Genetically engineered streptomyces as well as construction method and application thereof

By replacing the aveA3 gene fragment of Streptomyces with the milA3 fragment using CRISPR-Cas9 gene editing technology, a genetically engineered strain, Streptomyces avermitilis HU501-M, was constructed to produce milbemycin D efficiently. This solved the problems of low yield and high cost of milbemycin D and enabled high-purity fermentation production.

CN121610433APending Publication Date: 2026-03-06HUZHOU UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511902228.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-05-16
Filing Date
2025-12-17
Publication Date
2026-03-06

AI Technical Summary

Technical Problem

Existing technologies make it difficult to produce milbemycin D efficiently, which limits its industrialization, mainly due to low output and high manufacturing costs.

Method used

Using CRISPR-Cas9 gene editing technology, the aveA3 gene fragment of *Streptomyces avermitilis* containing ivermectin B1b was replaced with the milA3 fragment of *Streptomyces bluegrayense*, thus constructing a genetically engineered *Streptomyces avermitilis* HU501-M. Gene editing was achieved through conjugation transfer via *Escherichia coli* ET12567 (pUZ8002).

Benefits of technology

It improved the fermentation yield and purity of milbemycin D, increasing its HPLC purity to over 70%, reduced production costs, and promoted the industrial application of milbemycin D.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121610433A_ABST
    Figure CN121610433A_ABST
Patent Text Reader

Abstract

The invention discloses genetically engineered streptomyces as well as a construction method and application thereof. According to the present invention, with the application of the CRISPR-Cas9 gene editing technology, the aveA3 fragment in the Streptomyces avermitilis gene cluster capable of generating the ivermectin B1b compound is replaced with the milA3 fragment in the Streptomyces hygroscopicus gene cluster so as to obtain the gene engineering Streptomyces, such as Streptomyces avermitilis HU501-M, and the gene engineering Streptomyces HU501-M can be used to produce the ivermectin B1b compound, the constructed genetically engineered streptomyces can be used for preparing milbemycin D, and the compound has efficient insecticidal, acaricidal and antiparasitic activity, is high in safety to human beings and animals, and is environment-friendly. The main fermentation product of the genetically engineered streptomyces is milbemycins D, and the genetically engineered streptomyces has a good industrial development prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology and microbial pharmaceuticals, specifically relating to genetically engineered bacteria, their construction methods, and applications. Background Technology

[0002] Sixteen-membered macrolides have long been a focus of attention in drug development due to their rich bioactivity and good safety profile. Among them, avermectin and milbemycin compounds, with their excellent insecticidal activity, have been widely used in agricultural and veterinary pesticides. The biosynthetic gene clusters of avermectin and milbemycin have been identified, and these biosynthetic gene clusters in Streptomyces exhibit good homology. This provides a foundation for using synthetic biology techniques to manipulate gene fragments to modify the producing strains and obtain engineered strains with favorable traits.

[0003] Milbemycin is derived from Streptomyces. Streptomyces hygroscopicus A class of sixteen-membered macrocyclic lactone compounds were discovered in the fermentation broth of milbemycin, characterized by high activity and low toxicity. In 1972, the 16-membered macrocyclic lactone structure of this class of compounds was elucidated and named milbemycin, and several structurally similar compounds such as milbemycin D, E, F, G, H, J, and K were subsequently reported (Mishima H, et al. J Antibiot. 1983, 36(8): 980-90.). Several milbemycin compounds have been industrialized internationally. Among them, milbemycin D, due to its good acaricidal and canine heartworm-killing activities and long half-life, has been attempted for use in the development of veterinary drugs and pesticides. However, it is not the main fermentation product of milbemycin-producing bacteria, resulting in low yield and high manufacturing cost, which has affected its commercialization. Patent CN 120025955 A discloses a recombinant Streptomyces praziquantel (CCTCC NO: M 20242151) obtained through PCR targeting technology, which can produce succinimibacterium B. This compound has the same structure as milbemycin D. This strain can produce three main fermentation products, among which milbemycin D has an HPLC purity of less than 50%. If an engineered strain with milbemycin D as the main fermentation product can be obtained through synthetic biology, it will be of great significance for the industrialization of this compound. Summary of the Invention

[0004] This invention provides a genetically engineered Streptomyces strain capable of producing milbemycin D, using CRISPR-Cas9 gene editing technology to produce ivermectin B1b compound from Streptomyces virgaurea (…). Streptomyces avermitilis In the biosynthetic gene cluster of ) aveA3 Gene fragment replacement with Streptomyces bluegrayense ( Streptomyces milbemycinicus Nimoktin was born in the middle of the period.

