PAM-limitation-free SNM detection method based on CRISPR / Cas12a system and application of PAM-limitation-free SNM detection method
By employing a PAM-free detection method based on the CRISPR/Cas12a system, combined with engineered crRNA and aPCR amplification, the problems of high detection range and cost have been solved, enabling rapid, accurate, and low-cost detection of pathogens such as MRSA, which is suitable for primary healthcare settings.
Patent Information
- Application Number
- CN202511933701.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-19
- Publication Date
- 2026-01-30
AI Technical Summary
Existing CRISPR-Cas12a detection methods are limited by PAM when detecting single nucleotide mutations (SNMs), resulting in limited detection range and flexibility, high costs, and difficulty in promotion in primary healthcare settings, especially in low-frequency mutation abundance or complex samples where detection performance is poor.
A PAM-free detection method based on the CRISPR/Cas12a system was developed. By designing engineered crRNA and tool target heteroduplexes, combined with aPCR nucleic acid amplification, a highly specific detection method for target ssDNA was achieved, overcoming the PAM limitation and making it suitable for rapid and accurate detection of pathogens such as MRSA.
It significantly improves the detection range and sensitivity of single base mutations, achieves highly specific and sensitive detection of drug-resistant bacteria, reduces detection costs, and is suitable for point-of-care testing in grassroots areas.
Smart Images

Figure CN121428071A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a biological detection technology, specifically to a method for detecting SNM without PAM limitations based on a CRISPR / Cas12a system and its application. Background Technology
[0002] In single nucleotide mutations ( Single Nucleotide Mutation SNM (Synthetic Substances Mutation) is a stable base variation in the gene sequence of pathogens and is a key molecular marker for distinguishing drug-resistant bacteria from other pathogens. SNM-based detection technology has become one of the core technologies for detecting drug-resistant bacteria due to its advantages of high specificity and high sensitivity.
[0003] In medical and health applications, rapid and accurate detection of single nucleotide mutations (SNMs) in drug-resistant bacteria is crucial for the development of appropriate treatment strategies for drug-resistant microbial infections and for the detection and control of pathogen transmission. Currently, mainstream methods for SNM detection include high-throughput sequencing (such as next-generation sequencing), genome-wide association studies (GWAS) microarray sequencing, and single-molecule sequencing (nanopore sequencing). While these methods can effectively detect SNMs, they are generally costly, heavily reliant on specialized personnel and equipment, and cannot provide rapid, real-time detection, thus limiting their application in clinical and public health fields.
[0004] In recent years, the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) system has been increasingly developed for use in nucleic acid molecular diagnostics. The CRISPR-Cas12a protein, as an RNA-guided endonuclease, possesses the ability to recognize specific target DNA and can identify single-base mutations within a certain range. After correctly recognizing the target, this system rapidly initiates trans-cleavage of the fluorescent probe, converting the detection signal into a fluorescent signal for characterization. It is a promising nucleic acid detection tool for identifying drug-resistant SNM bacteria.
[0005] Traditional CRISPR-Cas12a detection methods have limitations, including PAM restriction and a narrow single-base recognition range. They only show good recognition of single-base mutations in the DNA double strand within the seed region near the PAM ends (positions 1-6), limiting the scope and flexibility of single-base mutation detection. Existing CRISPR-Cas12a-based SNM detection methods mainly focus on optimizing and improving target sequence enrichment strategies and signal readout amplification methods. For example, the RPA-Cas12a isothermal amplification method amplifies the target sequence containing the SNM site using RPA and mismatched primer pairs, and then combines this with CRISPR-Cas12a to detect SNM. While this method can achieve rapid SNM detection, RPA is costly and prone to generating non-specific amplification products, resulting in low detection sensitivity. Two other methods utilize external instruments and materials for signal amplification and visualization in SNM detection. These include the CRISPR-Cas12a lateral flow test strip visualization method and the digital microfluidic CRISPR-Cas12a quantitative detection method. While these methods achieve visualized SNM detection, they exhibit poor tolerance to sample matrices during actual testing. Their sensitivity is typically lower than fluorescence detection methods when detecting complex samples, and their accuracy and stability are relatively insufficient. While the digital microfluidic method can perform precise quantitative analysis of SNM, it heavily relies on dedicated microfluidic chips and supporting instruments, resulting in high equipment costs and hindering its widespread adoption in primary healthcare settings.
