at the 21st base of the molecular marker; the wheat high-molecular-weight glutenin subunit of which the mutation site is T is Ax1, and the wheat high-molecular-weight glutenin subunit of which the mutation site is A is Ax2 *. The specific KASP molecular marker is developed on the basis of variation sites of Ax1 and Ax2 * subunit gene coding regions in a wheat genome, the Ax1 and Ax2 * subunit types of the wheat high-molecular-weight glutenin can be detected by utilizing the molecular marker, the identification result is accurate and reliable, the repeatability is good, the identification process of the high-molecular-weight glutenin subunit in wheat offspring is greatly simplified, and the application prospect is wide. And the identification efficiency and accuracy are improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular marker assisted breeding, in particular to a molecular marker for detecting high molecular weight glutenin subunit of wheat, a primer set and application thereof. BACKGROUND

[0002] Wheat (Triticum aestivum L.) is an important staple crop, and its quality is one of the important breeding objectives. Wheat can be processed into bread, steamed buns, noodles, cakes, biscuits and other flour foods due to its unique gluten protein in the grain. Gluten protein is the main storage protein in wheat grain, which is composed of glutenin and prolamin; among them, high molecular weight glutenin (HMW-GS) has a small content, but it is the main determinant of dough elasticity, and the variation of its content and composition has a great impact on quality. The HMW-GS of wheat is controlled by Glu-A1, Glu-B1 and Glu-D1 three loci, and each locus contains multiple different allelic variation types. Among them, Ax1 at Glu-A1 locus, Bx7+By8 and Bx17+By18 at Glu-B1 locus, and Dx5+Dy10 at Glu-D1 locus are all recognized as high-quality subunits, which are positively correlated with better gluten strength and processing quality. Therefore, they are also favored in high-quality wheat breeding.

[0003] Sichuan wheat variety Chuanmai 104 (HMW-GS composition: Ax1, Bx6+By8, Dx5+Dy10) and Canadian super gluten wheat Glenlea (HMW-GS composition: Ax2 * , Bx7 OE +By8, Dx5+Dy10, wherein Bx7 OE is overexpressed Bx7 subunit, which gives stronger gluten quality) were crossed and continuously selfed. It is hoped to screen excellent lines with HMW-GS composition (Ax1, Bx7 OE +By8, Dx5+Dy10) in the hybrid offspring population, and further improve the quality of wheat by the aggregation of multiple high-quality subunits.

[0004] The commonly used method for wheat high molecular weight glutenin subunit is polyacrylamide gel electrophoresis (SDS-PAGE) method, which has large workload and long cycle, and can only be detected and screened after the next generation seed is harvested, which seriously restricts the breeding efficiency. While PCR technology has the characteristics of less time and high sensitivity, and can greatly shorten the time and improve the screening efficiency by developing specific molecular markers for distinguishing and identifying according to the difference of gene sequence. Therefore, it is necessary to develop a molecular marker that can quickly and accurately identify the phenotype of high molecular weight glutenin subunit Ax1 and Ax2 * . SUMMARY

[0005] The application aims to provide a molecular marker for detecting a wheat high-molecular-weight glutenin subunit, a primer set and application thereof, to solve the problems in the prior art. * The application is based on the variation sites in the coding regions of Ax1 and Ax2 * subunit genes in the wheat genome, and a specific KASP molecular marker is developed, which can be used to detect the Ax1 and Ax2 *

[0006] To achieve the above-mentioned purpose, the application provides the following solutions.

[0007] The application provides a molecular marker for detecting a wheat high-molecular-weight glutenin subunit, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 3, wherein a T / A mutation exists at the 21st base.

[0008] The wheat high-molecular-weight glutenin subunit with the mutation site T is Ax1, and the wheat high-molecular-weight glutenin subunit with the mutation site A is Ax2 * .

[0009] The application also provides application of the above-mentioned molecular marker in preparation of a product for detecting a wheat high-molecular-weight glutenin subunit.

[0010] The application also provides a KASP primer set for detecting the above-mentioned molecular marker, wherein the primer set comprises KASP-Ax-T shown in SEQ ID NO. 4, KASP-Ax-A shown in SEQ ID NO. 5 and KASP-Ax-R shown in SEQ ID NO. 6.

[0011] The application also provides a kit for detecting a wheat high-molecular-weight glutenin subunit, wherein the kit comprises the above-mentioned KASP primer set.

