Acid-resistant lactobacillus plantarum engineering bacterium as well as construction method and application thereof
By introducing glutamate decarboxylase and arginine decarboxylase genes into Lactobacillus plantarum, a co-expression recombinant strain was constructed, which solved the problem of limited activity of Lactobacillus plantarum in acidic environments and improved its performance in acidic foods and the intestines.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NINGXIA UNIVERSITY
- Filing Date
- 2026-02-05
- Publication Date
- 2026-05-01
AI Technical Summary
Lactobacillus plantarum has limited activity in acidic environments, which inhibits its growth in the human gastrointestinal tract and fermentation systems, thus affecting its probiotic function.
The glutamate decarboxylase gene (gadA) and the arginine decarboxylase gene (speA) were introduced into Lactobacillus plantarum WCFS1 to construct a co-expression recombinant engineered bacterium, and the acid-resistant Lactobacillus plantarum engineered bacterium was obtained by electroporation transformation technology.
It significantly improved the growth capacity and survival rate of engineered bacteria under acidic conditions, enhanced their fermentation performance and product stability in acidic foods such as yogurt and kimchi, and improved their probiotic effects in the gut.
Smart Images

Figure CN121950656A_ABST
Abstract
Description
An acid-resistant engineered strain of Lactobacillus plantarum, its construction method and application Technical Field
[0001] This invention belongs to the field of microbial genetic engineering technology, and more specifically, relates to an acid-resistant Lactobacillus plantarum engineered strain, its construction method, and its application. Background Technology
[0002] Lactobacillus plantarum, a recognized safe probiotic, has wide applications in the food, feed, and pharmaceutical industries. It possesses various beneficial functions, including regulating intestinal flora, enhancing immunity, antioxidation, and antibacterial activity, and is commonly used in the production of fermented dairy products, fruit and vegetable beverages, pickled foods, and probiotic preparations. Furthermore, in fruit winemaking, Lactobacillus plantarum can initiate malolactic fermentation, reduce acidity, and improve flavor and taste, thus playing a crucial role in the brewing industry.
[0003] However, *Lactobacillus plantarum* faces a common bottleneck in practical applications: its limited tolerance to acidic environments. The optimal pH for its growth is around 6.5, while in the human gastrointestinal tract, the pH of gastric juice is typically between 1.5 and 3.5. A highly acidic environment easily leads to decreased bacterial activity or even death, thus affecting its probiotic functions. Similarly, in fermentation systems such as fruit wine, yogurt, and kimchi, as metabolic acid accumulates, the environmental pH often drops rapidly to below 4.0. Under these conditions, the growth of common *Lactobacillus plantarum* is inhibited, fermentation efficiency decreases, and product quality and stability are difficult to guarantee. Summary of the Invention
[0004] To address the aforementioned technical problems, the present invention aims to provide an acid-resistant Lactobacillus plantarum engineered strain, its construction method, and its application.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The present invention provides an acid-resistant Lactobacillus plantarum engineered strain, which is obtained by introducing glutamate decarboxylase gene and arginine decarboxylase gene into Lactobacillus plantarum. The glutamate decarboxylase gene is shown in SEQ ID NO.1, and the arginine decarboxylase gene is shown in SEQ ID NO.2.
[0006] This invention addresses the problem of limited activity of *Lactobacillus plantarum* in acidic environments (such as the gastrointestinal tract or fruit wine fermentation systems) by providing an acid-resistant engineered *Lactobacillus plantarum* strain, its construction method, and its applications. The core idea is to co-introduce two key acid-resistant genes—glutamate decarboxylase gene (gadA) and arginine decarboxylase gene (speA)—into *Lactobacillus plantarum* WCFS1 to construct a co-expressing recombinant engineered strain. By constructing the recombinant plasmid pMG36e-gadA-speA and using electroporation to introduce it into the host bacteria, a recombinant strain capable of simultaneously and highly expressing both decarboxylases was obtained. Experiments show that this engineered strain can effectively maintain high intracellular pH and ATP levels under low pH stress, significantly improving its growth capacity and survival rate under acidic conditions, and exhibiting stronger acid-producing performance in apple juice fermentation. This invention provides a new strain resource and construction method for obtaining high-performance acid-resistant probiotics and starter cultures, and has application potential in the fields of food fermentation and probiotic preparations.