[0005] The genetically engineered Streptomyces involved in this invention is named Streptomyces avermitilis HU501-M is deposited at the China Center for Type Culture Collection (CCTCCC) with accession number NO: CCTCC M 2025823 and deposit date of April 18, 2025.

[0006] The present invention also provides a method for constructing the genetically engineered Streptomyces, comprising: constructing milA3 The CRISPR-Cas9 knock-in vector was used; the transfer was performed via conjugation with E. coli ET12567 (pUZ8002). milA3 The CRISPR-Cas9 knock-in vector was introduced into *Streptomyces praziquantel*, a bacterium that produces ivermectin B1b, thereby increasing the concentration of ivermectin B1b in the *Streptomyces praziquantel* gene cluster. aveA3 Fragment replacement with the gene cluster of *Streptomyces hygroscopicus* milA3 Fragment. Among them, milA3 The CRISPR-Cas9 knock-in vector contains sgRNA sequences as shown in SEQ ID NO:1 to SEQ ID NO:18.

[0007] The present invention also relates to the use of the genetically engineered Streptomyces, which can be used to prepare milbemycin D compound, comprising: a step of aerobic liquid deep fermentation of the genetically engineered Streptomyces in a culture medium containing assimilated carbon and nitrogen sources.

[0008] Preferably, the assimilable carbon source in the above-mentioned culture medium is selected from one or a combination of starch, soluble starch, maltodextrin, sucrose, glucose, sorbitol, mannitol, maltose, lactose, galactose, and fructose; preferably, the assimilable nitrogen source in the above-mentioned culture medium is selected from one or a combination of soybean meal, soybean flour, peanut meal, malt extract, peptone, yeast powder, yeast extract, beef extract, yeast extract, corn steep liquor, and gluten powder; the temperature of the aerobic liquid deep fermentation is 20~35℃, preferably 28~30℃; the pH is 5.0~8.0, preferably 7.0; and the fermentation time is 120~240 hours.

[0009] This invention also provides the application of milbemycin D in the control of the fall webworm.

[0010] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention utilizes CRISPR-Cas9 gene editing technology, which offers higher gene editing efficiency compared to traditional techniques such as PCR targeting. Furthermore, the genetically engineered Streptomyces obtained in this invention, such as... Streptomyces avermitilisHU501-M, whose fermentation product contains milbemycin D as the main component, has a purity exceeding 70% as determined by HPLC. Attached Figure Description

[0011] Figure 1 strain Streptomyces avermitilis HPLC chromatogram of the fermentation products of HU501; Figure 2 strain Streptomyces avermitilis High-resolution mass spectrometry of the main product peak of HU501 fermentation; Figure 3 Structure diagram of CRISPR-Cas9 knock-in vector plasmid pKC1139-Cas9-spacer-AA3UD-MA3; Figure 4 Flowchart of the construction process of CRISPR-Cas9 knock-in vector plasmid pKC1139-Cas9-spacer-AA3UD-MA3; Figure 5 Enzyme digestion verification diagram of CRISPR-Cas9 knock-in vector plasmid pKC1139-Cas9-spacer-AA3UD-MA3; Figure 6 type milA3 PCR verification diagram of the conjugate strain of the fragment; Figure 7 Gene segment substitution process in conjugating strains; Figure 8 type milA3 HPLC chromatogram of fermentation products from the conjugating strain of the fragment; Figure 9 type milA3 High-resolution mass spectrum of the main fermentation product peak of the fragment conjugant strain; Figure 10 The pure milbemycin D prepared in Example 6 of this invention 1 H-NMR spectrum; Figure 11 The pure milbemycin D prepared in Example 6 of this invention 13 C-NMR spectrum; Figure 12 DEPT135 spectrum of pure milbemycin D prepared in Example 6 of this invention; Detailed Implementation Example 1

