SNP (Single Nucleotide Polymorphism) marker primer pair related to porcine nipple number character and application of SNP marker primer pair

Abstract

The invention relates to an SNP (Single Nucleotide Polymorphism) marker primer pair related to pig nipple number character and application thereof. The SNP marker is located on a nucleotide sequence of a PUM1 gene on a pig chromosome 6, a site of the SNP marker is a molecular marker of a nucleotide site rs326400175 of a pig chromosome 6 of a reference sequence of an international pig genome version 11.1, the SNP marker has G / C polymorphism, and the SNP marker is remarkably related to the number of papilla of a French large white pig (Plt: 0.01). According to a primer pair for detecting the SNP marker, an upstream primer is SEQ ID NO: 2, and a downstream primer is SEQ ID NO: 3. The SNP marker provided by the invention is remarkably related to the nipple number of the French large white pig, and the French large white pig strain with multiple nipples is screened by identifying the genotype of the SNP marker. By establishing the strain, the reproductive performance of the French large white pigs can be improved, and more social and economic benefits can be generated.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology and relates to an SNP marker primer pair related to the number of pig nipples and its application. Background Technology

[0002] In my country, pork is a staple meat consumed by the population. With economic development and rising living standards, the demand for pork is increasing daily. Improving the reproductive performance of sows to increase the number of market-ready pigs is currently a key focus of breeding efforts.

[0003] In pig production, teat number is one of the most important reproductive traits. Based on their location, teats can be divided into left and right teats. According to differences in physiological structure and function, teats can be classified as functional teats, inverted teats, and accessory teats. Only functional teats have normal lactation function. Therefore, teat number generally refers to the number of functional teats a sow possesses. Suckling piglets obtain the nutrients necessary for their growth and development through milk. This means that the number of teats a sow has a significant impact on the number of piglets she can nurse. If the number of piglets born exceeds the number of teats a sow has, some piglets will have to be fostered or artificially nursed to survive, significantly increasing the cost of piglet rearing. Furthermore, studies have shown that the number of teats each piglet receives from the mother is closely related to piglet survival rate and affects the final number of pigs at slaughter. Therefore, improving the teat number trait in sows is of great significance for improving sow reproductive performance.

[0004] Statistical analysis of the teat count trait in 2393 French Large White pigs revealed a coefficient of variation of 5.64%, indicating phenotypic variation within the population and suggesting potential for improvement in teat count. Therefore, utilizing molecular biology techniques to enhance the teat count trait in French Large White pigs has significant breeding value.

[0005] The number of teats is a quantitative trait with moderate heritability (0.2-0.5) and a relatively complex genetic mechanism. Conventional breeding methods have been slow to advance. Utilizing major SNP loci as molecular genetic markers for selecting for the teat number trait can accelerate genetic progress. In the QTL database (http: / / www.animalgenome.org / cgi-bin / QTLdb / SS / index), QTL regions associated with the number of teats have been identified on most chromosomes. These QTLs are mostly located through linkage analysis using microsatellite markers, resulting in large confidence intervals, making it difficult to identify key major genes and causal loci, and thus difficult to directly apply to the genetic improvement of this trait. Therefore, identifying SNP markers associated with the number of teats in French Large White pigs and using marker-assisted selection technology for the genetic improvement of the teat number trait in pigs is of great significance. Summary of the Invention

[0006] The purpose of this invention is to address the time-consuming and labor-intensive nature of traditional pig nipple number selection, which results in slow selection effects, by providing a selection molecular marker developed from SNP markers related to the number of pig nipples.

[0007] Another object of the present invention is to provide primer pairs and detection methods for detecting the above-mentioned SNP markers.

[0008] Another object of the present invention is to provide the use of the above-mentioned SNP markers, molecular markers, and primers.

[0009] The objective of this invention can be achieved through the following technical solutions:

[0010] A molecular marker associated with the number of teats in French Large White pigs is disclosed. The molecular marker sequence is shown in SEQ ID NO: 1, which contains a SNP marker site associated with the number of teats in French Large White pigs. This site is the rs326400175 nucleotide site on chromosome 6 of the international pig genome version 11.1 reference sequence. The SNP marker site described in SEQ ID NO: 1 is located at position 354 and exhibits G / C polymorphism. The total number of teats in CC-type individuals is significantly higher than that in GC-type and GG-type individuals.

[0011] A primer pair for detecting SNP markers associated with the number of teats in French Large White pigs, with the upstream primer being SEQ ID NO: 2 and the downstream primer being SEQ ID NO: 3; the SNP marker associated with the number of teats in French Large White pigs is located on the nucleotide sequence of the PUM1 gene on chromosome 6 of pigs. The SNP marker site is the molecular marker at nucleotide position rs326400175 on chromosome 6 of the international pig genome version 11.1 reference sequence, and it exhibits G / C polymorphism. The SNP marker is highly significantly correlated with the number of teats in French Large White pigs (P<0.01), and the total number of teats in CC-type individuals is significantly higher than that in GC-type and GG-type individuals.

