Method for improving Iturin A production capacity of bacillus and bacillus mutant strain

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a method for improving Iturin A production capacity of bacillus and a bacillus mutant strain. According to the specific technical scheme, the method comprises the following steps: carrying out gene modification on bacillus, and reducing the strength of a citrate synthase CitZ promoter in the bacillus, so as to obtain a bacillus mutant strain. According to the method, a promoter with proper strength is used for replacing a tricarboxylic acid cycle key rate-limiting enzyme citrate synthase CitZ promoter, and a fermentation regulation strategy of metabolic restriction-exogenous compensation is supplemented, so that the fermentation synthesis efficiency of the iturin A is remarkably improved finally. The method has universality, the yield of the iturin A produced by the bacillus can be increased by about 30% or above, and the method has important application value.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a method for improving the ability of Bacillus to produce Iturin A and a Bacillus mutant strain. Background Technology

[0002] Iturin A is a homologue of cyclic lipopeptide compounds produced by Bacillus subtilis and other Bacillus species. Its molecule consists of a fatty acid chain of 14–17 carbon atoms and a heptcyclic peptide, exhibiting both hydrophilic and lipophilic properties. Iturin A possesses broad-spectrum antifungal activity, effectively inhibiting various pathogenic and environmental fungi. It also boasts advantages such as low toxicity, high safety for humans and animals, and low likelihood of inducing drug resistance.

[0003] The properties of iturobrine A make it a promising candidate for applications in agricultural disease control, fruit and vegetable preservation, medicine, and environmental protection. For example, in agriculture, it effectively inhibits various stubborn crop pathogens, such as wilt of melons and Verticillium wilt of cotton, by disrupting fungal cell walls and membranes, demonstrating its potential as a highly effective biological pesticide. In fruit and vegetable preservation, iturobrine A plays a dual role: firstly, by disrupting pathogen cell membranes, inducing reactive oxygen species bursts, and interfering with the MAPK signaling pathway, it directly inhibits pathogen growth; secondly, by activating the plant defense system, it enhances the stress resistance of fruits and vegetables. In medicine, iturobrine A can induce tumor cell apoptosis and inhibit angiogenesis, showing anti-tumor potential. In environmental protection, it can combine with silver ions to form silver nanoparticles, which can be used for highly sensitive detection and remediation of heavy metal pollution in water.

[0004] Despite the broad application prospects of iturobrine A, its industrial production still faces significant challenges. Due to its complex chiral structure and numerous active functional groups, the chemical synthesis of iturobrine A is costly and technically difficult. Therefore, it currently relies mainly on Bacillus fermentation for production.

[0005] However, due to limitations in strain performance and fermentation process, the current production efficiency is low, and the output is insufficient to meet the needs of large-scale applications, thus restricting the industrialization process of iturobrine A.

[0006] Therefore, strain improvement to enhance production efficiency is an important research and development direction for iturobrine A. Summary of the Invention

[0007] The purpose of this invention is to provide a method for improving the ability of Bacillus to produce Iturin A and a corresponding Bacillus mutant strain.

[0008] To achieve the aforementioned objectives, the technical solution adopted in this invention is as follows: a Bacillus mutant strain that produces high levels of iturobrinein A. The mutant strain is obtained by genetically modifying Bacillus. The genetic modification method includes reducing the strength of the CitZ promoter in the Bacillus. Specifically, reducing the strength of the CitZ promoter involves replacing the CitZ promoter with a promoter of lower strength. The Bacillus can be any Bacillus capable of producing iturobrinein A.

[0009] The promoter with lower strength is any one of promoters A to F, with the sequence of promoter A as shown in SEQ ID NO:1, the sequence of promoter B as shown in SEQ ID NO:2, the sequence of promoter C as shown in SEQ ID NO:3, the sequence of promoter D as shown in SEQ ID NO:4, the sequence of promoter E as shown in SEQ ID NO:5, and the sequence of promoter F as shown in SEQ ID NO:6.

[0010] Accordingly, a method for improving the ability of Bacillus to produce ituronic acid A involves replacing the CitZ promoter of citrate synthase in Bacillus with a promoter of lower strength. The promoter of lower strength is any one of promoters A through F, with the sequence of promoter A shown in SEQ ID NO:1, promoter B in SEQ ID NO:2, promoter C in SEQ ID NO:3, promoter D in SEQ ID NO:4, promoter E in SEQ ID NO:5, and promoter F in SEQ ID NO:6.