[0012] Starting strain Streptomyces avermitilis Acquisition of HU501 (CCTCC NO: M 2025824) Streptomyces of the present invention Streptomyces avermitilisHU501 is an avermectin-producing bacterium. Streptomyces avermitilis Based on (ATCC NO. 31267), it was obtained through multiple rounds of mutagenesis and selection using single or combined mutagenesis methods such as ultraviolet (UV), ambient pressure room temperature plasma (ARTP), and ethyl methanesulfonate (EMS).

[0013] After culturing the avermectin-producing strain in ISP2 or ISP3 slant agar at 28°C for 8 to 10 days, the spores were scraped off under aseptic conditions to prepare a spore suspension, which was then adjusted to a spore concentration of 10. 7 The cells were per mL and subjected to mutagenesis using ultraviolet light, ambient pressure, room temperature plasma, and ethyl methanesulfonate.

[0014] UV mutagenesis: 1 mL of spore suspension was spread onto a sterile 9 cm culture dish and irradiated with a 30 W, 254 nm UV lamp at a distance of 20 cm from the surface for 40, 60, and 80 seconds, respectively. Afterwards, the solution was diluted with physiological saline to a final concentration under red light. -4 10 -5 10 -6 Spread the bacteria onto ISP2 plates, place them in a stainless steel container for dark incubation, and after 8 days of incubation at 28°C, select mutant colonies.

[0015] ARTP mutagenesis: Take 25 μL of spore suspension, spread it on a slide, set the gas flow rate to 10 SLM, the incident power to 100 W, and the outlet spacing to 2 mm. After treatment for 30, 40, 50, and 60 s, dilute with sterile water to 10. -4 10 -5 10 -6 Spread the samples onto ISP2 plates. After incubating at 28°C for 8 days, select mutant colonies.

[0016] EMS mutagenesis: Dissolve 1 mL of ethyl methanesulfonate in 2 mL of anhydrous ethanol, then add 22 mL of phosphate buffer (pH 7.2). Take 2 mL of spore suspension in a sterile test tube, add 4.0% ethyl methanesulfonate solution to achieve final concentrations of 2.0%, 3.0%, and 4.0%, respectively. Shake at 150 rpm for 30 minutes, then add 10 mL of 5% sodium thiosulfate to terminate the reaction. Dilute successively with physiological saline and then with sterile water to a final concentration of 10. -4 10 -5 10 -6 The samples were plated on ISP2 plates and incubated at 28°C for 8 days. Mutant colonies were then selected.

[0017] Combined mutagenesis: Select two or more of the above mutagenesis methods and continuously treat the spore suspension for mutagenesis.

[0018] At least 100 single or combined mutant colonies were selected from each batch, and spores were scraped off after expansion and fermented in shake flasks. Fermentation medium: corn starch 100 g / L, amylase 0.2 g / L, glucose 10 g / L, yeast powder 10 g / L, soybean flour 20 g / L, distilled water 1 L, CaCO3 3 g / L, pH 7.0. 30 mL of the medium was added to a 250 mL shake flask and fermented at 28℃ and 250 rpm for 10 days. 1 mL of the fermentation broth was taken, 3 mL of methanol was added, and the mixture was sonicated for 30 min. The mixture was then filtered through filter paper, and the filtrate was analyzed by HPLC. High-yielding *Ivermectin* strains with B1b (molecular formula: C...) were selected. 47 H 72 O 14 The strain was identified. HPLC analysis conditions were as follows: Agilent ZORBAXXDB-C18 column (4.6 × 250 mm id, 5 μm); mobile phase: methanol:acetonitrile:water = 81:7:12; flow rate: 1 mL / min; absorption wavelength: 240 nm; injection volume: 10 μL.

