Screening and application of fluorescent quantitative reference gene in root and stem development process of iris vetiveria

Abstract

The invention discloses screening and application of a fluorescent quantitative reference gene in a root and stem development process of iris vetiveria, and belongs to the technical field of plant genetic engineering. By constructing a strict reference gene evaluation and screening system, the reference gene with the most stable expression in different stages of root and stem development of iris vetiveria is screened out from eight candidate genes for the first time, errors in samples and between samples caused by internal reference selection are remarkably reduced, accurate correction and standardization of the expression level of a target gene are achieved, and the accuracy of the reference gene is improved. And reliable technical guarantee is provided for subsequent large-scale accurate quantitative analysis of irisone synthesis related functional genes.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant molecular biology, and particularly relates to screening and application of fluorescent quantitative internal reference genes in rhizome development of Iris pallida. BACKGROUND

[0002] Iris pallida is a perennial herb of the genus Iris in the family Iridaceae. Iris pallida The underground rhizome of Iris pallida has a woody fragrance similar to violet after natural aging, and can extract iris root oil. As a top-grade fragrance, essential oil, and mask luxury product, the core fragrance component of iris root oil is irone. However, the content of irone in fresh Iris pallida rhizome is extremely low, and needs to be sliced at room temperature, dried, and naturally aged for 2-3 years or even longer to reach the peak content. Limited by the long aging period and the distribution of production areas, the yield of natural irone is low and the price is high, which seriously restricts its industrial application. Therefore, analyzing the molecular mechanism of irone synthesis regulation is the key prerequisite for artificial accelerated aging and breaking through the industrial bottleneck. Screening suitable internal reference genes and using real-time fluorescent quantitative PCR technology to analyze the expression level of related genes in the development process of Iris pallida rhizome can provide important support for elucidating the molecular mechanism of irone synthesis. However, there is no report on the identification of internal reference genes of Iris pallida.

[0003] Real-time fluorescent quantitative PCR has the advantages of high sensitivity, strong specificity, and good repeatability, and has been widely used in medical, microbiological, and agricultural research fields. However, the detection results are easily disturbed by the differences between samples, so internal reference genes are needed for data standardization to correct errors and ensure the accuracy of quantitative data. An ideal internal reference gene should be stably expressed in different developmental stages, tissues, organs, and experimental treatment conditions. However, a large number of studies have shown that there is no universal internal reference gene, therefore, for different species, sample types, and test systems, it is necessary to systematically screen stable internal reference genes for accurate analysis of RT-qPCR.

[0004] Based on the RNA-Seq sequencing results of Iris pallida, eight candidate internal reference genes were selected, and the expression stability of the candidate genes in the development process of rhizome was analyzed and verified from different statistical angles by GeNorm, NormFinder, BestKeeper, and ReFinder algorithms. The present application successfully mined the stable internal reference genes in the development process of Iris pallida rhizome, laying a solid foundation for large-scale analysis of irone synthesis network and molecular breeding in the future. SUMMARY

[0005] The technical problem to be solved by the present application is to systematically screen the most stable internal reference genes in the development process of Iris pallida rhizome, and to lay a foundation for mining irone synthesis key genes in different development periods of Iris pallida rhizome.

[0006] The technical solutions adopted by the present application are as follows: 1. A kind of Iris tectorum rhizome development process fluorescent quantitative internal reference gene screening and application, it is characterized in that, the internal reference gene is EF1 alpha The nucleic acid sequence is as shown in SEQ ID NO.1;The internal reference gene is ACT7 The nucleic acid sequence is as shown in SEQ ID NO.2;The internal reference gene is GAPDH The nucleic acid sequence is as shown in SEQ ID NO.3;The internal reference gene is CYP The nucleic acid sequence is as shown in SEQ ID NO.4;The internal reference gene is UBC7 The nucleic acid sequence is as shown in SEQ ID NO.5;The internal reference gene is TUB The nucleic acid sequence is as shown in SEQ ID NO.6;The internal reference gene is EF1 beta The nucleic acid sequence is as shown in SEQ ID NO.7;The internal reference gene is PGK The nucleic acid sequence is as shown in SEQ ID NO.8.

[0007] 2. As the most preferred, the fluorescent quantitative internal reference gene in the rhizome development process of Iris tectorum of the present application is preferably TUB.

