InDel marker for regulating and controlling nipple number heterosis on pig chromosome 9 and application of InDel marker in pig crossbreeding
By detecting and selecting T/T type pigs on pig chromosome 9, and using InDel markers to regulate nipple number heterosis, the problem of insufficient improvement in sow reproductive performance was solved, resulting in a significant improvement in sow reproductive capacity and production efficiency.
Patent Information
- Application Number
- CN202511611451.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-05
- Publication Date
- 2026-01-27
AI Technical Summary
Existing technologies cannot effectively utilize the InDel marker on pig chromosome 9 to regulate nipple number heterosis, resulting in insufficient improvement in sow reproductive performance and affecting the production efficiency of the pig farming industry.
An InDel marker located on chromosome 9 of pigs is provided. By detecting pig individuals with the genotype T/T, TC/TC and T/TC individuals are eliminated, and T/T type individuals are bred. The InDel marker is used for molecular marker-assisted selection to improve the heterosis of nipple number.
It significantly improves the reproductive capacity of sows, increases the number of weaned piglets, enhances the production efficiency of breeding sows, shortens the generation interval of genetic progress, and improves the competitiveness of breeding enterprises.
Smart Images

Figure CN121406789A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic breeding technology and relates to the application of the InDel marker located on chromosome 9 of pigs, which regulates heterosis by regulating the number of nipples. Background Technology
[0002] The pig farming industry plays a vital role in agricultural economic development. One of the direct factors affecting the efficiency of pig production is the reproductive performance of breeding pigs, and the low productivity of breeding sows is one of the major challenges that the pig farming industry currently needs to address. Therefore, improving sow reproductive performance is an important direction for pig genetic improvement. Teat count, as an important indicator of breeding pig genetic improvement, is a crucial determinant of sow fertility and is essential for increasing the number of weaned piglets.
[0003] Heterosis, an important genetic resource widely found in plants and animals, refers to the phenomenon where hybrid offspring exhibit superior traits compared to their parents. Over the past half-century, the utilization of heterosis in rice breeding has significantly increased rice yields, making a crucial contribution to food security and serving as an important agricultural pathway to address rapid global population growth and climate change, and to meet global food demands. In pig farming, the Duroc-Landrace-Large White three-way crossbred pig, produced by crossing lean-type breeds Duroc, Landrace, and Large White, is a commonly used three-way crossbred pig combination model in my country. It is characterized by high feed conversion ratio and high lean meat percentage, making it suitable for intensive pig farms and large-scale pig farms with high production levels. Summary of the Invention
[0004] The purpose of this invention is to provide an InDel marker located on chromosome 9 of pigs that can regulate heterosis in pig nipple number and its application.
[0005] According to one aspect of the present invention, an InDel marker is provided that regulates heterosis in the number of nipples on chromosome 9 of a pig. The site is located between positions 79 and 80 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to a C insertion mutation between positions 11197897 bp and 11197898 bp on chromosome 9 of the International Swine Reference Genome 11.1. The genotype of the InDel marker is T / T, T / TC, or TC / TC.
[0006] The InDel-tagged nucleotide sequences are shown in SEQ ID NO:1 or SEQ ID NO:2. The only difference between the DNA fragment with SEQ ID No:2 (insertion type, TC) and the DNA fragment with SEQ ID No:1 (wild type, T) is that the insertion type has a nucleotide C inserted between position 79 (T) and position 80 (C) of SEQ ID No:1.
[0007] The InDel marker provided by this invention is significantly correlated with the heterosis trait of nipple number in pigs and can be used to regulate heterosis of nipple number. The T / T genotype is the dominant genotype for heterosis of nipple number in pigs. By detecting the genotype of this InDel marker, the heterosis trait of nipple number in pigs can be identified. In pig crossbreeding, selecting pigs with the T / T genotype of the InDel marker can accelerate the breeding process and achieve genetic improvement in pigs.
[0008] Therefore, the InDel marker located on chromosome 9 of pigs, which regulates heterosis by regulating nipple number, provided by this invention, can be applied to: (1) Identify the heterosis trait of the number of teats in pigs; (2) Prepare products for identifying heterosis traits in the number of teats in pigs; (3) Pig genetic improvement, based on the selection of pigs with the InDel marker genotype T / T to improve the heterosis of the number of teats in pigs, and to achieve the genetic improvement of pigs; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of the InDel marker genotype to assist in the genetic improvement of pigs.
[0009] According to a second aspect of the invention, an application is provided for detecting an InDel marker located on chromosome 9 of pigs that regulates heterosis in the number of nipples, the application comprising at least one of the following (1) to (4): (1) Identify the heterosis trait of the number of teats in pigs; (2) Prepare products for identifying heterosis traits in the number of teats in pigs; (3) Pig genetic improvement, based on breeding pigs with the InDel marker genotype T / T to improve the heterosis of pig nipple number; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of the InDel marker genotype to assist in the genetic improvement of pigs.