[0006] Currently, the CRISPR-Cas12a detection method has several drawbacks in practical applications, such as poor detection performance for low-frequency mutation abundance or mutations in complex sample backgrounds (e.g., mixed pathogen infection) and insufficient detection specificity; or although the detection effect is high, the high detection cost makes it difficult to promote and apply at the grassroots level. Summary of the Invention
[0007] To address the aforementioned technical problems, the present invention aims to provide a method for detecting SNMs based on the CRISPR / Cas12a system without PAM restrictions and its application. This method targets ssDNA, is not limited by PAM, and allows for greater freedom in target sequence selection; combined with aPCR nucleic acid amplification, it enables rapid, accurate, and highly specific detection of SNMs in pathogens such as MRSA.
[0008] The technical solution of the present invention is as follows: A method for detecting SNM without PAM limitations based on a CRISPR / Cas12a system includes the following steps: S1. Obtain the target ssDNA strand Genomic DNA was extracted from the test sample and normal bacteria, respectively. Primers were designed with the common gene between the drug-resistant bacteria and normal bacteria as the target gene. aPCR amplification was performed to obtain the test target ssDNA chain and the control target ssDNA chain. S2. Obtaining engineered crRNA and tool target heteroduplexes Based on the target ssDNA strand, a corresponding crRNA was designed. A Blocker strand complementary to the nucleic acid sequence containing a single-base mutation site in the non-seed region of the crRNA's Spacer region was designed. The two were combined to obtain the engineered crRNA. A long tool chain complementary to the nucleic acid sequence of the target ssDNA strand was designed. A short tool chain complementary to the long tool chain was designed. The target ssDNA strand and the control target ssDNA strand were combined with the long tool chain and the short tool chain, respectively, to obtain the target tool target heteroduplex and the control tool target heteroduplex. The 3' end region of the long tool chain is complementary to the nucleic acid sequence of the target ssDNA chain, and its 5' end region is complementary to the 3' end region of the short tool chain. The region between the 3' end region and the 5' end region is PAM1; the 5' end region of the short tool chain is PAM2; PAM1 and PAM2 are complementary genes. S3, Detection of SNM in drug-resistant bacteria using a Cas12a / CRISPR coupled system. The CRISPR / Cas12a protein opens the heteroduplex of both the test target and the control target, causing the engineered crRNA to undergo a strand displacement reaction with the target heteroduplex, generating a fluorescent signal. If the fluorescence signal F1 of the test target heteroduplex is higher than that of the control target heteroduplex, the sample is considered to have undergone SNM and is a drug-resistant bacterium. If the fluorescence signal F1 of the test target heteroduplex is less than or equal to that of the control target heteroduplex, the sample is considered to have not undergone SNM and is a normal bacterium.
[0009] Furthermore, step S3 also includes: calculating the repeatability verification signal difference factor DF of the fluorescence signal. DF = F1, F2, and F0 are the fluorescence signal values generated when the target is drug-resistant bacteria, normal bacteria, and NONE target, respectively. If DF≥2, the sample under test has SNM and is a drug-resistant bacteria; if DF<2, the sample under test has not SNM and is a normal bacteria.
[0010] Furthermore, the drug-resistant bacteria are any one of methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant Staphylococcus aureus (VRSA), vancomycin-resistant enterococci (VRE), penicillin-resistant Streptococcus pneumoniae (PRSP), carbapenem-resistant Pseudomonas aeruginosa (CRPA), or multidrug-resistant Mycobacterium tuberculosis (MDR-TB).
[0011] Furthermore, for the detection of methicillin-resistant Staphylococcus aureus (MRSA), the nuc gene is used as the target gene; for the detection of carbapenem-resistant Pseudomonas aeruginosa (CRPA), the phzM gene can be used as the target gene; for the detection of isoniazid-resistant Mycobacterium tuberculosis (MDR-TB), the KatG gene can be used as the target gene; and for the detection of vancomycin-resistant Enterococcus (VRE), the esp gene can be used as the target gene.