[0019] After multiple rounds of mutagenesis, mutant strains were obtained. Streptomyces avermitilis HU501, with Ivermectin B1b yield exceeding 900 μg / mL, HPLC chromatogram shown below. Figure 1 The high-resolution liquid chromatography-mass spectra of the main product peak are shown below. Figure 2 . strain Streptomyces avermitilis HU501 is deposited at the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China), with accession number NO: CCTCC M 2025824 and deposit date of April 18, 2025. Example 2

[0020] Hygroscopic Streptomyces milA3 Construction of CRISPR-Cas9 knock-in vector plasmid for fragments In this embodiment, *Streptomyces hygroscopicus* milA3 The CRISPR-Cas9 knock-in vector plasmid for this fragment is named pKC1139-Cas9-spacer-AA3UD-MA3, and this vector contains Streptomyces cerevisiae. aveA3 The upstream and downstream fragments are aveA3-UP, aveA3-DOWN, and Streptomyces hydrophila, respectively. milA3 The fragment. The aveA3-UP sequence is shown in SEQ ID NO.19. milA3 The sequence is shown in SEQ ID NO.20, and the aveA3-DOWN sequence is shown in SEQ ID NO.21. The plasmid pKC1139-Cas9-spacer-AA3UD-MA3, plasmid structure is shown below. Figure 3This plasmid consists of 35,842 bases. Positions 297-316 are the sgRNA sequence, positions 477-4580 are the sequence encoding the Cas9 protein, positions 6504-6510 are the EcoRI restriction site, positions 6511-9197 are the upstream homologous arm of aveA3, and positions 9198-26678 are... milA3 The sequence, positions 26679-29654 are aveA3 Downstream homologous arm, positions 30857-31657, contains the apopramine resistance gene fragment. In this invention, spacer refers to sgRNA.

[0021] The construction process for pKC1139-Cas9-spacer-AA3UD-MA3 can be found here. Figure 4 The specific steps are as follows: (1) The original vector plasmid was named pKC1139-Cas9, used to kill Streptomyces cerevisiae. aveA3 Using fragment sequences as targets, usable sgRNA sequences were designed as shown in SEQ ID NO:1 to SEQ ID NO:18. The selected sequence, SEQ ID NO:1, was used as an example to construct the pKC1139-Cas9 plasmid.

[0022] (2) Design primer sequences: Forward (SEQ ID NO:22) and Reverse (SEQ ID NO:23). Then, using pKC1139-Cas9 as a template, amplify the fragment containing the sgRNA sequence using primers. (3) The pKC1139-Cas9 plasmid was digested with XbaI and NheI restriction endonucleases, and the large fragment was recovered. The recovered large fragment was ligated with the fragment containing the sgRNA sequence in step (1) by seamless cloning to obtain the plasmid pKC1139-Cas9-spacer; (4) Design primers for amplifying the upstream and downstream homologous arms of *Streptomyces aveA3*, using *Streptomyces HU501* ( Streptomyces avermitilis Using HU501 as a template, amplification was performed. The upstream homologous arm amplification primers were: Forward (SEQ ID NO:24) and Reverse (SEQ ID NO:25); the downstream homologous arm amplification primers were: Forward (SEQ ID NO:26) and Reverse (SEQ ID NO:27). The plasmid pKC1139-Cas9-spacer was digested with EcoRI restriction endonuclease, and the plasmid was cloned seamlessly. aveA3 The upstream and downstream homologous arms were inserted into the plasmid pKC1139-Cas9-spacer to obtain the plasmid pKC1139-Cas9-spacer-AA3UD, and the correct plasmid was extracted by enzyme digestion. (5) Search for Streptomyces hygroscopicus in the NCBI database milA3 The gene sequence was divided into four similarly sized segments (4635bp + 3611bp + 4123bp + 5112bp). Fragments were obtained through large-fragment gene synthesis, and NdeI restriction sites were added to the homologous arms of the first and fourth fragments. The plasmid pKC1139-Cas9-spacer-AA3UD was digested with the restriction endonuclease NdeI, and the gene was then cloned seamlessly. milA3 The first and fourth fragments were ligated with the digested plasmid to obtain plasmid pKC1139-Cas9-spacer-AA3UD-MA3part, which was then verified by enzyme digestion, and the correct plasmid was extracted. Plasmid pKC1139-Cas9-spacer-AA3UD-MA3part was digested with the restriction endonuclease NdeI, and the plasmid was then cloned seamlessly. milA3 The second and third fragments were seamlessly cloned and ligated with the digested plasmid to obtain plasmid pKC1139-Cas9-spacer-AA3UD-MA3. The plasmid pKC1139-Cas9-spacer-AA3UD-MA3 was verified by enzyme digestion with EcoRV and XbaI; the results are shown below. Figure 5 The enzyme digestion was expected to yield four fragments of sizes 5796bp, 6599bp, 11214bp, and 12233bp. Lane 1 was consistent with the expectation. Further sequencing of the plasmid in lane 1 showed that it was consistent with the target sequence, indicating that the plasmid pKC1139-Cas9-spacer-AA3UD-MA3 was successfully constructed. Example 3