[0007] This invention provides a method for constructing the acid-tolerant engineered *Lactobacillus plantarum*, comprising the following steps: S1, inserting the glutamate decarboxylase gene between the restriction endonuclease sites XbaI and SpfI of the pMG36e plasmid to obtain pMG36e-gadA; S2, inserting the arginine decarboxylase gene between the restriction endonuclease sites HindⅢ and KpnI of the pMG36e-gadA plasmid to obtain pMG36e-gadA-speA; S3, introducing pMG36e-gadA-speA into *Lactobacillus plantarum* via electroporation to obtain transformants, transferring the transformants to MRS broth containing 0.2-0.4M sucrose and incubating for 2-4 hours to obtain revived bacterial cells, and screening the revived bacterial cells to obtain the acid-tolerant engineered *Lactobacillus plantarum*.
[0008] Furthermore, the conditions for the electric shock conversion described in S3 are: an electric shock constant of 4~6ms and a voltage of 1~3kV.
[0009] Furthermore, the incubation temperature described in S3 is 30~40℃.
[0010] Furthermore, the screening described in S3 involves spreading the revived bacterial cells onto MRS agar plates containing 90-110 μg / mL erythromycin and culturing them at 30-40°C for at least 36 hours.
[0011] This invention provides the application of the acid-resistant Lactobacillus plantarum engineered strain in the preparation of fermented foods.
[0012] This invention provides the application of the acid-resistant Lactobacillus plantarum engineered strain in the preparation of probiotic health products, which are used to regulate intestinal flora.
[0013] This invention provides the application of the acid-resistant Lactobacillus plantarum engineered strain in brewing.
[0014] This invention has the following beneficial effects: Significantly improved acid resistance: By introducing and co-expressing glutamate decarboxylase and arginine decarboxylase genes, *Lactobacillus plantarum*, which is originally sensitive to acid, gains the ability to survive in lower pH environments. Furthermore, co-expression of the gadA and speA genes shows a more significant improvement in acid resistance than expression of either gadA or speA gene alone. Experimental data show that under stress conditions of pH 3.2–4.0, the growth rate and maximum OD of the recombinant *Lactobacillus plantarum* are significantly improved. 600 The value was significantly higher than that of the control strain Lactobacillus plantarum WCFS1-pMG36e, while the lag phase was significantly shorter than that of the control strain.
[0015] With great application potential, recombinant strains can better tolerate gastric acid and reach the intestines with a higher number of live bacteria, greatly enhancing their probiotic effects. In the production of acidic foods such as yogurt, kimchi, and fermented fruit juice, recombinant strains can maintain higher activity in the later stage of fermentation (high acidity), shorten fermentation time, improve product flavor and texture, or serve as a more stable fermentation starter. They can also improve production stability in environments where acidic fermentation products (such as lactic acid) accumulate.
[0016] Novel Mechanism: This invention is the first to combine the acid-resistant genes gadA and speA in the modification of Lactobacillus plantarum, providing a novel gene resource and engineering strategy for enhancing microbial resistance to acid stress.
[0017] Highly targeted: Through genetic engineering, it directly enhances the cell's intrinsic acid resistance physiological mechanisms, with clear and heritable effects, superior to external protection methods. Attached Figure Description
[0018] Figure 1 shows the growth curves of recombinant Lactobacillus plantarum fitted by the Gompertz equation at different pH levels. Wherein, a is the growth curve of recombinant *Lactobacillus plantarum* fitted by the Gompertz equation at pH=6.2; b is the growth curve of recombinant *Lactobacillus plantarum* fitted by the Gompertz equation at pH=4; c is the growth curve of recombinant *Lactobacillus plantarum* fitted by the Gompertz equation at pH=3.8; d is the growth curve of recombinant *Lactobacillus plantarum* fitted by the Gompertz equation at pH=3.6; e is the growth curve of recombinant *Lactobacillus plantarum* fitted by the Gompertz equation at pH=3.4; f is the growth curve of recombinant *Lactobacillus plantarum* fitted by the Gompertz equation at pH=3.2; Lp-vector: *Lactobacillus plantarum* transformed with empty vector pMG36e; Lp-gadA: recombinant *Lactobacillus plantarum* WCFS1-gadA; Lp-speA: recombinant *Lactobacillus plantarum* WCFS1-speA; Lp-gadA-speA: recombinant *Lactobacillus plantarum* WCFS1-gadA-speA.
