Engineering bacterium for producing amino sugar intermediate as well as construction method and application of engineering bacterium

By knocking out and overexpressing genes in *Streptomyces hygroscopicus*, engineered strains were constructed, and fermentation conditions were optimized to achieve efficient production of amino sugar intermediates. This solved the problems of high production costs and environmental pollution in existing technologies and met the needs of industrial production.

CN121406544APending Publication Date: 2026-01-27SHANGHAI TECHWELL BIOPHARMACEUTICALS CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511384766.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-09-12
Filing Date
2025-09-25
Publication Date
2026-01-27

AI Technical Summary

Technical Problem

Existing technologies for producing amino sugar intermediates involve long process routes, low overall yields, high production costs, and the use of various organic solvents, posing high safety risks and being environmentally unfriendly, thus failing to meet the needs of industrial production.

Method used

By knocking out the valA, valK, and/or valN genes in *Streptomyces hygroscopicus* and overexpressing valiolone synthase, an engineered strain was constructed. Fermentation conditions were optimized, including the use of a culture medium with specific ratios of rice flour, peanut flour, potassium dihydrogen phosphate, calcium carbonate, and sodium chloride, as well as the inoculum size and fermentation time, to achieve efficient production of amino sugar intermediates.

Benefits of technology

This technology enables high-yield fermentation of amino sugar intermediates, solving the problems of high production costs and environmental pollution in existing technologies, and providing favorable conditions for the production of diabetes drugs such as voglibose.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121406544A_ABST
    Figure CN121406544A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of bioengineering, and provides an engineering bacterium for producing an amino sugar intermediate as well as a construction method and application thereof, the engineering bacterium for producing the amino sugar intermediate inhibits synthesis of validamycin by knocking out genes on the basis of streptomyces hygroscopicus, and valilone synthetase is over-expressed. The engineering bacterium disclosed by the invention realizes high-yield effective alcohol amine through multiple modifications, and the yield reaches 513.8 mg / L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of bioengineering technology. Specifically, this application provides an engineered bacteria for producing amino sugar intermediates, its construction method, and its application. Background Technology

[0002] The aminoglycoside intermediate, effective alcoholamine, belongs to the aminocyclic alcohol class of compounds. Its chemical name is (1S,2S,3R,4S,5R)-5-(1,3-dihydroxypropane-2-ylamino)-1-(hydroxymethyl)-1,2,3,5-cyclohexanetetraol, and its chemical structural formula is shown in Formula I.

[0003] This compound exhibits strong α-D-glucosidase inhibitory activity and is the core structure of a pseudoaminoglycolase inhibitor.

[0004] Effective alcoholamines are direct precursors of the diabetes drug voglibose, which has good hypoglycemic properties and few side effects, and is widely used in clinical practice. Currently, the main reported production methods for effective alcoholamines both domestically and internationally are "bio-fermentation + chemical synthesis," which involves using jinggangmycin A as a substrate, microbial fermentation to obtain jinggangmycin-enamine, and then performing multiple organic synthesis reactions to obtain the effective alcoholamine. This process is lengthy, has a low overall yield, high production costs, uses various organic solvents, poses high safety risks, and is environmentally unfriendly.

[0005] In 2022, Kyowa Hakko Co., Ltd. publicly reported (JP 2022-45001) that it had constructed an engineered strain of Escherichia coli that directly ferments to produce effective alcohol amines, but its fermentation unit could only reach about 100 mg / L, which could not meet the needs of industrial production.

[0006] There is a real need in the art to provide a high-yield strain of effective alcoholamines to solve the above problems. Summary of the Invention

[0007] On one hand, this application provides an engineered strain for producing amino sugar intermediates, said engineered strain being *Streptomyces hygroscopicus* (… S. hygroscopicus Based on this, gene knockout is used to inhibit the synthesis of jinggangmycin.

[0008] Furthermore, the engineered bacteria overexpress valiolone synthase.

[0009] Furthermore, the *Streptomyces hygroscopicus* var. *Jinggangensis* (subspecies) is identified as PY05. This strain was deposited on July 15, 2024, at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 31292.

[0010] Furthermore, the knocked-out genes are selected from... valA , valK and valN One or more of them 。

[0011] Furthermore, the gene that was knocked out was valA , valK and v alN.

[0012] Furthermore, among them valA The nucleotide sequence is SEQ ID NO.1. valK The nucleotide sequence is SEQ ID NO.2 valN The nucleotide sequence is SEQ ID NO.3.

[0013] Furthermore, the knockout valA , valK and / or valN This includes inserting upstream and downstream homologous fragments of the gene into the free vector pJTU1278 to construct deletion plasmids.

[0014] Furthermore, the nucleotide sequence of the valiolone synthase is SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11.

[0015] Furthermore, the nucleotide sequence of the valiolone synthase is SEQ ID NO.11.

[0016] Furthermore, the overexpression of valiolone synthase comprises a pPM927 plasmid as a backbone, with the addition of a promoter P that drives valiolone synthase expression. valA Construct overexpression plasmids.