[0010] In some embodiments, products for detecting InDel markers located on pig chromosome 9 that regulate nipple number heterosis may include at least one of the following: reagents, kits, chips, and devices for detecting InDel markers located on pig chromosome 9 that regulate nipple number heterosis.
[0011] In some embodiments, the reagent for detecting InDel markers located on chromosome 9 of pigs that regulate nipple number heterosis may include at least one of the following: primers or probes for detecting InDel markers located on chromosome 9 of pigs that regulate nipple number heterosis.
[0012] In some implementations, the pigs are Duroc × Landrace × Large White three-way crossbred pigs, i.e., Duroc × Landrace × Large White three-way crossbred pigs.
[0013] According to a third aspect of the present invention, a primer pair for detecting InDel markers located on chromosome 9 of pigs that regulate heterosis in the number of nipples is provided, the primer pair comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:3 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:4.
[0014] According to a fourth aspect of the invention, a kit is provided for detecting InDel markers located on pig chromosome 9 that regulate heterosis in the number of nipples, the kit comprising primer pairs with nucleotide sequences as shown in SEQ ID NO:3 and SEQ ID NO:4.
[0015] In some embodiments, the kit for detecting InDel markers located on porcine chromosome 9 that regulate nipple number heterosis may further include: dNTPs, DNA polymerase, and Mg. 2+ Components of a conventional PCR reaction system, such as PCR reaction buffer.
[0016] According to a fifth aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the InDel marker located on chromosome 9 of pigs that regulates heterosis by the number of teats; (2) Select individuals with the InDel marker genotype T / T and eliminate individuals with the genotypes TC / TC and T / TC, thereby increasing the number of teats in offspring pigs.
[0017] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.
[0018] In some implementations, in step (1), the breeding pig is a Duroc-Landrace-Landrace-Landrace-Landrace-Handcross hybrid.
[0019] In some implementations, step (1), determining the genotype of the InDel marker located on chromosome 9 of pigs that regulates heterosis in the number of teats, includes the following steps: Whole-genome DNA was extracted from breeding pigs, and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:3 and SEQ ID NO:4. The amplified products were sequenced, and the genotype of the InDel marker located on chromosome 9 of pigs, which regulates heterosis in the number of nipples, was determined based on the sequencing results.
[0020] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention provides an InDel marker located on the nucleotide sequence of chromosome 9 of pigs that is related to heterosis of nipple number in pigs, and verifies its effect on heterosis of nipple number in pigs. This helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of nipple number in pigs, improve the production efficiency of breeding sows, and increase the number of weaned piglets.
[0021] (2) This invention provides a primer pair that can be used to identify InDel markers located on chromosome 9 of pigs that affect heterosis in the number of pig nipples. This primer pair enables the establishment of an efficient and accurate molecular marker-assisted breeding technology, allowing for rapid and accurate selection of traits and accelerating the breeding process. Applying this technology to a genetic improvement program for the number of pig nipples can significantly improve the reproductive capacity of sows, thereby increasing the profits of livestock farming enterprises and enhancing their core competitiveness.
[0022] (3) This invention provides a genetic improvement method for pigs based on the InDel marker located on chromosome 9 of pigs, which affects heterosis in the number of pig teats. This method can accelerate genetic progress and shorten the generation interval. By selecting all TC / TC type individuals with the InDel marker affecting heterosis in the number of pig teats into T / T type individuals, the median heterosis value of the offspring in the number of teats compared to the parents is increased by an average of 7.54%, which can significantly improve the reproductive capacity of sows and increase the number of weaned piglets. Attached Figure Description
[0023] Figure 1 Genome-wide association study (GWAS) plot of parental dominance in the nipple number trait of Duroc-Landrace-Large White crossbred pigs on chromosome 9; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log P value; Figure 2 The image shows a visualization of the IGV in the bam file obtained by aligning the InDel marker region of the present invention to the International Swine Reference Genome 11.1 version during whole-genome variant genotyping. As can be seen from the image, the InDel marker of the present invention exists on chromosome 9 of the International Swine Reference Genome 11.1 version. Figure 3 This is a graph showing the phenotypic ratios of parental dominance in the nipple number trait among pigs of different genotypes; among them, *** express P<0.001, **** express P <0.0001. Detailed Implementation
[0024] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.
[0025] Example 1: Identification and verification of the InDel locus associated with heterosis in the number of teats in pigs. (1) Experimental pig herd The experimental pig population used in this invention consisted of 1421 three-way crossbred pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd., and 74 Duroc, 161 Landrace, and 156 Large White grandparent pigs identified by pedigree. The Duroc, Landrace, and Large White pigs were the core population of the breeding pig division, with detailed pedigree records. The pigs had free access to feed and water, and the feeding methods and rearing conditions remained consistent throughout the process, following conventional methods.