[0019] Figure 2 shows the relative expression levels of key genes in recombinant Lactobacillus plantarum under acid stress. In Figure 2, a represents the relative expression level of gadA in recombinant Lactobacillus plantarum WCFS1-gadA-speA, and b represents the relative expression level of speA in recombinant Lactobacillus plantarum WCFS1-gadA-speA.
[0020] Figure 3 shows the intracellular pH and ATP content of recombinant Lactobacillus plantarum under different acid stress conditions. In Figure 3, a represents the intracellular pH, and b represents the ATP content.
[0021] Figure 4 shows the activity of glutamate decarboxylase and arginine decarboxylase in recombinant Lactobacillus plantarum WCFS1-gadA-speA, where a is the activity of glutamate decarboxylase and b is the activity of arginine decarboxylase.
[0022] Figure 5 shows the changes in pH value and live cell count during the fermentation of apple juice by Lactobacillus plantarum WCFS1-gadA-speA, where a is the pH value graph and b is the live cell count graph. Detailed Implementation
[0023] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.
[0024] Example 1: Strain construction.
[0025] 1. Strain activation: *Lactobacillus plantarum* WCFS1 strain stored at -80℃ was inoculated into MRS broth at a volume fraction of 2% (v / v). After static incubation at 37℃ for 12 hours, the inoculum was streaked onto MRS plates and incubated at 37℃ for another 24 hours. Single colonies were then picked and inoculated into fresh MRS broth, and incubated at 37℃ for 12 hours to obtain fully activated *Lactobacillus plantarum*. The *Lactobacillus plantarum* WCFS1 strain is disclosed in the article “Zhao H, Yuan L, Hu K, Liu L, Peng S, Li H, Wang H. Heterologous expression of ctsR from *Oenococcus oeni* enhances the acid-ethanol resistance of *Lactobacillus plantarum*. FEMS Microbiol Lett. 2019 Aug1;366(15):fnz192. doi: 10.1093 / femsle / fnz192. PMID: 31504471.”
[0026] 2. Vector construction: Two acid-resistant genes, glutamate decarboxylase gene (gadA) and arginine decarboxylase gene (speA), were selected. The sequence of the gadA gene is shown in SEQ ID NO.1, and the sequence of the speA gene is shown in SEQ ID NO.2.1:CTAGTCTAGAATGCCACACTGGAACGCGCGCCACGCGCAATCGCTGCTACCTCATGAGTTATCTGTCAATCCGTTATTTTCCCGCGATGAAGATGAGTCTGTCCCACGATTTCACATGCGAGAAATGGGCATGTTGCCCGAAACCGCGTATCAAATCATCCACGACGAGCTCGCATTAGATGGGAATGCCCGCCTCAATCTTGCCACATTCGTGACCACGTGGATGGAGCCTGCTGCAGATCGCTTGTACACCGAATCAGCCGACAAGAACATGATTGATAAGGACGAGTATCCACAAACAGCGGCCATAGAGGAACGCTGCGTGCGCATTTTAGCCCACCTGTGGCACGCCCCGAATCCCGAGACGACGATAGGAGTTTCCACGACTGGCTCATCTGAAGCATGCATGCTAGCCGGTCTCGCGCTGAAACGACGCTGGCAGAACGCGCGGAAGAAAGCAGGAAAGTCCATTGATCGGCCCAACATCGTATTTAGCTCGGCGGTGCAAGTTGTATGGGAGAAATTTGCGAACTATTGGGAAGTGGAACCCCGGTATGTGAACATTACGCCAGATAAGCCCTATCTCCATCCCGACGGCGTTCTCTCCGCCGTCGACGAGAATACCATTGGCGTCGTGCCAATTCTCGGCGTCACGTACACCGGCCTGTATGAACCAGTCGCCACGATTGCACAAGCCCTAGACGATTTACAGTCACGAACGGGTCTGGATATTCCAATGCACGTCGATGCTGCTTCGGGTGGATTCGTCGCCCCATTCCTACAGCCAGACTTGATTTGGGACTTTCAATTACAAAGGGTCAAATCTATCAACGTCTCCGGGCACAAATACGGACTGGTGTACCCGGCCTTGGATGGGTCGTGTGGCGTGAAGCAGAAGACCTACCCGAAGAGCTTATTTTCCGCGTGTCCTATTTGGGCGGAAATATGCCGACTTTTGCCTTAACCTGCAGGTA。.