[0017] Furthermore, the engineered bacteria according to any one of claims 1-10 was deposited on September 10, 2025, at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 35870.

[0018] On the other hand, this application provides the application of the above-mentioned engineered bacteria in the production of amino sugar intermediates.

[0019] Furthermore, the amino sugar intermediate is an effective alcohol amine.

[0020] On the other hand, this application provides the application of the above-mentioned engineered bacteria in the production of voglibose.

[0021] Furthermore, in the application, the engineered bacteria are fermented to produce amino sugar intermediates.

[0022] Furthermore, the culture medium used in the fermentation culture contains 40-120 g / L rice flour, 5-20 g / L peanut flour, 0.5-5 g / L potassium dihydrogen phosphate, 0.5-1 g / L calcium carbonate, and 1-10 g / L sodium chloride.

[0023] Furthermore, the culture medium used in the fermentation culture contains 90-110 g / L rice flour, 16-20 g / L peanut flour, 0.5-1 g / L potassium dihydrogen phosphate, 0.5-0.7 g / L calcium carbonate, and 1-2 g / L sodium chloride.

[0024] Furthermore, the culture medium used in the fermentation culture contains 100 g / L rice flour, 18 g / L peanut flour, 0.7 g / L potassium dihydrogen phosphate, 0.6 g / L calcium carbonate, and 1.4 g / L sodium chloride.

[0025] Furthermore, in the fermentation culture, engineered bacteria are inoculated into the culture medium at an inoculation rate of 1%-15%.

[0026] Furthermore, in the fermentation culture, the engineered bacteria are inoculated into the culture medium at an inoculation rate of 8%-12%.

[0027] Furthermore, in the fermentation culture, the engineered bacteria are inoculated into the culture medium at an inoculation rate of 10%.

[0028] Furthermore, the fermentation and culture time is more than 90 hours.

[0029] Furthermore, the fermentation time is 96-120 hours.

[0030] Furthermore, the fermentation time is 96 hours.

[0031] Furthermore, the fermentation culture temperature is 30-40℃.

[0032] Furthermore, the fermentation culture temperature is 35-40℃.

[0033] Furthermore, the fermentation culture temperature was 37°C.

[0034] On the other hand, this application provides a method for constructing the above-mentioned engineered bacteria, the method comprising inhibiting jinggangmycin synthesis by gene knockout based on Streptomyces hygroscopicus PY05, and overexpressing valiolone synthase.

[0035] Furthermore, the gene that was knocked out was valA , valK and v alN.

[0036] Furthermore, among them valA The nucleotide sequence is SEQ ID NO.1. valK The nucleotide sequence is SEQ ID NO.2 valN The nucleotide sequence is SEQ ID NO.3 。

[0037] Furthermore, the nucleotide sequence of the valiolone synthase is SEQ ID NO.11.

[0038] The knockout, insertion, and overexpression genes in this application can be performed using various genetic engineering techniques known in the art, including but not limited to CRISPR-based methods, TALENs, RNA interference, transposons, homologous recombination, and various commercially available and self-made overexpression / deletion plasmids.

[0039] In this application, "effective alkanolamine," "Jinggangmycin alkanolamine," and "valiolamine" refer to the same compound and can be used interchangeably to indicate the same meaning; the CAS number of this compound is 83465-22-9, and its chemical formula is shown in Formula I:

[0040] Based on the analysis of metabolites and pathways, this application utilizes various genetic engineering techniques to modify existing strains, achieving for the first time the large-scale fermentation production of effective alcoholamines. This application solves problems related to cost, equipment conditions, and environmental pollution associated with the chemical synthesis of effective alcoholamines, providing favorable conditions for the improvement of the production of diabetes drugs such as voglibose. Attached Figure Description

[0041] Figure 1 A schematic diagram of the GZY-1 construction process (with genes deleted in the same frame as PY05). valK :Will valKUpstream and downstream homologous fragments of the gene were inserted into the free vector pJTU1278 to construct a gene for use in gene editing. valK The gene-deleted recombinant plasmid pLQ1801. After homologous recombination, the full-length plasmid is 975 bp. valK The gene was deleted by 669 bp, resulting in valK The gene deletion mutant strain was named GZY-1.

[0042] Figure 2 A schematic diagram of the GZY-13 construction process (with the gene missing in the same frame as in GZY-1). valN :Will valN Upstream and downstream homologous fragments of the gene were inserted into the free vector pJTU1278 to construct a gene for use in gene editing. valN The gene-deleted recombinant plasmid pLQ1811. After homologous recombination, the full-length plasmid is 996 bp. valN The gene was deleted by 762 bp, resulting in valN The gene deletion mutant strain was named GZY-13.

[0043] Figure 3 A schematic diagram of the construction process of GZY-14 (with the gene missing in the same frame as in GZY-13). valA :Will valA Upstream and downstream homologous fragments of the gene were inserted into the free vector pJTU1278 to construct a gene for use in gene editing. valA The gene-deleted recombinant plasmid pLQ1812. After homologous recombination, the full-length plasmid is 1,245 bp. valA The gene was deleted by 1,062 bp, resulting in valA The gene deletion mutant strain was named GZY-14.