[0026] (2) Phenotypic measurement Mid-parent heterosis refers to the degree of dominance of a particular trait in a hybrid compared to the mean value of the same trait from both parents. The calculation formula is as follows:
[0027] F1 refers to the phenotypic value of three-way crossbred pigs, P D P refers to the phenotypic value of Duroc pig parents. L P refers to the phenotypic value of the Landrace pig parent. Y Phenotypic values of the Large White pig parent line.
[0028] (3) Extraction of porcine genomic DNA Ear tissue samples from each Duroc-Landrace-Large White crossbred pig were collected to extract whole-genome DNA using the standard phenol-chloroform method. The DNA quality and concentration were determined using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.
[0029] (4) Genotyping of pig whole genome variation DNA samples were subjected to next-generation sequencing by Beijing Novogene Technology Co., Ltd., and the sequencing results were in FASTQ format.
[0030] First, GATK v4.0.2.1 software was used to generate a dict file based on the pig reference genome (Sscrofa11.1). Second, BWA-MEM-0.7.12 software was used to correlate FASTQ data reads onto the pig reference genome. Third, SAMtools v1.9 software was used to generate a bam file. Fourth, Sentieon software (version 202010) was used for variant detection, during which "--algo LocusCollector", "--algo Realigner", "--algoQualCal", "--algo Haplotyper", and "algo GVCFtyper" were used to ultimately generate the VCF file for the three-way crossbred pig. Finally, the "VariantFiltration" function of GATK v4.0.2.1 software was used to filter SNPs, with the default parameters being: "QD<2.0, FS>60.0, SOR>3.0, MQ<40.0, MQRankSum<12.5, ReadPosRankSum<-8.0". For INDEL filtering, the parameters were: "QD<2.0, QUAL<50.0, FS>100.0, and ReadPosRankSum<-20.0". Finally, PLINK v1.9 was used to perform quality control on the obtained genotype data, removing variant sites with a detection rate <90%, a mimor allelic frequency (MAF) <5%, and excluding variant sites located at unknown locations and on sex chromosomes. The final 21,002,909 variant sites and 1421 samples were used for subsequent data analysis.
[0031] (5) Genome-wide association analysis (GWAS) Because kinship and population stratification effects can cause false positives, a kinship matrix needs to be constructed using GCTA software before association analysis. Principal component analysis is then performed using GCTA software, with the first three principal components used as covariates to correct for population structure. Finally, GWAS analysis is performed using a mixed linear model in GCTA software. This invention references the human genome significance threshold, setting the genomic significance and chromosomal significance thresholds to 5.00E-08 and 1.00E-06, respectively.
[0032] GWAS analysis results are as follows Figure 1 As shown.
[0033] from Figure 1It can be seen that in Duroc-Landrace-Landrace-Large White crossbred pigs, there is an InDel locus on chromosome 9 that significantly affects heterosis in terms of nipple number, with the strongest associated InDel being 9_11197897_T_TC ( P = 7.11×10 -10 The 79th nucleotide in SEQ NO.1 corresponds to the T>TC mutation at position 11197897p on chromosome 9 in International Pig Reference Genome Version 11.1.
[0034] (6) Analyze the association between different genotypes and the parental dominance phenotype in the number of teats in three-way crossbred pigs to verify the effect of the InDel locus on the heterosis trait of teat number in pigs. The results are shown in Table 1. Figure 3 As shown.
[0035] As shown in Table 1, the InDel marker of this invention is significantly correlated with parental dominance in the number of nipples. P The value <0.01 indicates that this molecular marker significantly affects the heterosis of nipple number in pigs. By assisted selection of this InDel site in pigs, the heterosis of nipple number in this population can be improved, thereby accelerating the breeding process of sow fertility.
[0036] Additionally, according to Table 1, Figure 3 Furthermore, it was found that the TC / TC type exhibited a lower parental heterosis in teat number compared to the T / TC and T / T types, indicating that T / T is the dominant genotype for teat number heterosis. Teat number, as an important indicator of boar genetic improvement, is a crucial determinant of sow reproductive capacity and is essential for increasing the number of weaned piglets. Therefore, during the breeding process, gradually culling TC / TC and T / TC type boars while retaining T / T type boars can significantly improve sow reproductive capacity and increase the number of weaned piglets.
[0037] Table 1. Correlation analysis between InDe molecular markers and traits
[0038] (7) Effect analysis This invention provides an InDel marker that can significantly improve heterosis in pig teat number. Using this InDel marker for marker-assisted selection, gradually culling pigs with genotypes TC / TC and T / TC within the population can significantly improve sow reproductive capacity and increase the number of weaned piglets. By selecting all TC / TC individuals with the InDel marker affecting heterosis in pig teat number to become T / T individuals, the median heterosis value of the offspring's teat number compared to the parents increased by an average of 7.54%.