[0011] Accordingly, a method for producing iturobacillus A involves culturing the Bacillus mutant strain, preferably by adding sodium citrate to the culture, wherein the amount of sodium citrate added is 0.1 to 1% of the mass of the fermentation broth.

[0012] This invention offers the following advantages: The inventors' team conducted in-depth research on the metabolic and transcriptional patterns during the fermentation synthesis of iturobrine A by Bacillus subtilis strain ZK-H2. They discovered for the first time that during the fermentation process of iturobrine A synthesis, the high-intensity tricarboxylic acid (TCA) cycle leads to carbon diversion and waste, reducing the efficiency of carbon source substrate conversion. However, on the other hand, the TCA cycle provides a large amount of energy and produces a series of intermediate products essential for cell growth and metabolic activities. Therefore, this invention replaces the CitZ promoter (metabolic restriction), a key rate-limiting enzyme in the TCA cycle, with a promoter of appropriate strength, and employs an exogenous compensation (supplementation with sodium citrate) fermentation regulation strategy, ultimately significantly improving the fermentation synthesis efficiency of iturobrine A. This invention further extends this method to other Bacillus species, finding that it has universality and can increase the yield of iturobrine A produced by Bacillus by more than 30%, demonstrating significant application value. Attached Figure Description

[0013] Figure 1 Electrophoresis diagram of PCR detection of the promoter region of the citZ gene in Bacillus subtilis ZK-H2 and mutant strain; Figure 2 Sequencing maps of the promoter regions of the Bacillus subtilis ZK-H2 and citZ mutant genes. Detailed Implementation

[0014] This invention provides a Bacillus strain that produces high levels of iturobrinein A. The citrate synthase CitZ promoter (sequences shown in SEQ ID NO: 7-12) in a Bacillus strain capable of producing iturobrinein A is obtained by replacing the promoters A-F (sequences shown in SEQ ID NO: 1-6) with promoters A-F (sequences shown in SEQ ID NO: 1-6). citZ The promoter mutant strain is a Bacillus strain that produces high levels of itucrin A. The method provided by this invention is universally applicable to Bacillus microorganisms. The new promoter sequence is shown in Table 1, and the core sequence of the replaced promoter is shown in Table 2.

[0015] Table 1. Sequence Comparison of the New Promoters

[0016] Table 2. Core sequence comparison table of each replaced promoter

[0017] The present invention also provides a method for high-yield iturobrine A production based on a Bacillus mutant strain capable of high production of iturobrine A, the method comprising the following steps: 1. Replace the CitZ promoter of citrate synthase in Bacillus with a new promoter (the core sequences are shown in SEQ ID NO:1 to 6 respectively) to obtain Bacillus mutant strains.

[0018] 2. Activate the Bacillus mutant strain and ferment it to the logarithmic phase. Then, add sodium citrate to the culture medium. The added sodium citrate accounts for 0.1-1% of the fermentation broth mass. After adding sodium citrate, ferment for 48-96 hours, at which point fermentation is complete. The fermentation broth contains the required iturobrinein A.

[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and the data obtained are all average values ​​obtained after at least three repetitions, and each repetition yields valid data.

[0020] Example 1: Construction and Validation of Bacillus Mutant Strains

[0021] The promoter of citrate synthase CitZ in the Bacillus subtilis ZK-H2 genome was replaced using the thermosensitive homologous recombination plasmid pMAD to obtain citZ promoter mutant strains. The steps included are as follows: Build citZ Promoter homologous recombination was used to replace the plasmid. Primers (containing upstream and downstream homologous arms of the pMAD insertion site) were designed to amplify the target promoter fragment. For example, using primers citZ_up_Fwd (AACAGCGCAAATGCAGTCAA) and citZ_up_Rev (CATGAAATTTAACGGTTAAATGTA) as a template, the upstream homologous arm of the citZ promoter was amplified. Using primers citZ_down_Fwd (TAAATAAGCTTATAAGAATTTG) and citZ_down_Rev (CTCGCGTTTTCCACTT) as a template, the downstream homologous arm of the citZ promoter was amplified. DNA total synthesis was used to obtain the DNA sequence (400 bp in length, identical to the original recipient bacterial sequence except for approximately 52 bp differences in the core sequence) used to replace the original citZ promoter. Using seamless cloning technology, homologous arms of the citZ promoter were ligated upstream and downstream of the target promoter and inserted into the multiple cloning site of the pMAD plasmid. The cells were then transformed into DH5α competent cells. After plating, single colonies were picked for colony PCR verification and sequencing to obtain... citZ Promoter editing plasmid.