[0008] 3. The present application also includes specific primers for amplifying the real-time fluorescent quantitative internal reference gene of Iris tectorum: The specific primer sequence of the internal reference gene EF1 alpha is: EF1 alpha -F: 5'-CAAACATGGGTAAAGAGAAGATTCA-3'; EF1 alpha -R: 5'-AATTGTAATACCACGCTCCCTCT-3; The specific primer sequence of the internal reference gene ACT7 is: ACT7 -F: 5'-ATTCTGGTGATGGTGTGAGCC-3'; ACT7 -R: 5'-AACTGGTCTTGGAGGTCTCTAGCT-3'; The specific primer sequence of the internal reference gene GAPDH is: GAPDH -F: 5'-TACACTGCTGAAGAAGGGGTGA-3'; GAPDH-R: 5'-TCAAAATAGACCTTCTGTGTGACCT-3'; The specific primer sequence of the internal reference gene CYP is: CYP -F: 5'-TTATCCTAATAGCCCTCCTTCAGTC-3'; CYP -R: 5'-TCAAAACTATGCTCTCCACCGTAT-3'; The specific primer sequence of the internal reference gene UBC7 is: UBC7 -F: 5'-TTATCCTAATAGCCCTCCTTCAGTC-3'; UBC7 -R: 5'-TCAAAACTATGCTCTCCACCGTAT-3'; The specific primer sequence of the internal reference gene TUB is: TUB -F: 5'-TTATCCTAATAGCCCTCCTTCAGTC-3'; TUB -R: 5'-TCAAAACTATGCTCTCCACCGTAT-3'; The specific primer sequence of the internal reference gene EF1 beta is: EF1 beta -F: 5'-TTATCCTAATAGCCCTCCTTCAGTC-3'; EF1 beta -R: 5'-TCAAAACTATGCTCTCCACCGTAT-3'; The specific primer sequence of the internal reference gene PGK is: PGK -F: 5'-TTATCCTAATAGCCCTCCTTCAGTC-3'; PGK -R: 5'-TCAAAACTATGCTCTCCACCGTAT-3'.

[0009] 4. The application of the primer pair in the fluorescence quantitative expression analysis of different development periods (1-year-old, 2-year-old, 3-year-old) and different tissues (root, stem, leaf) of Iris pallida root rhizomes.

[0010] 5. The application of the special primer in the fluorescence quantitative PCR of Iris pallida.

[0011] 6. The method for screening fluorescent quantitative internal reference genes during the development of Iris pallida rhizomes, characterized in that the screening method comprises the following steps: (1) Based on the RNA-Seq sequencing results of Iris pallida, the genes with stable expression are obtained as selected internal reference genes according to the RPKM values of Unigene in the database; (2) The primer for detecting the candidate internal reference genes obtained in step (1) is designed by using Primer Premier 5 respectively; (3) The roots, stems, leaves, 1-year-old, 2-year-old and 3-year-old rhizomes are collected respectively, total RNA is extracted, and cDNA is reverse transcribed, and qPCR amplification is carried out by SYBR Green method; (4) The stability of the candidate genes is comprehensively evaluated by using GeNorm, NormFinder, BestKeeper and ReFinder four software, and the most suitable internal reference or internal reference combination is finally determined.

[0012] 7. The method for screening fluorescent quantitative PCR internal reference genes of Iris pallida according to claim 5, characterized in that in step (3), the conditions of real-time fluorescent quantitative PCR are as follows: the volume of real-time fluorescent quantitative PCR reaction is 20 μL, containing SYBR Premix Ex Taq 10 μL, 1 μL of forward and reverse primers respectively, 5 μL of cDNA template, and 3 μL of ddH2O; the reaction program is 95℃, 3min; 95℃, 10s, 57℃, 15min, 72℃, 20s, 40 cycles; each sample is repeated for 3 times.

[0013] Beneficial effects The application establishes an exclusive internal reference system for Iris pallida for the first time by a strict internal reference gene screening procedure, filling the gap at home and abroad. The application screens the most stable internal reference genes in different periods of rhizome development of Iris pallida from 8 candidate genes by using 4 internal reference analysis software TUB . The introduction of the internal reference can improve the accuracy and reliability of RT-qPCR data of Iris pallida iridone synthesis pathway and development related functional genes, and lay a solid foundation for subsequent molecular mechanism analysis, key gene mining and molecular design breeding. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 It is an agarose gel electrophoresis map of primer specificity of candidate internal reference genes.

[0015] Figure 2 It is a Cq value map obtained by real-time quantitative PCR of candidate internal reference genes.

[0016] Figure 3Figure of the ranking of the expression stability (M) of 8 candidate reference genes by GeNorm software; A: different tissues; B: different development periods of rhizome; C: all samples. DETAILED DESCRIPTION

[0017] The present application is further illustrated in conjunction with the following examples, but is not used to limit the scope of the present application.