[0027]
[0028] First, the gadA gene and the empty vector plasmid pMG36e (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) were double-digested with restriction endonucleases XbaI and SpfI, respectively. After purification, the digestion products were ligated according to the DNA ligation kit instructions at 16°C overnight. The ligation product was transformed into competent *E. coli*, and the recombinant plasmid pMG36e-gadA was obtained after verification by colony PCR and double enzyme digestion. Subsequently, the pMG36e and speA genes were double-digested with restriction endonucleases HindIII and KpnI, and ligated as described above to construct the recombinant plasmid pMG36e-speA. Finally, the speA gene and the recombinant plasmid pMG36e-gadA were double-digested with restriction endonucleases HindIII and KpnI, respectively, purified, and then ligated, transformed, and verified again. After successful verification, the co-expression recombinant plasmid pMG36e-gadA-speA was finally obtained.
[0029] 3. Transformation of recombinant Lactobacillus plantarum: Activated Lactobacillus plantarum WCFS1 was inoculated into MRS broth containing 0.5 mol / L glycine and 0.3 mol / L sucrose at an inoculum rate of 2% (v / v), and cultured at 37°C until OD500. 600 =0.5. Cells were collected by centrifugation and washed twice with sterile electroporation buffer (5 mmol / L potassium dihydrogen phosphate, 0.5 mmol / L magnesium chloride, and 0.5 mmol / L sucrose) pre-chilled in ice water. The cells were then gently resuspended in 0.2 mL of electroporation buffer and placed in ice water. 2 μg of the recombinant expression vector was gently mixed with 200 μL of the competent cells and transferred to a 0.2 cm Bio-Rad bacterial electroporation cuvette. The cuvette was placed on ice for 5 min to allow plasmid DNA to attach to the cell surface. Transformants were obtained by electroporation using a Bio-Rad electroporator with a pulse constant of 5 ms and a voltage of 2.0 kV. The transformants were then immediately transferred to 1.5 mL of MRS broth containing 0.3 M sucrose and incubated at 37 °C for 3 h to obtain revived cells. The revived bacterial cells were centrifuged at 4000 r / min, and only 100 μL of supernatant was retained to gently resuspend the cells. The resuspended cells were then plated onto MRS agar plates containing 100 μg / mL erythromycin and incubated at 37°C for at least 36 h. Single colonies were picked from the resistance plates of *Lactobacillus plantarum* WCFS1-gadA, WCFS1-speA, and WCFS1-gadA-speA for colony PCR identification, yielding recombinant *Lactobacillus plantarum* WCFS1-gadA, WCFS1-speA, and WCFS1-gadA-speA.
[0030] Example 2: Tolerance test.
[0031] I. Acid tolerance test.
[0032] 1. Experimental Methods: Recombinant *Lactobacillus plantarum* was inoculated into MRS broth containing 100 μg / mL erythromycin and cultured at 37℃ for approximately 12 h. Then, it was inoculated into fresh resistant MRS broth at a volume fraction of 2% (v / v) and cultured for another 6 h to obtain a seed culture. The *Lactobacillus plantarum* seed culture was inoculated into MRS broth at pH values of 6.2 (control), 4.5, 4.0, 3.8, 3.6, 3.4, 3.2, and 3.0, respectively. Growth curves were measured using a Bioscreen C fully automated microbial growth curve analyzer to evaluate its acid tolerance. The analyzer parameters were set to 37℃, no oscillation, a wavelength of 600 nm, a sampling interval of 2 h, and a total measurement time of 100 h. A modified Gompertz model was used to fit the growth curves of recombinant *Lactobacillus plantarum* at different pH values.
[0033] 2. Experimental Results: As shown in Figure 1, within the pH range of 6.2, 4.0, 3.8, 3.6, 3.4, and 3.2, the growth rate and maximum OD600 value (OD600max) of all strains decreased with increasing acidity in the culture environment; the lag phase gradually lengthened, indicating that the inhibition of bacterial growth by acid stress became increasingly severe with increasing acidity. Under the stress conditions of pH 3.2–4.0, recombinant *Lactobacillus plantarum* (whether single-gene expression or co-expression strains) showed stronger growth capacity and higher biomass compared to the control strain. Notably, compared to single-gene heterologous expression strains, recombinant *Lactobacillus plantarum* WCFS1-gadA-speA exhibited stronger acid tolerance.