[0012] Furthermore, the aPCR amplification reaction system comprises a total volume of 30 μL, including 2.1 μL of 10 μM forward primer, 0.6 μL of 1 μM reverse primer, 2 μL of DNA template, 15 μL of 2×TaKaRa Taq enzyme, and 9.3 μL of DEPC water.
[0013] Furthermore, the preparation system of the engineered crRNA includes: a Blocker chain, crRNA, DEPC water, and hybridization buffer 1; the hybridization buffer 1 consists of 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM dithiothreitol, and pH=7.9.
[0014] Furthermore, the molar ratio of the Blocker chain to crRNA is 2:1.
[0015] Furthermore, the preparation system of the tool target heteroduplex includes: a long tool chain, a short tool chain, a target ssDNA chain / control target ssDNA chain, DEPC water, and hybridization buffer 2; the hybridization buffer 2 consists of 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml BSA, and pH=7.9.
[0016] Furthermore, the molar ratio of the long tool chain, the short tool chain, and the target ssDNA chain is 2:2:1.
[0017] Further, the detection process includes: first, adding a final concentration of 1xNEB buffer 3.1, 10-50 nM engineered crRNA, and 10-50 nM Cas12a protein, and incubating at 37°C for 20-30 min; then adding 100-500 nM fluorescent probe FQ, 1-50 nM heteroduplex target of the test tool / heteroduplex target of the control tool, and DEPC water; then placing it in a 384-well plate of a microplate reader, reacting at 37°C for 90-150 min, detecting fluorescence and reading it every 2 min to obtain fluorescence signal data.
[0018] Furthermore, the Cas12a protein includes any one of LbCas12a, FnCas12a, AsCas12a, LwCas12a, OsCas12a, or TsCas12a.
[0019] Furthermore, the fluorescent probe FQ is a short-chain ssDNA, with one end modified with a fluorescent reporter group FAM and the other end modified with a quencher group BHQ1, and its nucleotide sequence is: 5'-FAM-TTTTTTTTTTTT-BHQ1-3'.
[0020] Furthermore, the nucleotide sequence length of the Blocker chain is 14nt, 13nt, 12nt, 11nt, or 10nt.
[0021] Furthermore, the nucleotide sequences of PAM1 and PAM2 are any one of TTTV, NTTV, TTNT, GTTV, and GCTV, where N represents any base and V represents any one of the three bases: adenine (A), cytosine (C), or guanine (G).
[0022] After amplifying the gene fragment sequence, the method of this invention selects any specific single-base mutation site as a target and designs a crRNA complementary to the target and a blocker strand complementary to the spacer sequence of the crRNA. A long tool chain with a 3' end sequence and a random 5' end sequence complementary to the ssDNA strand of the target region is designed, with the PAM region designed immediately adjacent to the target ssDNA strand. A short tool chain with a 5' end sequence complementary to the long tool chain is designed, with the PAM region immediately adjacent to the target ssDNA strand at the 5' region of the short tool chain. This set of tool chains is then used to couple with the Cas12a protein to achieve single-base mutation detection in drug-resistant bacteria without the PAM target chain. Furthermore, a corresponding set of chains can be designed based on the gene sequences of different drug-resistant bacteria for targeted detection of single-base mutations in different drug-resistant bacteria.
[0023] This invention also provides the application of the CRISPR / Cas12a system-based method for detecting SNM without PAM restrictions in the detection of drug-resistant bacteria in samples with low-frequency mutation abundance or complex samples.
[0024] Compared with the prior art, the present invention has the following beneficial effects: The method of this invention significantly improves the scope and ability of Cas12a detection of single base mutations, breaks through the limitations of PAM, realizes SNM detection of multiple sites related to drug-resistant bacteria with 100% specificity, and improves the accuracy of detection.