[0044] Figure 4 The expression plasmid structure used in the construction of GZY-15 (construction of overexpression plasmid pLQ1813: this plasmid uses pPM927 as the backbone and uses the promoter P) valA Driver genes amir_2000 (overexpression).

[0045] Figure 5 The image shows the 1H NMR spectrum of the fermentation products of GZY-15.

[0046] Figure 6 This is the carbon spectrum of the fermentation products of GZY-15.

[0047] Figure 7 This is a high-resolution mass spectrum of the fermentation product of GZY-15.

[0048] Figure 8 The expression plasmid structure used in the construction of GZY-16 (construction of overexpression plasmid pLQ1814: this plasmid uses pPM927 as the backbone and uses the promoter P)valA Overexpression of the driver gene EVS-1, similar to GZY-17 to 22).

[0049] Figure 9 The image shows the results of HPLC-TOF / MS analysis of the fermentation products of GZY-16 to 22.

[0050] Figure 10 The graph shows the yield results of fermentation products from GZY-16 to 22.

[0051] Figure 11 The image shows the 1H NMR spectrum of the fermentation products of GZY-16.

[0052] Figure 12 This is the carbon spectrum of the fermentation products of GZY-16.

[0053] Figure 13 This is a high-resolution mass spectrum of the fermentation products of GZY-16.

[0054] Figure 14 The results are analyzed by single-crystal determination of fermentation products.

[0055] Figure 15 This is the analytical data for single-crystal determination of fermentation products.

[0056] Figure 16 The image shows the 1H NMR spectrum of the fermentation products of GZY-22.

[0057] Figure 17 This is the carbon spectrum of the fermentation products of GZY-22.

[0058] Figure 18 This is a high-resolution mass spectrum of the fermentation products of GZY-22. Detailed Implementation

[0059] Related sequences: valA (SEQ ID NO.1); valK :(SEQ ID NO.2); ATGTCAGCCCGCCACATCAGCCGGAGGAAACACATGTCTGACCTTCGCTCGTCGCCACTCGTACTCCGGCCAGGCACGGCGGCACCTGCCGTGCCTGGCCGCATCCTGATCCTCGGTTCCGGCTACCTTGCCGGGCACATCGCCGCCCGCCTCACCCGGCTCGGCGCCGAGACAGTGCTCAGCTCCCGGCGTGCCCCAGTCCTCCCCGAGAGCCGAGGTGTGCGCTGGAAGCAGGTCGATGTCACCTCGGGCCCGCAGGTGGCTGCCTTGATGGATGCCGTCGAGCCCGATGCCGTCGTGGCCGTGCACGGCCCCTCCGACATCACTTGGTGCGAGTCGCATCCCGAAGAGGCATACGCCACCCACCACGGTGGTGCCCGCAACATCGCAGCCGCACTGGACGGCCGCCCCGTCCTGCTGGTGTCGACCGACAACGTTTTCTCCGGCGAGGACGAGAGCTACGGGGAGTCAGCACAGACCTTCCCGGTCAACGCCTACGGCCGGGCGAAGCTCGCGGCCGAGCGGGAGCTGCTCGACACCTCCTCCGCTCTTGTCCTGCGTGTGAGCCTGGTCTACGGCTGGGAGGATCGCGGTCCGCGGCCCAACTTCCTGACCAGTGTGGTTCGTTCGCTGATGCGCAAGGAGCAGCTACGGATCCCCGACGACCACTGGAACACCCCCGTTCACGTCGAGGACGTGGCCGCGTGGGCGACGACACTGATGAGTTCCGGCCGCACCGGAACGCTGCACCTCGGCGGGCCGCGCCGCATCGGCCGAGTCGACTGGGCCAGACACATCGCCGAGCAACTCGGCGTGGACCCCATGCTCATCGTGCCGACGCCGCGTATCGGCACCGCCTACGCCTGCCGGCCGCGCAACGCCTGTCTACACAGCGAGGTGGCCGCGCAGTTGCCCGAACTGCAACACCACCGCCCGGCCGACGTCCTCGAAACCACCCATGCCCTCATCTCCTGA valN:(SEQ ID NO.3); GTGACTCTGGAGGAGGGCGGGCCCCGTCTGCACCGCTCGCCGCCGCCGCGCCCGCGTGAAGATCCCGCCGTACTCGTCGGCATCGAACTGGCCGCGCTGTGCCGCTCCGACCTCAAGGAGGTAGCCGGCACCCGTCACGGCCCCAGCCAGTTCGGGCACGAACTCGTCGGTGTCGTCCGCGAGTCCACCACCTCTGCGTTCGCCGAAGGCACTCGCGTCGTCCTGGACCCGAACGTGAAGGTGGAGCGGGGCACCGGGTTCGCCGATCACATGTGGGCGGCGGGCCCGGACGACCTGCTGCGGCACGCCCTGCAACCGGTACCGCACGGCCCGGCCGCCCGTCGCCTGGTCTTCGCCGAGCCGATCGCCTGCGCCCAGCACTGTCTGAGCGCCATCAAGGGGCAGGTCGGCAGCCTGCGGGGTGCACAAGTCGTGGTGCTCGGTGCCGGGACCGCCGGGCTCTTCATCGCGGCGCTCGCCGAGCGTGCGGGCGCCCAGGTGTCGGTCTGCAATCGGAGCCGCGCTCGGATGGATGCGGCCCGCAAGGCGGACCTGCTCGATGTACCCACACTGCTCTTCGGTGAACTGGCTGGAGACAGGGCCGACGTGGTGGTGGTCGCCACCAGCTTCGTGACGCCCACCGTGCTGGACGAGGCGCTACGCCTGGTCGCGCCAGGTGGTCTGGTGCTGCTCTACGGTGGCACCGCACCAGGTGACCGGCACCCCGGGCTGGAATGTGACCTCGATCAAGTGCGGCGCACCGAGGCCGTCGCCGCCTGCACCTGGCAGGGCCACTCACTCCATGTGGCCGGCAGCTACGGCACGACCGCGGAGGATTTCGCTACCGCGATCGGTGACCTCACTGACGCGGCGTCACCTCTGCGCGCCGAAGCCCTGGTGGCTGCTGAAGTGGACCTGCCAGGCTTGCTCGGACTGCTGCGGACCCCGGATGCCCTTGGACCCGGCAAGATCGTTGTCCACCCCGAACCCTTCTGA amir_2000 :(SEQ ID NO.4); EVS-1:(SEQ ID NO.5); EVS-2:(SEQ ID NO.6); EVS-3:(SEQ ID NO.7); EVS-4:(SEQ ID NO.8); EVS-5:(SEQ ID NO.9)。