[0034] II. Analysis of expression levels of key genes.
[0035] 1. Experimental Methods: Three 10 mL aliquots of seed culture were centrifuged at 5000 r / min and 4℃ to collect the bacterial cell pellet. After washing the bacterial cells with physiological saline, they were transferred to MRS broth at pH 6.2 (control group), pH 4.0, and pH 3.0, respectively. After incubation at 37℃ for 1 h, recombinant *Lactobacillus plantarum* cells were collected. Total RNA was extracted according to the instructions of the Aike Rui RNA Extraction Kit. After removing genomic DNA, cDNA was immediately reverse transcribed and stored at -20℃ for later use. The expression levels of key genes were detected using a real-time PCR instrument (CFX96 Touch). The amplification program was as follows: pre-denaturation: 95℃, 30 s, 1 cycle; PCR reaction: 95℃, 5 s; 60℃, 30 s, 40 cycles. Primers were designed using the Primer-Blast function in NCBI. Detailed information on the selected primers is shown in Table 1. tuf (TUelongation factor) was selected as the internal reference gene, and 2...-ΔΔCt The relative expression level of the target gene is calculated using this method.
[0036] Table 1: Primer sequences and descriptions 2. Experimental Results: As shown in Figure 2, after 1 h of pH 4.0 stress, the expression level of the glutamate decarboxylase gene (gadA) in recombinant *Lactobacillus plantarum* WCFS1-gadA-speA was upregulated by more than 14-fold (Figure 2a), and the arginine decarboxylase gene (speA) was also upregulated by 5-fold (Figure 2b). After 1 h of pH 3.0 stress, both gadA and speA genes were also significantly upregulated (P < 0.05), but the upregulation was smaller compared to the pH 4.0 stress condition. This preliminarily confirms the important role of the glutamate decarboxylase system and the arginine decarboxylase system in protecting bacterial cells from acid stress damage.
[0037] III. Intracellular pH Measurement.
[0038] 1. Experimental Methods: The intracellular pH of recombinant Lactobacillus plantarum under acid stress was determined using the BCECF-AM fluorescent probe method. pH 6.2 was selected as the control group, and pH 4.0 and pH 3.0 for 1 h were used as acid stress treatment conditions. Intracellular pH was measured after the acid stress was completed.
[0039] (1) Establishment of intracellular pH standard curve: Take 6 mL of bacterial culture in mid-log phase, collect the cells by centrifugation, and wash and resuspend them with 6 mL of standard curve buffers at pH 3.0, 4.0, 5.0, 6.0, 7.0 and 8.0 respectively (containing 0.05 mol / L citrate monohydrate, 0.05 mol / L glycine, 0.05 mol / L disodium hydrogen phosphate dodecahydrate, and 0.05 mol / L potassium chloride, with pH adjusted using HCl and NaOH). Then add valine and nigrain to a final concentration of 1 μmol / L and incubate at 37℃ for about 25 min to balance the intracellular and extracellular pH. Collect the cells by centrifugation (4000g, 8 min), and then wash and resuspend them with the corresponding standard curve buffer. Add 1 μL of BCECF-AM fluorescent probe (Shanghai Beyotime Biotechnology Co., Ltd.) to 1.5 mL of the above bacterial suspension, mix well, and incubate at 37°C in the dark for 30 min. Centrifuge to collect the bacterial cells, wash with buffer using the corresponding standard curve, and resuspend. Then, measure the fluorescence intensity Itotal of the bacterial suspension at excitation wavelengths of 490 nm and 440 nm and emission wavelength of 525 nm, and the fluorescence intensity Ifiltrate of the supernatant obtained after filtration through a 0.22 μm filter. Calculate the fluorescence intensity I using the following formula, and construct an intracellular pH standard curve based on the linear relationship between lgI and pH: I = [(I490)total - (I490)filtrate] / [(I440)total - (I440)filtrate].
[0040] (2) Intracellular pH determination of recombinant Lactobacillus plantarum WCFS1-gadA-speA: Take 1.5 mL of the treated bacterial sample, wash with 1.5 mL of HEPES-K (50 mmol / L, pH 8.0), resuspend, add 1 μL of BCECF-AM fluorescent probe, mix well, and incubate at 37℃ in the dark for 30 min. Centrifuge to collect the bacterial cells, wash with phosphate buffer (50 mmol / L, pH 7.0), and resuspend. Measure and calculate the fluorescence intensity I according to the above method, and calculate the corresponding intracellular pH value based on the standard curve. Standard curve: y = 0.2597x - 0.988, R² = 0.9946.