[0012] The application also provides application of the above-mentioned molecular marker, the above-mentioned KASP primer set or the above-mentioned kit in detection of a wheat high-molecular-weight glutenin subunit.

[0013] The application also provides a method for detecting a wheat high-molecular-weight glutenin subunit, comprising the following steps.

[0014] Using the KASP primer set or the kit as described above to perform PCR amplification on the template of the wheat genomic DNA to be detected; and determining the type of the high-molecular-weight glutenin subunit of the wheat to be detected according to the fluorescence signal of the amplification product.

[0015] When the amplification product carries a FAM fluorescence signal, the high molecular weight glutenin subunit of the wheat to be tested is Ax1;

[0016] When the amplification product carries a HEX fluorescence signal, the high molecular weight glutenin subunit of the wheat to be tested is Ax2 * .

[0017] Optionally, the reaction system of the PCR amplification is as follows: template 50 ng, 2xMaster Mix V1 5 μL, KASP-Ax-T 0.1 μL, KASP-Ax-A 0.1 μL, KASP-Ax-R 0.3 μL, and ddH2O to 10 μL.

[0018] Optionally, the reaction procedure of the PCR amplification is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 58℃ annealing for 40 s, 10 cycles, and the annealing temperature decreases by 0.6℃ for each cycle; 95℃ denaturation for 20 s, 55℃ annealing for 40 s, 30 cycles.

[0019] The application further provides application of the above molecular marker, the above KASP primer set or the above kit in wheat molecular marker assisted breeding.

[0020] The application discloses the following technical effects:

[0021] The application is based on variation sites in coding regions of Ax1 and Ax2 * subunit genes in a wheat genome, and a specific KASP molecular marker is developed by using a PCR technique. * The KASP marker can be used to identify the genotype of a high molecular weight glutenin Ax subunit of wheat to be tested, and is used to distinguish the high molecular weight glutenin Ax1 and Ax2

[0022] The molecular marker of the application is not only suitable for scientific research experiments, but also suitable for wheat quality breeding practice, improves the operability in breeding work, saves a large amount of time, and shortens the breeding period. When the offspring of hybridization of materials in different genetic backgrounds needs to be backcrossed or hybridized to purify the background for multiple times, the KASP marker can be used to quickly identify the glutenin Ax subunit phenotype, and the offspring single plants are screened, so that the workload is greatly reduced. Therefore, the application provides a new genetic resource, an effective molecular marker and powerful technical support for wheat quality breeding. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings described below only show some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from these drawings without creative effort.

[0024] Figure 1 SDS-PAGE detection map of CM104 and Glenlea seeds;

[0025] Figure 2 Agarose gel electrophoresis detection map of Ax gene amplification products in CM104 and Glenlea;

[0026] Figure 3 Alignment results of partial nucleotide sequences of Ax gene coding regions in CM104 and Glenlea; the red circle is the position of the developed KASP marker;

[0027] Figure 4 KASP-Ax molecular marker genotyping results in CM104, Glenlea and their hybrid F1 generation; orange represents T / T genotype, blue represents A / A genotype, green represents T / A genotype, and black represents blank control;

[0028] Figure 5 KASP-Ax molecular marker genotyping results in part of single plants in (CM104 / Glenlea) F4 population; orange represents T / T genotype, blue represents A / A genotype, and black represents blank control;

[0029] Figure 6 F4 population in (CM104 / Glenlea) F4 population 4：5 SDS-PAGE detection results of grains. DETAILED DESCRIPTION

[0030] The detailed description set forth below will explain the various exemplary embodiments of the present application, but is not intended to limit the present application. Rather, the detailed description is meant to describe certain aspects, features, and embodiments of the present application.

[0031] It should be understood that the terms used in the present application merely describe particular embodiments and are not intended to limit the present application. In addition, for the numerical ranges in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range within any stated value or stated range, and any other stated value or intermediate value within the stated range, is also included within the present application. The upper limit and the lower limit of these smaller ranges can be included or excluded independently from the range.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as those commonly understood by one of ordinary skill in the art to which this application pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not an admission that it is prior art with respect to the present application. All literature and similar materials cited in this application, including but not limited to, patents, genetic code, scientific and / or technical articles, are expressly incorporated by reference.