[0060] EVS-6:(SEQ ID NO.10)。

[0061] EVS-7:(SEQ ID NO.11)。

[0062] Strains: The starting strain PY05 in the examples ( S. hygroscopicus var . jinggangensis This strain is a high-yield Jinggangmycin strain TL01 with the deletion of shbR1 (SHJG7318), shbR3 (SHJG4003), and valJ, and the introduction of the ΦC31 attB site (for details on the construction method, see: Peng Yao, Genetic Engineering Modification of High-Yielding Jinggangmycin Strains, CNKI Master's Thesis Electronic Journal, 2020, No. 03). This strain was deposited on July 15, 2024, at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 31292, and classified as *Streptomyces hygroscopicus* subsp. *jinggang*. Streptomyces hygroscopicus var.Jinggangensis .

[0063] Culture media and basic fermentation methods: Fermentation medium: First, prepare an inorganic salt stock solution, with each liter containing 0.6 g calcium carbonate, 1.4 g sodium chloride, and 0.7 g potassium dihydrogen phosphate. Dispense the solution into 250 mL Erlenmeyer flasks, adding 50 mL of the inorganic salt solution to each flask. Then weigh out 5 g rice flour and 0.9 g peanut flour, sterilize at 121 °C for 30 min, and store at room temperature.

[0064] S. hygroscopicus var. jinggangensis Liquid seed culture was performed using TSBY medium. For inoculation, a 1 cm section was cut from a solid medium containing aerial mycelia. 2 Small pieces of the culture were inoculated into 30 mL / 250 mL TSBY medium and cultured at 30°C and 220 rpm for 36-48 h until the mycelium grew densely. For fermentation, 5 mL of the seed culture was inoculated into 50 mL / 250 mL Jinggangmycin fermentation medium and cultured at 37°C and 220 rpm for 4 days.

[0065] Example 1: Production of valiolamine isomers from PY05 fermentation The fermentation broth of PY05 fermented in shake flasks at 37 °C for 4 days was analyzed using HPLC-TOF / MS. Characteristic ions of valiolamine were extracted in positive ion mode, and their theoretical... m / z =194.1023 [M+H] + The results showed that it was detected at a retention time of 7.3 min. m / z =194.1010 [M+H] + The ion peaks and the corresponding [M+Na] + ( m / z=216.0827) and [M+K] + ( m / z =232.0565) peak. These results indicate that PY05 is very likely to generate and accumulate valiolamine or its isomers.

[0066] To further clarify the structure of the product, it was isolated, purified, and its structure was identified. 4 L of fermentation broth was collected, and after centrifugation to remove the bacterial cells, it was first decolorized using macroporous resin D201, and then purified using a Dowex 50W × 8 (H) filter. + The amino-containing compounds were enriched using a (type) cation exchange resin. Further separation was then performed using Sephadex LH-20 molecular sieve chromatography to obtain a crude product containing the target compounds. Finally, the product was purified by Dowex 1 × 8 (OH-) cation exchange resin chromatography. - Further purification was performed using a type ( ) anion exchange resin with ethanol / water (50:50). v / v The product was eluted and then freeze-dried to obtain a white powdery purified product.