[0041] 2. Experimental Results: As shown in Figure 3a, after treatment at pH 6.2 for 1 h, there was no significant difference in intracellular pH between the control *Lactobacillus plantarum* and the recombinant *Lactobacillus plantarum* WCFS1-gadA-speA. However, after treatment at pH 4.0 and pH 3.0 for 1 h, the intracellular pH of the recombinant *Lactobacillus plantarum* WCFS1-gadA-speA was significantly higher than that of the control *Lactobacillus plantarum* (P < 0.05). Based on these results, it can be concluded that heterologous expression of gadA and speA can significantly increase the intracellular pH of *Lactobacillus plantarum* under acid stress.
[0042] IV. Determination of Intracellular ATP Concentration 1. Experimental Method: Acid-stressed bacterial cells were washed and resuspended in physiological saline. The OD600 values of all samples were then adjusted to 0.6. Under ice bath conditions, 200 μL of ATP lysis buffer was added to 2 mL of the bacterial sample and thoroughly mixed. The sample was then centrifuged at 10000 g and 4 °C for 6 min, and the supernatant was used as the ATP extract. 100 μL of the ATP extract was mixed with 100 μL of ATP detection solution in an opaque 96-well plate, and its chemiluminescence intensity was detected using a multi-mode microplate reader. In addition, ATP standards were appropriately diluted using ATP lysis buffer, and the chemiluminescence intensity of different concentrations of ATP standards was measured. A linear relationship between ATP concentration and chemiluminescence intensity was established, and a standard curve was plotted. Finally, the intracellular ATP content of the bacterial cells was calculated using the standard curve. Standard Curve: y = 127263x + 11278, R² = 0.9911.
[0043] 2. Experimental results: As shown in Figure 3b, heterologous expression of gadA and speA significantly increased the intracellular ATP level of recombinant Lactobacillus plantarum WCFS1-gadA-speA cells under acid stress (pH 4.0 and pH 3.0), providing more energy for the cells to resist acid stress.
[0044] Example 3: Measurement of physiological indicators.
[0045] I. Determination of glutamate decarboxylase activity.
[0046] 1. Experimental Methods: Recombinant *Lactobacillus plantarum* in mid-log phase were collected by centrifugation. Cells were resuspended in KH₂PO₄ (100 mmol / L, pH 3.0, pH adjusted with 1 mol / L HCl) with or without 10 mmol / L glutamate and incubated for 1 h at 45 °C and 150 rpm. A control group was used, with cells resuspended in 100 mmol / L KH₂PO₄ at pH 4.0 and incubated for 1 h. After treatment, cells were collected by centrifugation (5000 g, 8 min) and washed three times with PBS buffer (50 mmol / L, pH 7.0). Cells were then sonicated on ice. The resulting suspension was centrifuged at 12000 g and 4 °C for 8 min, and the supernatant was used as the glutamate decarboxylase extract. Protein concentration was determined using a BCA protein assay kit, and glutamate decarboxylase activity was expressed by directly measuring the yield of γ-aminobutyric acid (GABA) in the post-reaction system.
[0047] 2. Experimental Results: As shown in Figure 4a. Compared to the normal culture environment (pH 6.2), the activity of glutamate decarboxylase in the bacterial cells was significantly increased after 1 h of stress at pH 4.0 and pH 3.0. Notably, the glutamate decarboxylase activity of recombinant Lactobacillus plantarum WCFS1-gadA-speA was significantly higher than that of the control strain under the same treatment (P < 0.05).
[0048] II. Determination of arginine decarboxylase activity.
[0049] 1. Experimental Methods: Enzyme activity was determined by monitoring the content of the reaction product, guanidine. 1 mL of the above extract was transferred to a 2 mL assay mixture consisting of 50 mmol / L PBS buffer (pH 7.5), 30 mmol / L arginine, 2.5 mmol / L magnesium sulfate, and 0.06 mmol / L pyridoxal 5-phosphate. After incubation at 40 °C for 10 min, the reaction was terminated with a saturated sodium chloride solution containing 10% potassium hydroxide. The content of guanidine produced was determined by high-performance liquid chromatography (HPLC). Arginine decarboxylase activity was calculated based on the amount of guanidine produced per minute and per milligram of protein (nmol).