[0023] Hygroscopic Streptomyces milA3 The CRISPR-Cas9 knock-in vector plasmid fragment was introduced into Streptomyces hu501 to obtain a conjugating strain. The plasmid pKC1139-Cas9-spacer-AA3UD-MA3 was transferred into the originating strain Streptomyces HU501 via conjugation with Escherichia coli ET12567 (pUZ8002). The specific steps are as follows.

[0024] (1) The pKC1139-Cas9-spacer-AA3UD-MA3 expression vector was transformed into demethylated E. coli ET12567 (pUZ8002) by heat shock to obtain recombinant E. coli ET12567 / pUZ8002 / pKC1139-Cas9-spacer-AA3UD-MA3.

[0025] (2) E. coli ET12567 / pUZ8002 / pKC1139-Cas9-spacer-AA3UD-MA3 was inoculated into 50 mL LB liquid medium (containing chloramphenicol, kanamycin, and aporamycin) and cultured at 37°C until the OD600 reached 0.6. The cells were collected by centrifugation at 4000 rpm for 10 min, washed twice with 30 mL LB liquid medium, and resuspended in 2 mL LB liquid medium. HU501 of *Streptomyces hygroscopicus* was streaked on YMS solid medium (0.4% yeast extract, 0.4% soluble starch, 1% malt extract, 0.0005% CoCl·6H2O, 1.5% agar, pH 7.2) and cultured at 30°C for 5-7 days. Surface spores were scraped from the surface with a steel stick into sterile water to prepare a spore suspension. The suspension was then cultured in 2×YT liquid medium (1.6% tryptone, 1.0% yeast extract, NaCl...). Wash twice with 0.5% (w / v) solution, heat shock at 50°C for 10 min, cool, mix with the above-mentioned E. coli, and evenly spread on MS solid medium (mannitol 2%, soybean meal 2%, agar 2%, the remainder is water, all percentages are by mass, 10mM MgCl2, pH natural), incubate at 30°C for 20 h, add 25 μg / mL nalidixic acid and 50 μg / mL apopramine, and continue incubation at 30°C for 5-7 days; the transformed cells obtained above are cultured on YMS solid medium containing apopramine for 5-7 days, then on antibiotic-free YMS solid medium at 37°C for 2 days, and then transferred to 30°C for 3-5 days. Then, scrape a small amount of bacterial cells with a toothpick into a PCR tube, add 50 μL of sterile water, heat at 95°C for 10 min in a PCR instrument, transfer to a -80°C ultra-low temperature freezer for 5 min, thaw naturally, and obtain crude total DNA extract. Primers for the forward direction (SEQ ID NO:28) and the reverse direction (SEQ ID NO:29) were used for PCR amplification. milA3 A partial fragment (3074 bp) confirmed that the target DNA sequence had been fused into *Streptomyces hygroscopicus* HU501. PCR gel electrophoresis results are shown below. Figure 6 Lanes 1 and 2 have target size bands, indicating that... milA3 The fragment has been integrated, and the resulting strain is the target conjugant strain. The gene fragment replacement process in the conjugant strain is as follows: Figure 7 As shown, its gene clusters contain aveA3 Fragments were absorbed by Streptomyces milA3 Fragment replacement. Example 4

[0026] Fermentation and detection of zygotic strains The spores of the conidial strain obtained in Example 3 were inoculated onto YMS solid medium and cultured at 28°C for 6-10 days. Then, shake-flask fermentation was carried out according to the following steps, and the fermentation products were tested.