[0025] In practical applications, combining aPCR nucleic acid amplification can achieve highly specific, highly sensitive, and low-abundance mutation detection of SNMs in drug-resistant bacteria under complex backgrounds (such as mixed pathogen infections). Furthermore, this detection method has advantages over other methods, including lower detection costs, simpler operation, less dependence on personnel and equipment, and convenient data processing, making it suitable for real-time detection of drug-resistant pathogens in grassroots areas. Attached Figure Description
[0026] Figure 1 This is a schematic diagram illustrating the experimental principle of a method for detecting SNM without PAM limitations based on a CRISPR / Cas12a system according to the present invention.
[0027] Figure 2 The fluorescence kinetics curve (A) and fluorescence bar graph (B) show the feasibility of a PAM-free detection method for SNM based on the CRISPR / Cas12a system.
[0028] Figure 3 This is a fluorescence bar graph representing a method for detecting SNM without PAM limitations based on the CRISPR / Cas12a system.
[0029] Figure 4 This is a fluorescence bar chart showing the detection limit of low-frequency mutation abundance for a PAM-free method for detecting SNM based on the CRISPR / Cas12a system.
[0030] Figure 5 This is a repeatability fluorescence bar graph of a PAM-free method for detecting SNM based on the CRISPR / Cas12a system. Detailed Implementation
[0031] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. It should be understood that the embodiments described are only for illustrating the technical solutions of the present invention and are not intended to limit the present invention. All equivalent substitutions or modifications made based on the technical essence of the present invention are within the protection scope of the present invention.
[0032] The sources of some reagents and biological resources involved in the embodiments of this invention are as follows: The relevant sequence design tool is snapgene software. Blocker chains, tool short chains and tool long chains, cRNA chains, aPCR amplification primers, etc., were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.; LbCas12a protein was purchased from New England Biotech (Beijing) Co., Ltd.
[0033] The code, sequence, and serial number of the synthetic chain are shown in Table 1.
[0034] Table 1
[0035] Other reagents and equipment are all commercially available products.
[0036] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art.
[0037] In this embodiment of the invention, methicillin-resistant Staphylococcus aureus (MRSA), a relatively typical drug-resistant bacterium, is used as an example. It should be understood that the detection method proposed in this invention is also applicable to other drug-resistant bacteria.
[0038] Example 1: A method for detecting SNM without PAM limitations based on a CRISPR / Cas12a system, such as... Figure 1 As shown, taking MRSA and SA (strains purchased from the China Industrial Microbial Culture Collection Center) as examples, the steps include: S1. aPCR amplification of the ssDNA gene fragment of the MRSA target to be tested. APCR amplification was performed using the nuc gene fragment shared by methicillin-resistant Staphylococcus aureus (MRSA) and Staphylococcus aureus (SA). However, the nuc gene fragment of MRSA differs from that of SA due to individual base mutations. A partial sequence of the nuc gene was selected as the target gene, and its nucleotide sequence is shown in SEQ ID No: 11 (where G at position 111 is the mutation site). Primers were designed using snapgene software, and the primer pair sequences are shown in SEQ ID No. 9 and SEQ ID No. 10. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0039] ATGACAGAATACTTATTAAGTGCTGGCATATGTATGGCAATTGTTTCAATATTACTTATAGGGATGGCTATCAGTAATGTTTCGAAAGGGCAATACGCAAAGAGGTTTTT C(SEQ ID No.11).
[0040] 1) Genome extraction: The nucleic acid genomes of MRSA and SA strains were extracted using the EZNA® Bacterial DNA Kit D3350.
[0041] 2) aPCR nucleic acid amplification.
[0042] The aPCR amplification reaction system consisted of a total volume of 30 μL, including 2.1 μL of forward primer F1 (10 μM), 0.6 μL of reverse primer R2 (1 μM), 2 μL of DNA genomic template, 15 μL of 2×TaKaRa Taq enzyme, and 9.3 μL of DEPC water. After mixing, amplification was performed using a PCR instrument to obtain the target ssDNA strand (MRSA, the sequence of which is shown in SEQ ID No. 12) and the control target ssDNA strand (SA, the nucleotide sequence of which is shown in SEQ ID No. 13).