[0022] The constructed plasmid was electroporated into the ZK-H2 strain and cultured in LB medium containing sucrose (5% sucrose, 1% tryptone, 0.5% yeast extract, 1% NaCl, 1.5% agar, pH 7.4). Single clones were picked for colony PCR verification and sequencing to obtain the promoter-substituted strain. The strain was then cultured at 43°C for 24 hours to eliminate the plasmid.

[0023] Alternatively, gene editing technology can be used to replace the citZ promoter. The steps include: digesting pJOE8999 with the LabFD™ rapid restriction enzyme BsaⅠ to obtain a linearized plasmid. Design multiple pairs of sgRNAs to improve the success rate of promoter editing. Mix the linearized vector DNA (100 ng), insert fragment DNA (10:1 molar ratio), T4 DNA Ligase Buffer, T4 Ligase, and ultrapure water, incubate at 22°C for 10 minutes, and ligate to form a recombinant plasmid. Transform the reaction solution into DH5α cells, perform heat shock and culture, screen for kanamycin-resistant colonies, and perform colony PCR identification. Perform PCR verification using specific primers pJOE-seq-F and pJOE-seq-R. pJOE-seq-F: CCCCCTATGTTTTCTCCCC; pJOE-seq-R: ATGAAACACGCATTGATTTGAGT. Extract the pJOE-sgRNA plasmid from a single clone.

[0024] The donor DNA consisted of a 791 bp upstream homologous arm, an ampicillin resistance expression cassette, a target promoter, and a 900 bp downstream homologous arm. Overlap Extend PCR was used to bridge the 791 bp upstream homologous arm with the ampicillin resistance expression cassette, target promoter, and downstream homologous arm. The acquisition of the 791 bp upstream homologous arm, target promoter, and downstream homologous arm fragments was the same as that for homologous recombinant plasmid construction. The ampicillin resistance expression cassette was directly cloned from the homologous recombinant plasmid pMAD. pJOE-sgRNA was linearized by SfiI digestion, and the complete Up-ampR-Pi-Down fragment was ligated to the designated site on pJOE-sgRNA using seamless cloning. The resulting recombination system was added to DH5α for amplification. The PCR primer pair was pJOE-seq-F and pJOE-seq-R. Single clones were picked, identified, and sequenced to obtain pJOE-sgRNA-Pi-ampR.

[0025] pJOE-sgRNA-Pi-ampR was transformed into Bacillus subtilis via electroporation. The strain was inoculated into LB medium and cultured at 30°C for 6 h, followed by induction with 0.2% mannose and shaking culture at 30°C for 16 h. After dilution, the strain was plated on LB agar plates containing 20 μg / mL kanamycin. Single clones were picked for identification and sequencing, yielding strains with successfully replaced promoters. These strains were then inoculated into LB medium and cultured at 30°C for 10 h, followed by incubation at 50°C for 6 h. After dilution, the strains were streaked onto LB agar plates and incubated statically at 42°C to complete plasmid elimination. The primers for identifying the promoter mutant strain were: gDNA-seq-F: GCAGTAAGGCGGTTCCAATT; gDNA-seq-R: ATCAATGCCGAGACTGTGGT.

[0026] Table 3 sgRNA sequence listing

[0027] In Table 3, lowercase letters in the sequence represent retained restriction enzyme sites, and uppercase letters represent reverse complementary sgRNA double strands.

[0028] PCR detection of the original strain and mutant strain, results are as follows Figure 1 As shown. Figure 1 In the study, lane 1 contained a 5kb DNA marker; lanes 2 and 3 contained the original strain; and lanes 4–18 contained the mutant strain. The results showed that the mutant strain… citZ The promoter region showed a significant increase in length, indicating successful homologous recombination. Sequencing of the CitZ gene promoter in both the original and mutant strains is shown in the sequencing maps below. Figure 2 As shown. The results show that: the mutant strain citZ The startup sub-region has been replaced correctly as expected.

[0029] Using the same method, different mutant strains were constructed using different Bacillus species. The specific correspondences of the mutant strains constructed in this example are shown in Table 4.

[0030] Table 4. Comparison of original Bacillus strains and constructed mutant strains.