[0033] Many modifications and variations of this application of the application can be made without departing from its spirit or scope, which will be apparent to those skilled in the art. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is to be understood that the application is not limited in scope by the

[0034] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed materials and / or methods.

[0035] Example 1 Cloning and sequence analysis of Ax gene

[0036] The high molecular weight glutenin subunit phenotypes of the seeds of the wheat varieties CM104 and Glenlea are shown in Table 1. Figure 1 Using the reference genome sequence information, a specific primer AxF2 / R2 was designed according to the coding region sequence of the high molecular weight glutenin subunit Ax gene, and the sequences are as follows:

[0037] AxF2: CCACACTTCTGGAAACAATACAC; SEQ ID NO. 1;

[0038] AxR2: GCATCATTACTGGGCTTTACATT; SEQ ID NO. 2.

[0039] High-quality genomic DNA of CM104 and Glenlea was extracted using the CTAB method, dissolved with ddH2O, and diluted to a template concentration of 150-200 ng / μL. The full-length sequence of the Ax gene coding region was amplified using the DNA of CM104 and Glenlea as templates and 2xT5 SuperPCR Mix (Basic) high-fidelity enzyme, and the PCR reaction mixture was prepared. The corresponding cycle program was set in the PCR instrument for amplification. The reaction system is shown in Table 1, and the reaction program is shown in Table 2. The specific amplification product was obtained (Fig. 1). Figure 2 ).

[0040] Table 1 PCR reaction system

[0041]

[0042] Table 2 PCR amplification procedure

[0043]

[0044] The amplified products of the two wheat were sent to the company for sequencing, and the sequences of the coding region of CM104 and Glenlea Ax gene were obtained respectively. Sequence alignment in DNA MAN software found that there were many mutations in the nucleotide sequences of Ax gene in CM104 and Glenlea Figure 3 ).

[0045] Example 2 Development of KASP-Ax molecular marker and establishment of detection method

[0046] 1. Development of KASP-Ax molecular marker

[0047] According to the sequence alignment results of CM104 and Glenlea Ax gene Figure 3 ), according to the 1953bp T / A single base mutation site (21st of SEQ ID NO. 3), a set of KASP-Ax-T / A / R primers were designed.

[0048] Table 3 Detection primers of KASP-Ax molecular marker

[0049]

[0050] 2. Establishment of KASP detection method

[0051] Genomic DNA was extracted from CM104 and Glenlea and their hybrid F1 generation as template. The designed KASP-Ax-T / A / R primers were used for PCR amplification, the reaction system was shown in Table 4, and the reaction procedure was shown in Table 5. The PCR products needed to be stored at 4℃ in the dark.

[0052] Table 4 PCR amplification reaction system

[0053]

[0054] Table 5 PCR amplification reaction procedure

[0055]

[0056] After PCR amplification, genotyping can be performed based on fluorescence signals using real-time quantitative instruments commonly used in the field, such as the Bio-Rad C1000 Touch Thermal Cycler. Then, commonly used fluorescence typing software, such as the Bio-Rad CFX Maestro software, is used to read the typing data.

[0057] Genotyping was performed based on the fluorescence signal of the PCR amplification products, and the results are as follows: Figure 4 As shown, PCR amplification products carrying the fluorescent sequence FAM are represented in orange, and PCR amplification products carrying the fluorescent sequence HEX are represented in blue. If the result is orange, then the 1953rd nucleotide of the Ax gene in the tested wheat is T. This wheat genotype is called the T / T genotype. If the result is blue, then the 1953rd nucleotide of the Ax gene in the tested wheat is A. This wheat genotype is called the A / A genotype. If the result is green, then the 1953rd nucleotide of the Ax gene in the tested wheat is T / A. This wheat genotype is called the T / A genotype.

[0058] from Figure 4 It can be seen that the genotypes of CM104 are all T / T, the genotypes of Glenlea are all AA, and the genotypes of the F1 generation are all T / A. This indicates that the KASP molecular marker and its specific primers of this invention can accurately distinguish the Ax genotype of wheat. Based on the fluorescence signal of the PCR product, the type of nucleotide at position 1953 of the Ax gene of the wheat to be identified can be determined, thereby identifying the SDS-PAGE phenotype of the high molecular weight glutenin Ax subunit of wheat.