[0043] aPCR amplification cycling procedure: Pre-denaturation at 95 °C for 5 min, followed by 10 cycles, each cycle consisting of denaturation at 95 °C for 30 s, annealing at 45 °C for 20 s, and extension at 72 °C for 10 s. Then perform 35 cycles, each cycle consisting of denaturation at 95 °C for 30 s, annealing at 55 °C for 20 s, extension at 72 °C for 10 s, and finally extension at 72 °C for 5 min. Cool to 4 °C and store.
[0044] S2. Preparation method of heteroduplex engineered crRNA and tool target 1) Preparation of engineered crRNA: Based on the target ssDNA strand, a corresponding crRNA (its nucleotide sequence is shown in SEQ ID No. 1) is designed. A Blocker strand (its nucleotide sequence is shown in any one of SEQ ID No. 2-6, with Blocker-14 selected in the following steps) is designed to complement the non-seed region of the spacer region of the crRNA containing a single-base mutation site. The engineered crRNA is then prepared in an engineered crRNA preparation system.
[0045] The total volume of the engineered crRNA preparation system was 50 μL, which included 5 μL of crRNA (10 μM), 10 μL of Blocker strand (10 μM), 5 μL of 10× hybridization buffer 1, and 30 μL of DEPC water. The above system was placed in a 200 μL PCR tube and vortexed to mix. After mixing, the system was placed in a PCR instrument, and the hybridization program was set. The temperature was first rapidly increased to 90 °C and incubated for 5 min, then automatically cooled to 37 °C at a rate of 2 °C / min, and finally incubated at 37 °C for 30 min to obtain the engineered crRNA.
[0046] 2) Tool target heteroduplex: The 3' end region of a long tool chain complementary to the nucleic acid sequence of the target ssDNA strand was designed; a short tool chain complementary to the 5' end region of the long tool chain was designed, with PAM1 designed between the 3' and 5' end regions of the long tool chain, and PAM2 designed within the 5' end region of the short tool chain, and PAM1 and PAM2 being complementary genes. The nucleotide sequence of the long tool chain is shown in SEQ ID No. 8, and the nucleotide sequence of the short tool chain is shown in SEQ ID No. 7; the target ssDNA strand and the control target ssDNA strand were prepared as tool target heteroduplexes and control tool target heteroduplexes respectively with the long tool chain and the short tool chain in a specific preparation system.
[0047] The total volume of the preparation system for the target heteroduplex and control target heteroduplex was 50 μL. This system included 10 μL of the long (10 μM) tool chain, 10 μL of the short (10 μM) tool chain, 5 μL of the target ssDNA strand, 5 μL of 10× hybridization buffer 2, and 30 μL of DEPC water. The above system was placed in a 200 μL PCR tube and vortexed to mix. After mixing, it was incubated in a constant temperature metal bath at 37°C for 60 min. Feasibility verification detection reaction system: Prepare a detection system with a total volume of 20 μL. First, add 0.6 μL of engineered crRNA (1 μM), 0.6 μL of Cas12a protein (1 μM), and 2 μL of 10×NEBuffer 3.1. Then, incubate the reaction at 37℃ for 30 min. Next, add 0.5 μL of fluorescent reporter probe FQ (10 μM) and 1 μL of tool target heteroduplex (containing the ssDNA strand to be tested). Finally, add DEPC water to make up to 20 μL.
[0048] Feasibility verification detection method procedure: Each sample was subjected to 3 independent detections. The detection system was placed in a 384-well plate of an ELISA reader and shaken to mix. Excitation light of 492nm and emission light of 520nm were set, and the reaction was carried out at 37℃ for 90-150 min. Fluorescence was detected and read every 2 min to obtain fluorescence detection signal data.