[0067] The ¹H NMR spectrum of this product shows two characteristic methylene proton signals at the C-6 position [2.01 (dd, J =15.5, 2.1 Hz) and 1.82 (dd, J =15.5, 3.8 Hz), and the remaining proton signals attributed to the cyclic alcohol skeleton. ¹³CNMR and DEPT-135 spectra show that the compound has a total of 7 carbon signals, including a quaternary carbon signal [75.69 (C5)], a methylene carbon signal [31.11 (C6)], and a signal linked to an amino group [50.62 (C1)].

[0068] These characteristics are highly similar to the spectrum of the standard valiolamine; however, its C-2 proton signal [3.71(dd, J =10.0, 4.4 Hz)], C-4 proton signal [3.48 (d, J =9.5 Hz)] and the chemical shifts of the C-6 methylene proton signal [2.01 and 1.82 ppm] compared to the corresponding signals in the valiolamine standard (C-2 position: [3.58 (dd, J =9.9, 4.2 Hz)];C-4 bit: [3.42 (dd, J=9.5 Hz); C-6 position: [1.89 and 1.70 ppm]) Overall shifted to lower field. This change may originate from the difference in shielding effect caused by the change in the configuration of the hydroxyl group at C-5, suggesting that the compound is a stereoisomer of valiolamine.

[0069] Table 15- epi -valiolamine and valiolamine 1 H and 13 C NMR data

[0070] 1 H and 13 C NMR data are recorded at 600 and 150 MHz, respectively. Based on mass spectrometry and NMR data, it was basically confirmed that the product is a stereoisomer of valiolamine, 5- epi -valiolamine.

[0071] Example 2: Reducing byproduct increase by 5- epi -valiolamine production The main fermentation product of PY05 is jinggangmycin A, which not only results in only a small amount of metabolic flux flowing to 5- epi The synthesis of valiolamine is hindered, reducing synthesis efficiency; it also leads to a large accumulation of jinggangmycin A in the fermentation broth, increasing the risk of 5- epi The purification of valiolamine is difficult. To obtain a more suitable 5- epi - The chassis strains produced by valiolamine reduce the synthesis of byproducts such as jinggangmycin A and available oxamine A, and guide metabolic flux to 5- epi The synthesis of valiolamine was carried out in this study using GZY-1 (PY05Δ valK Based on Figure 1), further knockout valN Construct a double knockout mutant strain GZY-13 ( Figure 2 The study also compared and analyzed the changes in metabolites in the fermentation broth.

[0072] The fermentation broth of GZY-13 after 4 days of shake-flask fermentation at 37 °C was analyzed by HPLC-TOF / MS. The results showed that, compared to PY05, no jinggangmycin A or available oxamine A was detected in the fermentation broth of GZY-13, indicating that GZY-13 effectively reduced the formation of byproducts. Detection was achieved at 7.7 min. m / z =194.1023 [M+H]+ The ion peak indicates that GZY-13 can synthesize 5- epi -valiolamine.

[0073] Further analysis of 5- in the GZY-13 fermentation broth was performed using HPLC-QQQ / MS. epi Quantitative detection was performed using valiolamine, and the concentration of 5- in the fermentation broth of GZY-13 was measured. epi The concentration of valiolamine was 5.17 mg / L, an increase of 72.9% compared to PY03. These results indicate that GZY-13 effectively reduced the accumulation of byproducts while increasing the concentration of valiolamine. epi The yield of valiolamine is achieved by a chassis strain with superior performance. Further modifications can be made to alter the C-5 configuration of the product, thereby enabling efficient synthesis of valiolamine.

[0074] Example 3: Metabolic pathway optimization to correct 5- epi -valiolamine stereochemistry To correct 5- epi The stereoconfiguration of valiolamine, knocked out in GZY-13 valA ( Figure 3 And overexpression originates from Actinosynnema mirum Valiolone synthase of DSM 43827 amir_2000 ( Figure 4 GZY-15 was obtained, and valiolamine in the fermentation broth of GZY-15 was quantitatively detected by HPLC-QQQ / MS. The content of valiolamine in the fermentation broth of GZY-15 was found to be 15.5 mg / L.

[0075] Collect 4 L of fermentation broth, centrifuge to remove bacterial cells, first decolorize with macroporous resin D201, then pass through a Dowex 50W × 8 (H) filter. + The amino-containing compounds were enriched using a (type) cation exchange resin. Further separation was then performed using Sephadex LH-20 molecular sieve chromatography to obtain a crude product containing the target compounds. Finally, the product was purified by Dowex 1 × 8 (OH-) cation exchange resin chromatography. - Further purification was performed using a type ( ) anion exchange resin with ethanol / water (50:50). v / v The product was eluted and then freeze-dried to obtain a white powdery purified product.