[0050] 2. Experimental Results: As shown in Figure 4b. Similar to the trend of glutamate decarboxylase, compared with the normal culture environment (pH 6.2), the arginine decarboxylase activity of the bacteria was significantly increased after 1 h of stress at pH 4.0 and pH 3.0. Furthermore, the arginine decarboxylase activity of recombinant *Lactobacillus plantarum* WCFS1-gadA-speA was significantly higher than that of the control strain under the same treatment (P < 0.05).
[0051] III. Determination of the fermentation capacity of recombinant Lactobacillus plantarum.
[0052] 1. Experimental Methods: Wild-type and recombinant Lactobacillus plantarum were cultured to mid-log phase, with a viable cell count of approximately 10⁻⁶. 8 CFU / mL. Bacterial cells were then inoculated into non-concentrated (NFC) apple juice at a concentration of 2% (v / v). A control group (CK) without bacterial inoculation was prepared in parallel. All samples were incubated at 37°C for 48 h. The pH and viable bacterial count in the apple juice were monitored every 6 h. pH was measured using a pH meter, and viable bacterial counts were determined using the standard plate count method.
[0053] 2. Experimental Results: As shown in Figure 5. Throughout the 48-hour fermentation process, the pH value of the control group (without apple juice inoculation) remained approximately 4.2. In contrast, the pH value of apple juice inoculated with the control *Lactobacillus plantarum* dropped to 3.69 after 48 hours, while the recombinant strain *Lactobacillus plantarum* WCFS1-gadA-speA lowered the pH value to 3.32, as shown in Figure 5a, indicating that the recombinant strain had enhanced acid-producing ability during fermentation.
[0054] Although both the control and recombinant *Lactobacillus plantarum* WCFS1-gadA-speA eventually reached approximately 10¹ CFU / mL, the recombinant strain exhibited significantly faster growth during fermentation, as shown in Figure 5b. This accelerated growth may contribute to the recombinant strain lowering the juice pH more quickly and significantly. These findings suggest that the recombinant *Lactobacillus plantarum* strain possesses superior fermentation capacity compared to the control strain, highlighting its potential application in apple juice fermentation.
[0055] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0056] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
[0057] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. An acid-resistant engineered strain of *Lactobacillus plantarum*, characterized in that, It was obtained by introducing the glutamate decarboxylase gene and the arginine decarboxylase gene into Lactobacillus plantarum, wherein the glutamate decarboxylase gene is shown in SEQ ID NO.1 and the arginine decarboxylase gene is shown in SEQ ID NO.
2.
2. The method for constructing the acid-resistant Lactobacillus plantarum engineered strain according to claim 1, characterized in that, Includes the following steps: S1. Insert the glutamate decarboxylase gene between the restriction endonuclease sites XbaI and SpfI of the pMG36e plasmid to obtain pMG36e-gadA; S2. Insert the arginine decarboxylase gene between the restriction endonuclease sites HindⅢ and KpnI of the pMG36e-gadA plasmid to obtain pMG36e-gadA-speA; S3. Introduce pMG36e-gadA-speA into Lactobacillus plantarum by electroporation to obtain transformants. Transfer the transformants to MRS broth containing 0.2-0.4M sucrose and incubate for 2-4 hours to obtain revived bacterial cells. Screen the revived bacterial cells to obtain the acid-resistant Lactobacillus plantarum engineered bacteria.
3. The construction method according to claim 2, characterized in that, The conditions for the electric shock conversion described in S3 are: an electric shock constant of 4~6ms and a voltage of 1~3kV.
4. The construction method according to claim 2, characterized in that, The incubation temperature described in S3 is 30~40℃.
5. The construction method according to claim 2, characterized in that, The screening described in S3 involves spreading the revived bacterial cells onto MRS agar plates containing 90-110 μg / mL erythromycin and culturing them at 30-40°C for at least 36 hours.
6. The application of the acid-resistant Lactobacillus plantarum engineered strain as described in claim 1 in the preparation of fermented foods.
7. The application of the acid-resistant Lactobacillus plantarum engineered strain according to claim 1 in the preparation of probiotic health products, characterized in that, The probiotic health products are used to regulate the intestinal flora.
8. The application of the acid-resistant Lactobacillus plantarum engineered strain as described in claim 1 in brewing.