[0027] (1) Preparation of seed liquid Seed culture medium formulation: 250 g / L corn starch, 10 g / L glucose, 12 g / L yeast extract, 20 g / L soybean meal, 1 L distilled water, 3 g / L CaCO3, pH 7.0, 1000 mL purified water (pH 6.8-7.0 before sterilization). Dispense 250 mL / 1000 mL portions into Erlenmeyer flasks and sterilize at 121℃ for 20 min. Spores from 10-day-old agar plates are scraped and inoculated into the seed culture medium, for a total of 4 flasks. Incubate at 28℃, 200 rpm for 40-48 hours to obtain the seed culture.

[0028] (2) Fermentation culture Fermentation medium formula: 60 g corn soluble starch, 20 g glucose, 20 g fried soybean meal powder, 20 g cottonseed meal powder, 2 g light calcium carbonate, 2 g sodium chloride, 2 g magnesium sulfate heptahydrate, 1000 mL tap water, pH 7.0 before sterilization. Fill 250 mL / 1000 mL Erlenmeyer flasks and sterilize at 121℃ for 20 min. Inoculate the seed culture at a rate of 2-10% (v / v). Prepare a total of 20 L of fermentation broth and incubate at 28℃, 200 rpm, shaking for 180-240 hours to terminate fermentation.

[0029] (3) Detection of fermentation products Add 6 mL of ethanol to 2 mL of fermentation broth, shake thoroughly, sonicate for 30 min, filter with filter paper, and transfer 1 mL of the filtrate to a sample bottle for HPLC analysis. HPLC conditions: Column: C8 column (ODS2, 5 µm, 200 × 4.6 mm id); Detection wavelength: 240 nm; Flow rate: 1.00 mL / min; Injection volume: 10 μl; Mobile phase: acetonitrile:methanol:water = 65:23:12. Typical HPLC chromatograms are shown below. Figure 8 The main product is milbemycin D, with an HPLC purity exceeding 70%. The high-resolution LC-MS chromatogram of the main product peak is shown below. Figure 9 Its molecular weight was determined to be 556 (m / z 579.3304 [M+Na]). + The chemical formula is calculated to be C. 33 H 48 O7 is consistent with milbemycin D.

[0030] The strain was named Streptomyces avermitilis HU501-M has been deposited at the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China), accession number: CCTCC M2025823, on April 18, 2025. Example 5

[0031] Using genetically engineered Streptomyces strains Streptomyces avermitilis HU501-M (CCTCC NO: M2025823) Preparation of fermentation broth containing milbemycin D compound (1) The preparation of plate colonies and seed liquid are described in Example 4.

[0032] (2) Preparation of seed liquid in seed tank 8 L of seed culture medium (same as in Example 4) was added to a 15 L seed tank and sterilized by steam at 121 °C for 30 min. After cooling to 30 °C, 500 mL of primary shake flask seed solution was added. The mixture was stirred at 200 rpm and aerated at 0.5 vvm, and incubated at 28 °C for 48 hours to obtain the seed solution.

[0033] (3) Preparation of fermentation broth in fermenter The fermentation medium formulation was the same as in Example 4, with the addition of 1% defoamer. The fermenter volume was 50 L, and the feed volume was 30 L. The fermentation was sterilized by steam at 121℃ for 30 min. After cooling to 30℃, 2 L of seed culture was added to the seed tank. The initial stirring speed was 150 rpm, adjusted according to dissolved oxygen levels (controlling dissolved oxygen not lower than 5%), with a maximum stirring speed not exceeding 400 rpm. The aeration rate was 0.5-3.0 vvm (adjusting the stirring speed according to dissolved oxygen levels, controlling dissolved oxygen not lower than 30%). Submerged fermentation was carried out at 28℃ for 240 hours. Fermentation was then terminated and the fermentation tank was removed. Milbemycin D in the fermentation broth was detected using the HPLC method described in Example 4. Example 6