[0018] The present application takes silver leaf Iris as the research material, collects total RNA of different development periods (1-year-old, 2-year-old, 3-year-old) and different tissues (roots, stems, leaves) of rhizome immediately, reverses into cDNA, and then performs real-time fluorescence quantitative PCR verification, adopts four software of GeNorm, NormFinder, BestKeeper and ReFinder to analyze the data, so as to screen the most stable expression reference gene of Iris.

[0019] The screening method of fluorescence quantitative reference gene in the development process of rhizome of Iris, comprising the following steps: (1) Based on the RNA-Seq sequencing result of Iris, the genes with stable expression are obtained as selected reference genes according to the RPKM value of Unigene in the database.

[0020] (2) 8 pairs of specific real-time fluorescence quantitative PCR detection primers of Iris are designed by using Primer Premier 5.0 software (Table 1), and the PCR amplification detection of the target fragments is performed. Figure 1 ).

[0021] Table 1 Gene name, primer sequence, amplification length, amplification efficiency and regression coefficient of 8 candidate genes in the present application

[0022] (3) Real-time fluorescence quantitative PCR template preparation: take different development periods (1-year-old, 2-year-old, 3-year-old) and different tissues (roots, stems, leaves) of rhizome, rinse with deionized water, then freeze in liquid nitrogen, and store at -80 °C. Extract total RNA according to the instructions of Beijing Tiangen RNA extraction kit, quantify and detect integrity (A260 / 280 ≈ 1.9-2.1, RIN ≥ 7) by NanoDrop. Take 1 μg of total RNA, reverse transcribe the first strand cDNA by using Maxima Reverse Transcriptase reverse transcription kit (Thermo, EP0743), store at -20 °C for standby, and use as the template for fluorescence quantitative PCR.

[0023] (4) Real-time quantitative PCR: The reaction system was prepared according to the SYBR Green Master (Roche) instructions, with a total volume of 20 μL, containing cDNA template 2 μL, upstream and downstream primers 0.4 μmol·L⁻¹ each. The reaction program was 95 °C for 10 min, 95 °C for 15 s, 60 °C for 30 s, 72 °C for 30 s, 40 cycles; each sample was set with 3 repeats, and the Cq mean value of the internal reference gene was seen Figure 2 .

[0024] (5) GeNorm analysis: GeNorm was used to calculate the expression stability M value of 8 candidate internal references (the smaller the M value, the higher the stability; the upper limit is 1.5). The results showed that, TUB and EF1 beta The M value is the smallest, which is the most suitable internal reference combination ( Figure 3 ).

[0025] (6) NormFinder analysis: NormFinder sorts the stability of 8 candidate internal reference genes by variance analysis, and the smaller the stability value M, the higher the stability of the candidate internal reference gene. The results show that the 8 candidate internal reference genes are ranked in descending order of M value as: ACT7 > CYP > GAPDH > EF1 alpha > PGK > EF1 beta > UBC > TUB (Table 2). Thus, TUB is the most stable, followed by UBC and EF1 beta .

[0026] Table 2 NormFinder software analysis of the expression stability of 8 candidate genes

[0027] (7) BestKeeper analysis: BestKeeper is based on Cq value to obtain the correlation coefficient (r), standard deviation (SD) and coefficient of variation (CV) of each candidate gene to judge its stability. The smaller the SD value, the better the stability, and vice versa. SD < 1 is considered to be stable. The results show that the SD of the 8 genes from large to small is: ACT7 > CYP > GAPDH > EF1 alpha > PGK > UBC7 > EF1 beta > TUB (Table 3).

[0028] Table 3 Stability of eight candidate genes analyzed by BestKeeper software

[0029] (8) ReFinder comprehensive analysis: ReFinder takes the geometric mean of the ranking results of GeNorm, NormFinder and BestKeeper to generate a comprehensive stability index (the smaller the index, the higher the stability). As shown in Table 4, the most stable internal reference gene in the development process of Iris pallida rhizome is TUB , followed by EF1 beta and UBC7 .