[0049] Analysis of test results: The spacer sequence of the engineered crRNA is completely complementary to the ssDNA strand fragment obtained by aPCR amplification of methicillin-resistant Staphylococcus aureus (MRSA), but contains a single base mismatch with the ssDNA strand fragment obtained by aPCR amplification of Staphylococcus aureus (SA). The results are as follows: Figure 2 As shown in Figure a, with increasing detection time, the fluorescence signal of methicillin-resistant Staphylococcus aureus (MRSA) increased significantly, while the fluorescence signal of Staphylococcus aureus (SA) increased slowly. Data at the endpoint of 150 min were used to create a bar chart representing the mean ± standard deviation. Figure 2 b), and performed a T-test component analysis between the two groups. The results showed that the significance of the MRSA group and the SA group was ***, P<0.001, indicating that there was a significant difference between the two groups.
[0050] It is understood that the method of the present invention selects nucleic acid sequence fragments that are present in both drug-resistant and non-drug-resistant strains of the same species, and uses the nucleic acid sequence at the position of the single base mutation on the common sequence of the two as a target, which can realize the detection and differentiation of SNM in other drug-resistant strains.
[0051] Example 2 Specificity Verification (1) Sample preparation for specific detection of MRSA: Methicillin-resistant Staphylococcus aureus (MRSA) was selected as the target strain, and common pathogenic strains such as Staphylococcus aureus (SA), Pseudomonas aeruginosa (PA), Escherichia coli (EC), Vibrio harveyi (VH), Vibrio cholerae (VC), Vibrio parahaemolyticus (VP), Enterococcus faecalis (EF), Klebsiella pneumoniae (KP), Salmonella typhimurium (SRB), and Listeria monocytogenes (LM) were selected as control strains. The culture was carried out until the final bacterial concentration reached 1×10⁻⁶. 8 CFU / mL. The kit was used to extract the genome of the above-mentioned test strains, and the corresponding ssDNA was obtained by aPCR amplification. Then, the above strains were detected using the detection method in Example 1.
[0052] (2) Specific detection reaction system for MRSA: Prepare a detection system with a total volume of 20 μL. First, add 0.6 μL of engineered crRNA (1 μM), 0.6 μL of Cas12a protein (1 μM), and 2 μL of 10×NEBuffer 3.1. Then, incubate the reaction at 37℃ for 30 min. Next, add 0.5 μL of fluorescent reporter probe FQ (10 μM) and 1 μL of engineered pseudohybrid duplex (containing the ssDNA strand to be tested). Finally, add DEPC water to make up to 20 μL.
[0053] (3) Specific detection method of MRSA: Each sample was tested in 3 independent groups. The detection system was placed in a 384-well plate of the microplate reader and shaken to mix. The excitation light was set to 492nm and the emission light to 520nm. The reaction was carried out at 37℃ for 90-150min. The fluorescence was detected and read every 2min to obtain the fluorescence detection signal data.
[0054] (4) Analysis of the specificity of MRSA detection results: like Figure 3 As shown, the fluorescence detection signal of MRSA (methicillin-resistant Staphylococcus aureus) detected by the method of the present invention is significantly different from that of SA (Staphylococcus aureus), which is the most closely related species (P < 0.001, marked "***"). This proves that the method of the present invention can effectively distinguish between MRSA and sensitive Staphylococcus aureus and avoid cross-reaction.
[0055] Compared with other non-target strains (PA: Pseudomonas aeruginosa; EC: Escherichia coli; VH: Vibrio harveyi; VC: Vibrio cholerae; VP: Vibrio parahaemolyticus; EF: Enterococcus faecalis; KP: Klebsiella pneumoniae; SRB: Salmonella typhimurium; LM: Listeria monocytogenes), the detection signal of MRSA was significantly different from the fluorescence detection signal of the above strains (P < 0.001, marked "***").
[0056] Compared with the negative control (NC), the detection signal of MRSA was significantly different from the background signal of NC (P < 0.001, marked "***"), while the signals of all control strains were not significantly different from those of NC (marked "ns"). This further demonstrates the high specificity of the method of the present invention for detecting MRSA (methicillin-resistant Staphylococcus aureus).