[0059] Example 3: Application of KASP-Ax molecular markers in the identification of hybrid offspring

[0060] CM104 and Glenlea were crossed to obtain F1 generation seeds. After three generations of self-pollination of the F1 generation, F4 seeds were obtained and planted to form the F4 population. The F4 population plants and their F1 generation were then analyzed. 4：5 The seeds were identified using KASP typing and SDS-PAGE techniques.

[0061] First, DNA was extracted from the leaves of F4 individual plants, and the mutation sites were detected using the KASP detection method established in Example 2. Figure 5 This presents the genotyping results of some F4 individual plants. Then, at maturity, F4 wheat plants with the T / T genotype (plant numbers CG-7-1 and CG-85-1, respectively) and the A / A genotype (plant numbers CG-37-1 and CG-119-1, respectively) identified by KASP genotyping were harvested. 4:5Seed, randomly select 3 seeds per plant, after grinding, extract high molecular weight glutenin to detect by SDS-PAGE technology. Figure 6 F4 generation of F 4：5 The detection results of grain HMW-GS. The HMW-GS composition of CG-7-1, CG-85-1, CG-37-1 and CG-119-1 is (1, 7 OE +8, 5+10), (1, 6+8, 5+10), (2 * ,7 OE +8, 5+10), (2 * , 6+8, 5+10) respectively. It can be seen that the KASP typing results are consistent with the HMW-GS phenotype identified by SDS-PAGE method. It shows that the KASP marker of the application is indeed suitable for detecting the phenotype of wheat high molecular weight glutenin subunit Ax1 and Ax2*.

[0062] The above results show that the KASP marker of the application can quickly and accurately detect the high molecular weight glutenin Ax subunit phenotype of the material to be tested, and can be used as a molecular marker for assisted selection in wheat quality breeding.

[0063] The above-described embodiments are only preferred modes of the application and do not limit the scope of the application. Without departing from the design spirit of the application, various modifications and improvements to the technical solutions of the application made by those skilled in the art shall fall within the protection scope of the claims of the application.

Claims

1. A molecular marker for detecting a high molecular weight glutenin subunit of wheat, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 3, and a T / A mutation exists at the 21st base; The high molecular weight glutenin subunit of wheat with mutation site T is Ax1, and the high molecular weight glutenin subunit of wheat with mutation site A is Ax2 * .

2. Use of the molecular marker of claim 1 in the preparation of a product for detecting the high molecular weight glutenin subunit of wheat.

3. A KASP primer set for detecting the molecular marker of claim 1, characterized in that, The primer set comprises KASP-Ax-T shown as SEQ ID NO. 4, KASP-Ax-A shown as SEQ ID NO. 5 and KASP-Ax-R shown as SEQ ID NO.

6.

4. A kit for detecting a high molecular weight glutenin subunit of wheat, characterized by, The kit comprises the KASP primer set of claim 3.

5. Use of the molecular marker of claim 1, the KASP primer set of claim 3 or the kit of claim 4 in detecting the high molecular weight glutenin subunit of wheat.

6. A method of detecting a high molecular weight glutenin subunit of wheat, characterized by, The method comprises the following steps: PCR amplification is performed on the template of wheat genomic DNA to be tested by using the KASP primer set of claim 3 or the kit of claim 4; and the type of high molecular weight glutenin subunit of the wheat to be tested is determined according to the fluorescence signal of the amplification product; When the amplification product carries a FAM fluorescence signal, the high molecular weight glutenin subunit of the wheat to be tested is Ax1. When the amplification product carries a HEX fluorescent signal, the high molecular weight glutenin subunit of the wheat to be tested is Ax2 * .

7. The method of claim 6, wherein, The reaction system of the PCR amplification is as follows: template 50 ng, 2xMaster Mix V 5 μL, KASP-Ax-T 0.1 μL, KASP-Ax-A 0.1 μL, KASP-Ax-R 0.3 μL, and ddH2O supplemented to 10 μL.

8. The method of claim 6, wherein, The reaction procedure of the PCR amplification is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s, annealing at 58℃ for 40 s, 10 cycles, and decreasing the annealing temperature by 0.6℃ for each cycle; denaturation at 95℃ for 20 s, annealing at 55℃ for 40 s, 30 cycles.

9. Use of the molecular marker of claim 1, the KASP primer set of claim 3 or the kit of claim 4 in wheat molecular marker assisted breeding.

Images