[0012] A method for detecting SNP markers associated with the number of teats in French Large White pigs includes PCR amplification of a sequence at nucleotide site rs326400175 on chromosome 6 of the French Large White pig international pig genome version 11.1 reference sequence, sequencing the amplified product, and interpreting the G / C polymorphism at that site.

[0013] As a preferred embodiment of the present invention, the method includes the following steps:

[0014] (1) Extract total DNA from tissue samples of French Large White pigs;

[0015] (2) Using the extracted Large White pig genomic DNA as a template, PCR amplification was performed using the primer pair described above;

[0016] (3) Sequencing of the amplified product, analysis of the sequencing results, and interpretation of the G / C polymorphism at position 354 of SEQ ID NO: 1.

[0017] The application of SNP markers associated with the number of teats in French Large White pigs in screening for multi-teeth French Large White pig populations. The SNP markers are molecular markers located at nucleotide position rs326400175 on chromosome 6 of the international pig genome version 11.1 reference sequence, and exhibit G / C polymorphism. The SNP markers are highly significantly correlated with the number of teats in French Large White pigs (P<0.01), and the total number of teats in CC-type individuals is significantly greater than that in GC-type and GG-type individuals.

[0018] The application of the molecular markers described in this invention in screening multi-papill French Large White pig populations.

[0019] The application of the primer pairs described in this invention in screening multi-papill French Large White pig populations.

[0020] A method for screening French Large White pig populations with multiple nipples includes detecting the genotype of the rs326400175 nucleotide site on chromosome 6 of the French Large White pig international pig genome version 11.1 reference sequence, and selecting individuals with the CC type at the rs326400175 nucleotide site as priority for breeding.

[0021] Beneficial effects

[0022] This invention develops a SNP marker associated with the number of teats in French Large White pigs and provides primer pairs and methods for detecting this marker. French Large White pig breeds with multiple teats can be screened by identifying the genotype of this SNP marker. The establishment of this breed can improve the reproductive performance of French Large White pigs and generate greater social and economic benefits. Attached Figure Description

[0023] Figure 1 A gel image showing the PCR amplification of the rs326400175 site of the PUM1 gene on chromosome 6 of French Large White pigs.

[0024] Figure 2 Example of a typing diagram of the rs326400175 locus of the PUM1 gene on chromosome 6 of French Large White pigs.

[0025] A is of type GG, B is of type GC, and C is of type CC. Detailed Implementation

[0026] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0027] Example 1

[0028] 1. Source of experimental animals

[0029] Henan Minwang Agriculture and Animal Husbandry Co., Ltd.

[0030] 2. Extraction of genomic DNA from French Large White pigs

[0031] One ear tissue sample was collected from 2,393 French Large White pigs for individual DNA extraction.

[0032] Referring to the instructions for the Tissue DNA Extraction Kit from Tiangen Biotech Co., Ltd., the extraction steps are as follows:

[0033] ① First, add 68 mL of buffer GD and 200 mL of anhydrous ethanol to the wash buffer PW, and mix thoroughly.

[0034] ② Collect approximately 100 mg of ear tissue sample and place it in a 2 mL EP tube. After completely cutting it into small pieces, add 200 μL of buffer GA and shake until completely suspended.

[0035] ③ Add 20 μL of proteinase K solution, mix well, and place in a 56 ℃ metal bath for digestion overnight until the tissue sample dissolves. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0036] ④ Add 200 μL of buffer GB, mix thoroughly by inverting, place in a 70 ℃ metal bath for 10 min, the solution should become clear, and briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0037] ⑤ Add 200 μL of anhydrous ethanol and shake thoroughly for 15 seconds. At this time, flocculent precipitate may appear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0038] ⑥ Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3, place the adsorption column in the collection tube, then centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0039] ⑦ Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 into the collection tube.

[0040] ⑧ Add 600 μL of washing buffer PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, and place the adsorption column CB3 into the collection tube.

[0041] ⑨ Repeat step ⑧.

[0042] ⑩ Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 min, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to thoroughly dry any residual washing liquid in the adsorption material.

[0043] ⑪ Transfer the adsorption column CB3 into a clean centrifuge tube, add 100 μL of elution buffer TE to the middle of the adsorption membrane, incubate at room temperature for 2-5 min, centrifuge at 12,000 rpm for 2 min, collect the solution into the centrifuge tube, add the centrifuged solution back into the adsorption column CB3, incubate at room temperature for 2 min, centrifuge at 12,000 rpm for 2 min, collect the solution into the centrifuge tube.

[0044] The quality and concentration of DNA were determined using a Nanodrop-2000 spectrophotometer. All DNA concentrations were diluted to 50 ng / μL and stored at -20 ℃ for later use.