[0057] Example 3: Validation of the detection limit for low-frequency mutation abundance (1) Sample processing for detecting the abundance of low-frequency mutations in MRSA Mixed bacterial suspensions containing different proportions of MRSA (0%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 5%, 10%, 20%) were prepared, with Staphylococcus aureus (SA) as the background bacterium. The final bacterial suspension concentration was 1×10⁻⁶. 8 CFU / mL. The kit was used to extract the genome from the samples containing different proportions of MRSA, and the corresponding ssDNA was obtained by aPCR amplification. Then, the detection method in Example 1 was used to detect the samples containing different proportions of MRSA.
[0058] (2) MRSA low-frequency mutation abundance detection reaction system: Prepare a detection system with a total volume of 20 μL. First, add 0.6 μL of engineered crRNA (1 μM), 0.6 μL of Cas12a protein (1 μM), and 2 μL of 10×NEBuffer 3.1. Then, incubate the reaction at 37℃ for 30 min. Next, add 0.5 μL of fluorescent reporter probe FQ (10 μM), 1 μL of tool target heteroduplex (including the ssDNA strand to be tested), and finally add DEPC water to make up to 20 μL.
[0059] (3) MRSA low-frequency mutation abundance detection method: Each sample was tested in 3 independent groups. The detection system was placed in a 384-well plate of the microplate reader and shaken to mix. The excitation light was set to 492nm and the emission light to 520nm. The reaction was carried out at 37℃ for 90-150 min. Fluorescence was detected and read every 2 min to obtain fluorescence detection signal data.
[0060] (4) Analysis of the detection results of the MRSA low-frequency mutation abundance detection reaction system: The method of this invention detects the fluorescence signal of mixed bacterial cultures with different proportions of MRSA (0%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 5%, 10%, 20%), and the results are as follows. Figure 4 As shown, When the MRSA content in the samples was 20%, 10%, 5%, 1%, 0.5%, and 0.1%, the detection signal (RFU) remained at a high level, and the signal fluctuations between groups were small, indicating that the method of the present invention has a stable signal output capability for samples with a medium to low proportion of MRSA. Furthermore, when the MRSA content dropped to 0.01%, the fluorescence detection signal was still higher than the background signal of the negative control, proving that the method of the present invention is still detectable for samples with an extremely low proportion of MRSA.
[0061] Example 4 Repeatability Verification The same method and process were used for the detection content in Example 2 to perform batch-to-batch repeatability testing. The repeatability testing was performed four times to verify the stability of the method of the present invention.
[0062] Analysis of repeatability test results: like Figure 5 As shown, in four independent replicate experiments of the method of the present invention for detecting MRSA target strain and SA control strain, the intra-group coefficient of variation (CV) for MRSA detection fluorescence signal analysis was ≤8.2%, and the intra-group coefficient of variation (CV) for SA detection fluorescence signal analysis was ≤6.5%, indicating that the method of the present invention has stable signal output for both target and non-target strains and good repeatability. The repeatability verification signal difference factor (DF) for signal discrimination is defined as... DF = (F) MRSA F SA and F NC These are the fluorescence signal values generated when the targets are MRSA, SA, and NONE, respectively. The DF value remained stable in four replicate experiments, with an intragroup coefficient of variation ≤9.3%; and the DF value was significantly higher than the threshold (DF≥2) in all replicate experiments, demonstrating that the method of this invention can stably distinguish between the target strain MRSA and the control strain SA in different experimental batches.
[0063] The above description is merely a preferred embodiment of the present invention, and the scope of protection of the present invention is not limited to the above embodiments. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention. It should be noted that for those skilled in the art, any improvements and modifications made without departing from the principles of the present invention should also be considered within the scope of protection of the present invention.