[0039] Example 2: Methods for genetic improvement of pigs The nucleotide sequences of the target fragment containing the InDel site, which is significantly associated with the heterosis trait of nipple number in Duroc-Landrace-Large White crossbred pigs, are shown in SEQ ID NO:1 and SEQ ID NO:2, and the primer pairs for its PCR amplification are shown in SEQ ID NO:3 and SEQ ID NO:4.
[0040] SEQ ID NO:1 TTAGGGGCTAAGCTGGTTCCCTCGGAGGGCTCCAGGGGAGCCTCTGTTCCTTGTGGCCCCGTCACCCCAGGGTCTCCT T CGTTGTCACCTTGTTCTTTTCCTCCTTCGGAGTCAGATCTCCCTCTGCACCCCGCGCCCCCCGCCCCGAACTCCTGTGACTACA SEQ ID NO:2 TTAGGGGCTAAGCTGGTTCCCTCGGAGGGCTCCAGGGGAGCCTCTGTTCCTTGTGGCCCCGTCACCCCAGGGTCTCCT TC CGTTGTCACCTTGTTCTTTTCCTCCTTCGGAGTCAGATCTCCCTCTGCACCCCGCGCCCCCCGCCCCGAACTCCTGTGACTACA The T or TC marked in the sequence are mutation sites, which are allele mutations; the bolded beginning and end of the sequence indicate the primer binding positions.
[0041] Upstream primer-F: 5'-TTAGGGGCTAAGCTGGTTCC-3' (SEQ ID NO:3); Downstream primer primer-R: 5'- TGTAGTCACAGGAGTTCGGG-3' (SEQ ID NO:4).
[0042] The genetic improvement methods for pigs include the following steps: S1. Determine the genotype of the InDel marker for heterosis in pigs with controllable teat number. (1) Take ear tissue from pigs and extract the whole genome DNA of pigs according to the standard phenol-chloroform method. Then, perform quality testing and concentration determination on the extracted DNA.
[0043] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of a conventional PCR reaction system, such as PCR reaction buffer.
[0044] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.
[0045] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, with gene fragments sequenced in both forward and reverse reactions. The genotype of the pig using the InDel marker was determined based on the sequencing results. S2. Select pigs with the InDel marker genotype T / T as parents for breeding.
[0046] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.
Claims
1. An InDel marker on pig chromosome 9 that regulates heterosis by regulating nipple number, characterized in that... The InDel-tagged nucleotide sequence is shown in SEQ ID NO:1 or SEQ ID NO:
2.
2. The application of the InDel-marked product according to claim 1, characterized in that, The application includes at least one of the following items (1) to (4): (1) Identify the heterosis trait of the number of teats in pigs; (2) Prepare products for identifying heterosis traits in the number of teats in pigs; (3) Pig genetic improvement, based on breeding pigs with the InDel marker genotype T / T to improve the heterosis of pigs in terms of the number of teats; (4) Prepare a product for assisting in the genetic improvement of pigs, the product being based on the identification of the genotype of the InDel marker to assist in the genetic improvement of pigs.
3. The application according to claim 2, characterized in that, The detection of the InDel-marked product according to claim 1 includes at least one of the following: reagents, kits, chips, and devices for detecting the InDel-marked product.
4. The application according to claim 3, characterized in that, The reagents used to detect the InDel label include at least one of the following: primers or probes for detecting the InDel label.
5. The application according to any one of claims 2 to 4, characterized in that, The pigs in question are Duroc-Landrace-Large White crossbred pigs.
6. A primer pair for detecting the InDel-labeled primer pair according to claim 1, characterized in that, The primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:
4.
7. A kit for detecting InDel labeling according to claim 1, characterized in that, Its composition includes the primer pair as described in claim 6.
8. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the pig using the InDel marker as described in claim 1; (2) Select individuals with the InDel marker genotype T / T and eliminate individuals with the genotypes TC / TC and T / TC.
9. The method for genetic improvement of pigs according to claim 8, characterized in that, In step (1), the method for determining the genotype of the pig according to claim 1 using the InDel marker includes the following steps: Whole-genome DNA was extracted from pigs and amplified by PCR using primer pairs with nucleotide sequences as shown in SEQ ID NO:3 and SEQ ID NO:
4. The amplified products were sequenced, and the genotype of the pigs with the InDel marker as described in claim 1 was determined based on the sequencing results.
10. The method for genetic improvement of pigs according to claim 8 or 9, characterized in that, The pigs in question are Duroc-Landrace-Large White crossbred pigs.