[0045] 3. PCR amplification and sequencing of the target fragment

[0046] PCR amplification was performed using French Large White pig genomic DNA as a template. The reaction system included 1 μL of DNA template, 1 μL each of the primers shown in SEQ ID NO: 2 (CACCACAACAGGAACTCTGATCAA) and SEQ ID NO: 3 (ATTGAACTGGAGCTTCAGTTGCCA), and 22 μL of PCR mix. The amplification program was as follows:

[0047]

[0048] The amplification product was subjected to agarose gel electrophoresis. The product fragment size was approximately 618 bp. The electrophoresis results are as follows: Figure 1 As shown. The remaining amplification products were sequenced, and the sequencing results were compared and verified for accuracy using DNAman software. The rs326400175 site was genotyped using Chromas software.

[0049] 4. Statistical Analysis

[0050] The association analysis between genotype and phenotype was performed using a general linear model in R4.3.1 software. The model is as follows:

[0051] y mn = μ + sex m + g n + e mn

[0052] Among them, y mn The number of nipples per individual; μ represents the mean number of nipples in the population; sex m The fixed effect of representative gender; g n For the fixed effect of SNP labeling; e mn It is a residual.

[0053] 5 Results

[0054] Table 1 shows the effects of different genotypes at the rs326400175 locus on the number of teats in French Large White pigs. The results indicate that there were significant differences in the number of teats among individuals with the three genotypes at the rs326400175 locus (P<0.05). Specifically, individuals with the CC genotype had significantly more teats than those with the GC and GG genotypes (P<0.05). Therefore, selective breeding for individuals with the CC genotype at the rs326400175 locus in French Large White pigs is beneficial for increasing the number of teats in the population, thereby improving the reproductive performance of French Large White pigs.

[0055] Table 1. Association analysis between the PUM1 gene rs326400175 locus on chromosome 6 of pigs and the number of teats in French Large White pigs.

[0056] Trait P Value Genotype (Mean±SE) CC(n=708) GC(n=1172) GG(n=513) Total number of nipples <0.0001 <![CDATA[16.73±0.0196 a ]]> <![CDATA[16.63±0.0188 b ]]> <![CDATA[16.50±0.0190 c ]]>

[0057] Note: Different letters in the same row of numbers indicate significant differences (P<0.05).

Claims

1. A molecular marker associated with the number of teats in French Large White pigs, characterized in that, The molecular marker sequence is shown in SEQ ID NO: 1, which contains an SNP marker site associated with the number of teats in French Large White pigs. This site is the rs326400175 nucleotide site on chromosome 6 of the pig in the international pig genome version 11.1 reference sequence. The SNP marker site described in SEQ ID NO: 1 is located at position 354 and exhibits G / C polymorphism. The total number of teats in CC-type individuals is significantly higher than that in GC-type and GG-type individuals.

2. A primer pair for detecting the SNP marker associated with the number of teats in French Large White pigs as described in claim 1, characterized in that, The upstream primer is SEQ ID NO: 2, and the downstream primer is SEQ ID NO: 3; the SNP marker associated with the number of teats in French Large White pigs is located on chromosome 6 of the pig. PUM1 The SNP marker on the nucleotide sequence of the gene is a molecular marker at nucleotide position rs326400175 on chromosome 6 of the pig in the international pig genome version 11.1 reference sequence, and it exhibits G / C polymorphism. This SNP marker is highly significantly correlated with the number of teats in French Large White pigs. P <0.01), the total number of nipples in CC-type individuals was significantly greater than that in GC-type and GG-type individuals.

3. A method for detecting SNP markers related to the teat count trait of French Large White pigs as described in claim 1, characterized in that, The sequence contains a PCR amplification of a segment of the rs326400175 nucleotide site on chromosome 6 of the French Large White pig international pig genome version 11.1 reference sequence. The amplification product was sequenced to determine the G / C polymorphism at this site.

4. The method according to claim 3, characterized in that... Includes the following steps: (1) Extract total DNA from tissue samples of French Large White pigs; (2) Using the extracted Large White pig genomic DNA as a template, perform PCR amplification using the primer pair described in claim 2; (3) Sequencing of the amplified product, analysis of the sequencing results, and interpretation of the G / C polymorphism at position 354 of SEQ ID NO:

1.

5. Application of SNP markers associated with the number of teats in French Large White pigs in screening multi-teeth French Large White pig populations. The SNP markers are molecular markers located at nucleotide position rs326400175 on chromosome 6 of the international pig genome version 11.1 reference sequence, and exhibit G / C polymorphism. The SNP markers are highly significantly correlated with the number of teats in French Large White pigs. P <0.01), the total number of nipples in CC-type individuals was significantly greater than that in GC-type and GG-type individuals.

6. The application of the molecular marker of claim 1 in screening multi-papill French Large White pig populations.

7. The application of the primer pair according to claim 2 in screening multi-papill French Large White pig populations.

8. A method for screening a population of multi-nippled Large White pigs, characterized in that... This includes detecting the genotype of the rs326400175 nucleotide site on chromosome 6 of the Large White pig in the international pig genome version 11.1 reference sequence, and selecting individuals with the CC type at the rs326400175 nucleotide site as priority for breeding.

Images