Claims
1. A method for detecting SNM without PAM limitations based on a CRISPR / Cas12a system, characterized in that, Includes the following steps: S1. Obtain the target ssDNA strand Genomic DNA was extracted from the test sample and normal bacteria, respectively. Primers were designed with the common gene between the drug-resistant bacteria and normal bacteria as the target gene. aPCR amplification was performed to obtain the test target ssDNA chain and the control target ssDNA chain. S2. Obtaining engineered crRNA and tool target heteroduplexes Based on the target ssDNA strand, a corresponding crRNA was designed. A Blocker strand complementary to the nucleic acid sequence containing a single-base mutation site in the non-seed region of the crRNA's Spacer region was designed. The two were combined to obtain the engineered crRNA. A long tool chain complementary to the nucleic acid sequence of the target ssDNA strand was designed. A short tool chain complementary to the long tool chain was designed. The target ssDNA strand and the control target ssDNA strand were combined with the long tool chain and the short tool chain, respectively, to obtain the target tool target heteroduplex and the control tool target heteroduplex. The 3' end region of the long tool chain is complementary to the nucleic acid sequence of the target ssDNA chain, and its 5' end region is complementary to the 3' end region of the short tool chain. The region between the 3' end region and the 5' end region is PAM1; the 5' end region of the short tool chain is PAM2; PAM1 and PAM2 are complementary genes. S3, Detection of SNM in drug-resistant bacteria using a Cas12a / CRISPR coupled system. The CRISPR / Cas12a protein opens the heteroduplex of both the test target and the control target, causing the engineered crRNA to undergo a strand displacement reaction with the target heteroduplex, generating a fluorescent signal. If the fluorescence signal F1 of the test target heteroduplex is higher than that of the control target heteroduplex, the sample is considered to have undergone SNM and is a drug-resistant bacterium. If the fluorescence signal F1 of the test target heteroduplex is less than or equal to that of the control target heteroduplex, the sample is considered to have not undergone SNM and is a normal bacterium.
2. The method according to claim 1, characterized in that, Step S3 also includes: calculating the repeatability verification signal difference factor DF of the fluorescence signal. DF = F1, F2, and F0 are the fluorescence signal values generated when the target is drug-resistant bacteria, normal bacteria, and NONE target, respectively. If DF≥2, the sample under test has SNM and is a drug-resistant bacteria; if DF<2, the sample under test has not SNM and is a normal bacteria.
3. The method according to claim 1, characterized in that, The aPCR amplification reaction system comprises a total volume of 30 μL, including 2.1 μL of 10 μM forward primer, 0.6 μL of 1 μM reverse primer, 2 μL of DNA template, 15 μL of 2×TaKaRaTaq enzyme, and 9.3 μL of DEPC water.
4. The method according to claim 1, characterized in that, The preparation system of the engineered crRNA includes: Blocker chain, crRNA, DEPC water and hybridization buffer 1; the hybridization buffer 1 consists of 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM dithiothreitol, and pH=7.
9.
5. The method according to claim 1, characterized in that, The preparation system for the heteroduplex tool target includes: a long tool chain, a short tool chain, a target ssDNA chain / control target ssDNA chain, DEPC water, and hybridization buffer 2; the hybridization buffer 2 consists of 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml BSA, and pH=7.
9.
6. The method according to claim 1, characterized in that, The detection process includes: first, adding 1xNEBbuffer 3.1 buffer, 10-50 nM engineered crRNA, and 10-50 nM Cas12a protein to a final concentration, and incubating at 37°C for 20-30 min; then adding 100-500 nM fluorescent probe FQ, 1-50 nM heteroduplex target of the test tool / heteroduplex target of the control tool, and DEPC water; then placing it in a 384-well plate of a microplate reader and reacting at 37°C for 90-150 min, detecting fluorescence and reading it every 2 min to obtain fluorescence signal data.
7. The method according to claim 6, characterized in that, The Cas12a protein includes any one of LbCas12a, FnCas12a, AsCas12a, LwCas12a, OsCas12a, or TsCas12a.
8. The method according to claim 1, characterized in that, The nucleotide sequence length of the Blocker chain is 14nt, 13nt, 12nt, 11nt, or 10nt.
9. The method according to claim 1, characterized in that, The nucleotide sequence of the PAM is any one of TTTV, NTTV, TTNT, GTTV, and GCTV, where N represents any base and V represents any one of the three bases: adenine (A), cytosine (C), or guanine (G).
10. The method for detecting SNM without PAM restriction based on the CRISPR / Cas12a system as described in any one of claims 1-9 is used in the detection of drug-resistant bacteria in samples with low-frequency mutation abundance or complex samples.