[0076] The purified sample was analyzed by high-resolution mass spectrometry. Figure 7The data are as follows: HRMS m / z: [M+H] + Calcd for C7H16NO5 194.1023; Found 194.1025, indicating that the GZY-15 fermentation sample has the same molecular formula as valiolamine. Further 1H NMR spectroscopy was performed (…). Figure 5 ) and carbon spectrum ( Figure 6 The measurement results are as follows: 1 H NMR (600 MHz, D2O) δ 3.84(t, J = 9.7 Hz, 1H), 3.58 (dd, J = 9.9, 4.2 Hz, 1H), 3.53 (d, J = 11.3 Hz, 1H), 3.46 (d, J = 11.3 Hz, 1H), 3.42 (d, J = 9.5 Hz, 1H), 3.34 (dd, J = 7.1, 3.7 Hz, 1H), 1.89 (dd, J = 15.2, 2.9 Hz, 1H), 1.70 (dd, J = 15.2, 3.9 Hz, 1H). 13 C NMR (150MHz, D2O) δ 78.79, 76.54, 76.53, 73.88, 68.26, 52.96, 35.31. The identification results indicate that GZY-15 can synthesize valiolamine samples with the correct stereoconfiguration.

[0077] Example 4: Metabolic Engineering to Increase Yield The low production volume of GZY-15 is not conducive to subsequent modification and industrial production.

[0078] Given that Amir_2000 is a heterologously expressed cyclase, it plays a significant role in... S. hygroscopicus The catalytic efficiency in the host may be limited, and attempts can be made to remove this limiting factor by replacing it with a more efficient isoenzyme.

[0079] Considering that EVS-like Sh7P cyclases are mainly distributed in gene clusters related to C7N aminocyclic alcohol biosynthesis, and these gene clusters typically contain pseudoglycosyltransferases homologous to ValL, this study first used... valThe ValL protein sequence, a pseudoglycosyltransferase within the gene cluster, was used as the query in a BLASTP analysis conducted on NCBI, yielding 500 similar protein sequences. This suggests that the strains containing these ValL homologs may carry a gene cluster involved in the biosynthesis of C7N aminocyclic alcohols, encoding potential EVS-like Sh7P cyclases. To narrow down the candidate pool, complete proteomic data of the aforementioned strains were downloaded and a local BLAST database was constructed. BLASTP alignment was then performed using Amir_2000 as the query sequence, ultimately resulting in 500 potential EVS homologous protein sequences.

[0080] To facilitate the differentiation of different types of Sh7P cyclases, several representative Sh7P cyclase sequences, including EEVS ValA and DDGS (4-deoxygadusol synthase) Ava_3858, were added to the above sequences. A phylogenetic tree was constructed based on all the above protein sequences to guide the subsequent screening and validation of highly efficient EVS isoenzymes.

[0081] In the initial phylogenetic tree, some branches deviated significantly from the main branch of the major Sh7P cyclase, indicating a distant evolutionary relationship with Amir_2000 and suggesting they did not belong to EVS activity. Therefore, these branches were removed in subsequent optimization. Based on the phylogenetic analysis results, 13 possible EVS candidate sequences were initially screened. After further excluding some redundant sequences with high similarity, five representative candidate EVS sequences with significant evolutionary differences were finally selected as functional validation targets, named EVS-1 to EVS-5 respectively.

[0082] On the other hand, this study used the protein sequence of Amir_2000 as the query sequence and performed DIAMOND-BLASTP alignment on 18,762 assembled actinomycete genomes in the Natural Products Discovery Center (NPDC, https: / / npdc.rc.ufl.edu) database, identifying two sequences annotated as 2- epi -valiolone synthase is a homologous protein of Amir_2000, and its protein sequence similarity with Amir_2000 is 56.4% and 52.8%, respectively.

[0083] Although the biosynthetic gene clusters containing these two homologous proteins are both predicted to be secondary metabolic gene clusters of non-ribosomal peptide synthases (NRPS), these clusters also contain several genes related to the biosynthesis of cyclic alcohols, in addition to NRPS-related enzymes (such as valienol-1-P nucleotide transferase, validamine-7-P glycosyltransferase, 2- epi -5- epi -valiolone-7-kinase and 2- epi -5- epi (e.g., valiolone epimerase), indicating that these two Amir_2000 homologs are likely involved in the biosynthesis of cyclic alcohols. These two enzymes were named EVS-6 and EVS-7, respectively.

[0084] To evaluate each candidate EVS in S. hygroscopicus The ability to synthesize in the middle, firstly by targeting the gene sequences of EVS-1 to EVS-7 to the host. S. hygroscopicus Codon optimization was performed, and the corresponding gene fragment (SEQ ID NO. 5-11) was synthesized. Subsequently, its overexpression vector pPM927-P was constructed. valA - evs -1 to pPM927-P valA - evs -7, named pLQ1814 to pLQ1820 respectively (see the example pLQ1814 construction process). Figure 8 The above overexpression vectors were transformed into strain GZY-14 to obtain mutant strains GZY-14::pLQ1814 to GZY-14::pLQ1820, which were named GZY-16 to GZY-22, respectively.