[0030] Table 4 Comprehensive ranking of stability of eight candidate genes

Claims

1. A method for screening and application of fluorescent quantitative internal reference genes in development of Iris pallida L. rhizome, characterized in that, The internal reference gene is EF1a with a nucleic acid sequence as shown in SEQ ID NO. 1; the internal reference gene is ACT7 with a nucleic acid sequence as shown in SEQ ID NO. 2; the internal reference gene is GAPDH with a nucleic acid sequence as shown in SEQ ID NO. 3; the internal reference gene is CYP with a nucleic acid sequence as shown in SEQ ID NO. 4; the internal reference gene is UBC7 with a nucleic acid sequence as shown in SEQ ID NO. 5; the internal reference gene is TUB with a nucleic acid sequence as shown in SEQ ID NO. 6; the internal reference gene is EF1b with a nucleic acid sequence as shown in SEQ ID NO. 7; the internal reference gene is PGK with a nucleic acid sequence as shown in SEQ ID NO.

8.

2. The specific primers for the fluorescence quantitative internal reference genes in the development of the roots of Iris pallida in claim 1, characterized in that: The specific primer sequences of the internal reference gene EF1a are as follows: EF1a - F: 5'-CAAACATGGGTAAAGAGAAGATTCA-3'; EF1a - R: 5'-AATTGTAATACCACGCTCCCTCT-3'; The specific primer sequences of the internal reference gene ACT7 are as follows: ACT7 F: 5'-ATTCTGGTGATGGTGTGAGCC-3'; ACT7 - R: 5'-AACTGGTCTTGGAGGTCTCTAGCT-3'; The specific primer sequences of the internal reference genes GAPDH are as follows: GAPDH F: 5'-TACACTGCTGAAGAAGGGGTGA-3'; GAPDH - R: 5'-TTTAGAAACTGCCAGGTTAACTGG-3'; The specific primer sequences of the internal reference gene CYP are as follows: CYP F: 5'- CCAGTCAGCAAACAAAATCTCC -3'; CYP - R: 5'-TCAAAATAGACCTTCTGTGTGACCT-3'; The specific primer sequences of the internal reference gene UBC7 are as follows: UBC7 - F: 5'-TTATCCTAATAGCCCTCCTTCAGTC-3'; UBC7 - R: 5'-TCAAAACTATGCTCTCCACCGTAT-3'; The specific primer sequences of the internal reference gene TUB are as follows: TUB F: 5'-TTGGAGCGATTGTCTGTGGAT-3'; TUB - R: 5'-CAGATGTCATAAATGGCCTCATTAT-3'; The specific primer sequences of the internal reference gene EF1b are as follows: EF1b F: 5'-TGGTGAAGCTGTTGGAGTAAAATAT-3'; EF1b - R: 5'-AAGAACGGAGGATTTCCCACT-3'; The specific primer sequences of the internal reference gene PGK are as follows: PGK - F: 5'- ACTTGATTATCTTGTTGGGGCTG -3'; PGK - R: 5'-CCTTGAGCCTTGTAGAATGTGAAT-3'.

3. The application of the real-time fluorescence quantitative PCR internal reference genes in claim 1 in the fluorescence quantitative expression analysis of different developmental stages (1-year-old, 2-year-old, 3-year-old) and different tissues (roots, stems, leaves) of the roots of Iris pallida.

4. The application of the specific primers in claim 2 in the fluorescence quantitative PCR of Iris pallida.

5. The method for screening the fluorescent quantitative internal reference genes during the development of the roots of the Iris pallida Duby according to claim 1, characterized in that, The screening method comprises the following steps: (1) Based on the RNA-Seq sequencing results of Iris pallida, the genes with stable expression are obtained as selected internal reference genes according to the RPKM values of Unigene in the database; (2) The fluorescence quantitative PCR detection primers are designed for the candidate internal reference genes obtained in step (1) by using Primer Premier 5; (3) The roots, stems, leaves, 1-year-old, 2-year-old, and 3-year-old roots and stems are collected, total RNA is extracted, and cDNA is reverse transcribed, and then SYBR Green method is used for qPCR amplification; (4) The stability of the candidate genes is comprehensively evaluated by using GeNorm, NormFinder, BestKeeper, and ReFinder software, and the most suitable internal reference or internal reference combination is finally determined.

6. The method for screening of the internal reference gene of the fluorescent quantitative PCR of the Iris pallida according to claim 5, characterized in that: In step (3), the conditions of the real-time fluorescence quantitative PCR are as follows: the volume of the real-time fluorescence quantitative PCR reaction is 20 μL, which contains SYBR Premix Ex Taq 10 μL, forward and reverse primers each 1 μL, cDNA template 5 μL, and ddH2O 3 μL; the reaction program is 95℃, 3min; 95℃, 10s, 57℃, 15min, 72℃, 20s, 40 cycles; and each sample is repeated for 3 times.

Images