[0034] Milbemycin D compound extracted from fermentation broth The fermentation broth obtained in Example 5 was centrifuged at 4500 rpm for 15 min to obtain mycelia. These mycelia were then soaked in 5 L of ethanol and sonicated for 30 min, followed by filtration to obtain an ethanol extract. The ethanol extract was concentrated under vacuum at 50 °C to approximately 1 L, and then extracted three times with equal volumes of ethyl acetate to obtain ethyl acetate extracts. The combined extracts were concentrated to dryness under reduced pressure at 50 °C to obtain 25 g of an oily substance. The obtained oily substance was dissolved in 100 mL of dichloromethane and methanol (1:1) solution, shaken onto silica gel, and subjected to silica gel column chromatography. Elution was performed using a gradient of petroleum ether:ethyl acetate 95:5–60:40. Thin-layer chromatography was performed using petroleum ether:ethyl acetate (2:1) as the developing condition. Based on UV absorption, the fractions were combined into three fractions (Fr. 1–3). Component Fr. 2 was further purified by HPLC (column: Zorbax XDB-C18, 5 µm, 250 × 9.4 mm id; mobile phase: MeOH:H2O = 95:5; detection wavelength: 240 nm; flow rate: 1.5 mL / min) to obtain compound milbemycin D (18 mg, t).R (19.3 min). The obtained pure milbemycin D was detected by high-resolution mass spectrometry (HRESIMS) and nuclear magnetic resonance spectroscopy (NMR). 1 H NMR, 13 C10 NMR and DEPT135 spectra (400 MHz, CDCl3) are shown below. Figures 10 to 12 The NMR data are listed in Table 1. Referring to the reference (Hi'ro'shiMishima, Junya Ide, Shigeki Muramatsu, et al. Milbemycins, a new family of macrolide antibiotics. Structure determination of milbemycins D, E, F, G, H, J and K. J Antibiot, 1983, 36(8):980-90.), its structure is determined to be as shown in formula (I), which is milbemycin D. Table 1: NMR data of milbemycin D obtained in Example 6. Example 7 Activity test of milbemycin D compound against American white moth Using fourth-instar larvae as test insects, solutions of milbemycin A3, A4, and D at concentrations of 1, 2, 5, 10, and 20 mg / L were prepared for use. Mulberry leaves were cut into 7cm × 7cm squares and immersed in the prepared solutions of different concentrations for 15 seconds. After being removed and air-dried, they were placed in petri dishes with moistened filter paper at the bottom. Each dish contained 15 fourth-instar larvae that had been starved for 12 hours. Fresh mulberry leaves were replaced with fresh leaves after 24 hours. The experiment was repeated three times, with a blank control included. The larvae were incubated at 25 ℃. Feeding was observed and recorded, and mortality was recorded after 48 hours. The results showed that 20 mg / L milbemycin D had a mortality rate of 86.7% for fourth-instar larvae, while milbemycin A3 and A4 both had a mortality rate of 80%.