[0031] Example 2: Demonstration of the ability of Bacillus mutant strains to produce iturobrinein A Iridin A was produced by fermentation using the wild-type strain from Example 1 and the corresponding synthesized mutant strain. The specific method was as follows: Single colonies of each wild-type strain and corresponding mutant strain were streaked onto LB slant agar and incubated statically at 30°C to activate the strains. The activated strains were then inoculated into 100 mL of seed culture medium (25 g / L glucose, 30 g / L fish meal peptone, 4.0 g / L KH₂PO₄, 3.0 g / L MgSO₄·7H₂O, pH=7.0) and incubated at 30°C and 150 rpm for 20 h. Subsequently, 10% (v / v) of the fermentation broth was transferred to 60 mL of fermentation medium (22 g / L glucose, 1.5 g / L KH₂PO₄, 3.8 g / L MgSO₄·7H₂O, 0.4 g / L yeast extract, 43.5 g / L soybean peptone, pH=8.0) and incubated at 30°C and 150 rpm. The fermentation time, timing, and amount of sodium citrate added for each group are shown in Table 5. The timing of sodium citrate addition refers to adding sodium citrate after fermentation in the fermentation medium for a specific period, specifically when fermentation has just entered the logarithmic phase. The timing of entering the logarithmic phase varies for different strains. The total fermentation time refers to the total fermentation time in the fermentation medium. The amount of sodium citrate added refers to the percentage of sodium citrate in the fermentation broth mass (obtained experimentally based on different strains, with the amount of sodium citrate controlled within 1%). The total fermentation time was determined when itchingin A synthesis ceased. Each group had three replicates.

[0032] Table 5 Comparison of Fermentation Conditions for Each Group

[0033] After fermentation, 1 mL of fermentation broth was taken and centrifuged at 10,000 rpm for 10 min. The supernatant was collected, and 80 μL of 15% HCl was added for acid precipitation. The mixture was allowed to stand at 4℃ for 12 h. The precipitate was recovered, and 500 μL of methanol (chromatographic grade) was added and mixed thoroughly. After sonication for 30 min, the mixture was centrifuged at 10,000 rpm for 10 min. The supernatant was filtered through an organic hydrophobic membrane with a pore size of 0.22 μm and then analyzed by HPLC. The determination conditions were: HC-C18 column, mobile phase: acetonitrile:10 mM ammonium acetate (3:4, v / v), flow rate: 0.8 mL / min, and detection wavelength: 214 nm. Iturin A standard purchased from Sigma was used as a control to calculate the Iturin A content in the fermentation broth. The results are shown in Table 6.

[0034] Table 6. Control table of iricubin A production in each group

[0035] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Any modifications, alterations, alterations, or substitutions made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A Bacillus mutant strain that produces high levels of iturobrinein A, characterized by: Genetic modification of Bacillus to obtain the Bacillus mutant strain, wherein the genetic modification method includes: reducing the strength of the CitZ promoter of citrate synthase in Bacillus.

2. The Bacillus mutant strain according to claim 1, characterized in that: Methods to reduce the strength of the CitZ promoter for citrate synthase include replacing the CitZ promoter in Bacillus with a promoter of lower strength.

3. The Bacillus mutant strain according to claim 2, characterized in that: The promoter with lower strength is any one of promoters A to F, with the sequence of promoter A as shown in SEQ ID NO:1, the sequence of promoter B as shown in SEQ ID NO:2, the sequence of promoter C as shown in SEQ ID NO:3, the sequence of promoter D as shown in SEQ ID NO:4, the sequence of promoter E as shown in SEQ ID NO:5, and the sequence of promoter F as shown in SEQ ID NO:

6.

4. The Bacillus mutant strain according to any one of claims 1 to 3, characterized in that: The Bacillus is any Bacillus capable of producing iturobrinein A.

5. A method for improving the ability of Bacillus to produce ituronic acid A, characterized in that: Replace the CitZ promoter for citrate synthase in Bacillus with a promoter of lower strength.

6. The method according to claim 5, characterized in that: The promoter with lower strength is any one of promoters A to E, with the sequence of promoter A as shown in SEQ ID NO:1, the sequence of promoter B as shown in SEQ ID NO:2, the sequence of promoter C as shown in SEQ ID NO:3, the sequence of promoter D as shown in SEQ ID NO:4, the sequence of promoter E as shown in SEQ ID NO:5, and the sequence of promoter F as shown in SEQ ID NO:

6.

7. A method for producing iturobrine A, characterized in that: Cultivate the Bacillus mutant strain according to any one of claims 1 to 4.

8. The method according to claim 7, characterized in that: Sodium citrate was added to the culture medium.

9. The method according to claim 8, characterized in that: The amount of sodium citrate added is 0.1% to 1% of the mass of the fermentation broth.

Images