[0085] The fermentation yield of valiolamine for each mutant strain was analyzed by HPLC-QQQ / MS after 4 days of shake-flask fermentation at 37 °C. Except for GZY-17, which did not produce the expected product, the other mutant strains showed corresponding ion peaks at a retention time of 6.1 min. Figure 9 Among them, GZY-22 had the highest yield, reaching 513.8 mg / L, which was 33.1 times higher than GZY-15; followed by GZY-16, with a yield of 318.8 mg / L, which was 20.6 times higher than GZY-15. Figure 10 This indicates that the replacement strategy of EVS high-efficiency isoenzyme effectively improves the synthesis efficiency of the target product.

[0086] 4 L of fermentation broth from strain GZY-16 was collected. After centrifugation to remove bacterial cells, the broth was first decolorized using macroporous resin D201, and then passed through a Dowex 50W × 8 (H) filter. + The amino-containing compounds were enriched using a (type) cation exchange resin. Further separation was then performed using Sephadex LH-20 molecular sieve chromatography to obtain a crude product containing the target compounds. Finally, the product was purified by Dowex 1 × 8 (OH-) cation exchange resin chromatography. - Further purification was performed using a type ( ) anion exchange resin with ethanol / water (50:50). v / v The product was eluted and then freeze-dried to obtain a white powdery purified product.

[0087] The purified sample was structurally identified by measuring its 1H NMR spectrum. Figure 11 ), carbon spectrum ( Figure 12 High-resolution mass spectrometry (HDMS) Figure 13 The data is as follows: 1 H NMR (600 MHz, D2O) δ 3.75 (t, J = 9.7 Hz, 1H), 3.49 (dd, J = 9.9, 4.2 Hz, 1H), 3.43 (d, J = 11.3 Hz, 1H), 3.37 (d, J = 11.3 Hz, 1H), 3.33 (d, J = 9.5Hz, 1H), 3.25 (dd, J = 7.1, 3.8 Hz, 1H), 1.80 (dd, J = 15.2, 2.9 Hz, 1H), 1.60(dd, J = 15.2, 3.9 Hz, 1H). 13 C NMR (150 MHz, D2O) δ 75.94, 73.68, 73.68, 71.03,65.40, 50.11, 32.44. HRMS m / z: [M+H] + Calcd for C7H16NO5 194.1023; Found194.1026. To further verify the absolute configuration of the sample, single crystals were grown and measurements were performed. The results are analyzed below ( Figure 14 , Figure 15 The crystal size is 0.14 x 0.12 x 0.1 mm. 3 The space group is P212121, and the unit cell parameters are: a = 5.19260(10) Å, b = 6.91970(10) Å, c = 23.4179(4) Å, α = β = γ = 90 o The number of asymmetric units in the unit cell volume Z = 4, and the absorption coefficient is 1.109 mm⁻¹. The reliability factors R₁ = 0.0253 and wR₂ = 0.0619. The final stoichiometric formula within one asymmetric unit is determined to be C₇H₁₅NO₅, with a calculated molecular weight of 193.20 and a calculated crystal density of 1.525 g / cm³. 3The spatial arrangement of carbon, hydrogen, oxygen, and nitrogen atoms in the test sample has been determined. The five corresponding chiral carbons correspond one-to-one with the structure: C1(S), C6(S), C5(R), C4(S), and C3(S), as shown below.

[0088]

[0089] 4 L of fermentation broth from strain GZY-22 was collected. After centrifugation to remove bacterial cells, the broth was first decolorized using macroporous resin D201, and then passed through a Dowex 50W × 8 (H) filter. + The amino-containing compounds were enriched using a (type) cation exchange resin. Further separation was then performed using Sephadex LH-20 molecular sieve chromatography to obtain a crude product containing the target compounds. Finally, the product was purified by Dowex 1 × 8 (OH-) cation exchange resin chromatography. - Further purification was performed using a type ( ) anion exchange resin with ethanol / water (50:50). v / v The product was eluted and then freeze-dried to obtain a white powdery purified product.

[0090] The purified sample was subjected to structural identification. Figures 16-18 The data are as follows: HRMS m / z: [M+H] + Calcd for C7H16NO5 194.1023; Found 194.1026, indicating that the purified sample has the same molecular formula as valiolamine. Further 1H and 1C NMR spectroscopy were performed, and the results are as follows: 1 H NMR (600 MHz, D2O) δ 3.75 (t, J =9.7 Hz, 1H), 3.49 (dd, J = 9.9, 4.2 Hz, 1H), 3.43 (d, J = 11.3 Hz, 1H), 3.36 (d, J = 11.3 Hz, 1H), 3.33 (d, J = 9.5 Hz, 1H), 3.24 (dd, J = 7.1, 3.5 Hz, 1H), 1.80 (dd, J = 15.2, 2.9 Hz, 1H), 1.60 (dd, J = 15.2, 3.9 Hz, 1H). 13 C NMR (150 MHz, D2O) δ 75.94, 73.68, 73.68, 71.03, 65.40, 50.11, 32.44. Identification results: The purified sample has the same stereoconfiguration as valiolamine.

[0091] GZY-16 (TW102I-2503-2) was deposited on September 10, 2025, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 35869 and taxonomic name *Streptomyces hygroscopicus*. Streptomyces hygroscopicus .