[0035] Sequence Listing SEQ ID NO:1 GGATTGTTGCGTGTGATGTG SEQ ID NO:2 CCTTGCTGACGAGTTGTGTG SEQ ID NO:3 GCCACATCGACAGATCATCG SEQ ID NO:4 TCGACAGATCATCGTGGCTA SEQ ID NO:5 TTTGATCGTAAGCCGTGTTC SEQ ID NO:6 CAGGAATGACCAACGGTGTG SEQ ID NO:7 GTGTGCTTTCGAGCCAGTAG SEQ ID NO:8 GTAGAGGAAACTCCCACAGC SEQ ID NO:9 CACAGTGAGTTGCTCGATTC SEQ ID NO:10 CCACATTGGAACTGGCCGAA SEQ ID NO:11 CACACCGTTGGTCATTCCTG SEQ ID NO:12 GCTTATGGCCTGGCATTCCA SEQ ID NO:13 CTTATGGCCTGGCATTCCAA SEQ ID NO:14 TCGCTGTGCTGATGAGGAAT SEQ ID NO:15 TATGGCGACTACGAGGCAAA SEQ ID NO:16 GAGGCAAATGGCTTTGTCTA SEQ ID NO:17 CCCGACACCAGTACATCTGA SEQ ID NO:18 CACACACAACTCGTCAGCAA SEQ ID NO.19 SEQ ID NO.20 SEQ ID NO.21 SEQ ID NO:22 GCTATTTCTAGCTCTAAAACGGATTGTTGCGTGTGATGTGGCTGGATCCTACCAACCG SEQ ID NO:23 GCGGCGACCACCACCACCAC SEQ ID NO:24 ctcttgatccccatcgaattcCGAAACCGGACACACCACA SEQ ID NO:25 ttgaatttgggagacagtgCATATGagcccagaaaccactccga SEQ ID NO:26 CACTGTCTCCCAAATTCAAGAAGTC SEQ ID NO:27 ACAGCTATGACATGATTACtaccacgaccacctcttccg SEQ ID NO:28 CCCTCGGTCTGCTCCCAAACTCCCCAG SEQ ID NO:29 CTGGACCCACACCTCGACCATCCCCTG。

Claims

1. A genetically engineered Streptomyces, characterized in that, The genetically engineered Streptomyces is an insecticide Streptomyces that produces ivermectin B1b using CRISPR-Cas9 gene editing technology. Streptomyces avermitilis ) gene clusters aveA3 Replace the fragment with Streptomyces hydrophila ( Streptomyces milbemycinicus In gene clusters milA3 Engineered bacteria obtained from the fragment.

2. The genetically engineered Streptomyces of claim 1, wherein, The genetically engineered Streptomyces is named as Streptomyces avermitilis HU501-M, which was preserved in China Center for Type Culture Collection, with the preservation number of NO: CCTCC M 2025823 and the preservation date of April 18, 2025.

3. A method for constructing genetically engineered Streptomyces according to any one of claims 1 to 2, characterized in that, comprising: Constructing milA3 CRISPR-Cas9 knock-in vectors; The CRISPR-Cas9 knock-in vector of milA3 was introduced into Streptomyces avermitilis producing the ivermectin B1 b compound by E. coli ET12567 (pUZ8002) conjugation transfer, so that the aveA3 fragment in Streptomyces avermitilis producing ivermectin B1 b was replaced by the milA3 fragment in Streptomyces hygroscopicus gene cluster.

4. The method of constructing a genetically engineered Streptomyces according to claim 3, wherein milA3 CRISPR-Cas9 knock-in vectors of the present application comprise sgRNA sequences as set forth in SEQ ID NO: 1 to SEQ ID NO:

18.

5. Use of genetically engineered Streptomyces as claimed in claims 1-2, characterized in that, The genetically engineered Streptomyces of claims 1-2 can be used to prepare milbemycin D, which has the following structure (I).

6. Use of the genetically engineered Streptomyces of claim 5, characterized in that, The process comprising the genetically engineered Streptomyces of claims 1-2 is carried out by aerobic submerged fermentation in a culture medium containing assimilable carbon and nitrogen sources.

7. Use of genetically engineered Streptomyces as claimed in claim 6, wherein, The assimilable carbon source in the culture medium is selected from one of starch, soluble starch, malt dextrin, sucrose, glucose, sorbitol, mannitol, maltose, lactose, galactose, fructose, or a combination thereof.

8. Use of genetically engineered Streptomyces as claimed in claim 6, wherein, The assimilable nitrogen source in the culture medium is selected from one of soybean meal, soybean powder, peanut meal, malt extract, peptone, yeast powder, yeast extract, beef extract, yeast extract, corn steep liquor dry powder, gluten meal, or a combination thereof.

9. Use of genetically engineered Streptomyces as claimed in claim 6, wherein, The aerobic submerged fermentation is carried out at a temperature of 20-35°C, preferably 28-30°C, and a pH of 5.0-8.0, preferably 7.0, for a period of 120-240 hours.

Citation Information

Patent Citations

  • Recombinant deinsectization streptomycete, construction method thereof and application of recombinant deinsectization streptomycete in preparation of convermectin B

    CN120025955A