[0092] GZY-22 (TW102I-2503-3) was deposited on September 10, 2025, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 35870 and taxonomic name *Streptomyces hygroscopicus*. Streptomyces hygroscopicus .

Claims

1. An engineered bacterium for producing amino sugar intermediates, wherein the engineered bacterium is based on Streptomyces hygroscopicus and its gene is knocked out to inhibit the synthesis of jinggangmycin.

2. The engineered bacteria according to claim 1, wherein the engineered bacteria overexpress valiolone synthase.

3. The engineered bacteria according to claim 1 or 2, wherein the *Streptomyces hygroscopicus* Jinggang variant... The subspecies of *hygroscopicus* var. *Jinggangensis* (PY05) was deposited on July 15, 2024, at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 31292.

4. The engineered bacteria according to any one of claims 1-3, wherein the knocked-out gene is selected from one or more of valA, valK and valN.

5. The engineered bacteria according to claim 4, wherein the knocked-out genes are valA, valK, and valN.

6. The engineered bacteria according to claim 4 or 5, wherein the nucleotide sequence of valA is SEQ ID NO.1, the nucleotide sequence of valK is SEQ ID NO.2, and the nucleotide sequence of valN is SEQ ID NO.

3.

7. The engineered bacteria according to any one of claims 4-6, wherein knocking out valA, valK and / or valN comprises inserting upstream and downstream homologous fragments of the gene into the free vector pJTU1278 to construct a deletion plasmid.

8. The engineered bacteria according to any one of claims 2-7, wherein the nucleotide sequence of the valiolone synthase is SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.

11.

9. The engineered bacteria according to claim 8, wherein the nucleotide sequence of the valiolone synthase is SEQ ID NO.

11.

10. The engineered bacteria according to any one of claims 2-9, wherein the overexpression of valiolone synthase comprises a pPM927 plasmid as a backbone, with the addition of a promoter P that drives valiolone synthase expression. valA Construct overexpression plasmids.

11. The engineered bacteria according to any one of claims 1-10, wherein the engineered bacteria was deposited on September 10, 2025 at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 35870.

12. The use of the engineered bacteria according to any one of claims 1-11 in the production of amino sugar intermediates.

13. The application according to claim 12, wherein the amino sugar intermediate is an effective alcohol amine.

14. The use of the engineered bacteria according to any one of claims 1-11 in the production of voglibose.

15. The application according to any one of claims 12-14, wherein the engineered bacteria are fermented to produce an amino sugar intermediate.

16. The application according to claim 15, wherein the culture medium used in the fermentation culture comprises 40-120 g / L rice flour, 5-20 g / L peanut flour, 0.5-5 g / L potassium dihydrogen phosphate, 0.5-1 g / L calcium carbonate, and 1-10 g / L sodium chloride.

17. The application according to claim 16, wherein the culture medium used in the fermentation culture comprises 90-110 g / L rice flour, 16-20 g / L peanut flour, 0.5-1 g / L potassium dihydrogen phosphate, 0.5-0.7 g / L calcium carbonate, and 1-2 g / L sodium chloride.

18. The application according to claim 17, wherein the culture medium used in the fermentation culture comprises 100 g / L rice flour, 18 g / L peanut flour, 0.7 g / L potassium dihydrogen phosphate, 0.6 g / L calcium carbonate, and 1.4 g / L sodium chloride.

19. The application according to any one of claims 15-18, wherein the engineered bacteria are inoculated into the culture medium at an inoculation rate of 1%-15% in the fermentation culture.

20. The application according to claim 19, wherein the engineered bacteria are inoculated into the culture medium at an inoculation rate of 8%-12% in the fermentation culture.

21. The application according to claim 20, wherein the engineered bacteria are inoculated into the culture medium at an inoculation rate of 10% in the fermentation culture.

22. The application according to any one of claims 15-21, wherein the fermentation culture time is 90 hours or more.

23. The application according to claim 22, wherein the fermentation time is 96-120 hours.

24. The application according to claim 23, wherein the fermentation time is 96 hours.

25. The application according to any one of claims 15-24, wherein the fermentation culture temperature is 30-40℃.

26. In the application according to claim 25, the fermentation culture temperature is 35-40℃.

27. The application according to claim 26, wherein the fermentation culture temperature is 37°C.

28. The method for constructing the engineered bacteria according to any one of claims 1-11, wherein the method comprises inhibiting jinggangmycin synthesis by gene knockout and overexpressing valiolone synthase based on Streptomyces hygroscopicus PY05.

29. The construction method according to claim 28, wherein the knocked-out genes are valA, valK, and valN.

30. The construction method according to claim 29, wherein the nucleotide sequence of valA is SEQ ID NO.1, the nucleotide sequence of valK is SEQ ID NO.2, and the nucleotide sequence of valN is SEQ ID NO.

3.

31. The construction method according to any one of claims 28-30, wherein the nucleotide sequence of the valiolone synthase is SEQ ID NO.11.

Citation Information

Patent Citations

  • Methods for producing valiolamine and voglibose

    JP2022045001A