Specific primer for detecting swine edema disease and application thereof

Abstract

The invention discloses a specific primer pair for detecting a swine edema disease. The specific primer pair comprises a forward primer Stx2eF and a reverse primer Stx2eR, wherein the nucleotide sequence of the forward primer Stx2eF is as shown in SEQ ID NO: 1, and the nucleotide sequence of the reverse primer Stx2eR is as shown in SEQ ID NO: 2. Data show that the detection result of a sample inoculated with Shiga toxin-producing escherichia coli containing the Stx2e gene by using the primer pair disclosed by the invention is highly consistent with the actual infection degree, and the pathogenic bacterium load can be dynamically quantified through a standard curve. By means of the advantage, early warning of the pig edema disease can be achieved, and a key time window is provided for early prevention and control.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular detection, and particularly relates to a specific primer pair for detecting porcine edema disease and application thereof. BACKGROUND

[0002] Shiga toxin-producing Escherichia coli (STEC) is a group of pathogenic Escherichia coli that can produce Shiga toxin (Stx). According to the antigenic difference of Stx produced, Stx can be mainly divided into Stx1 and Stx2 two subtypes. Among them, Stx2 subtype is more concerned due to its stronger virulence and closer association with animal and human diseases. Stx2 subtype can be subdivided into multiple variants (such as Stx2a, Stx2b, Stx2c, Stx2d, Stx2e, etc.) through genetic sequence difference, and the host specificity and pathogenic spectrum of different variants are significantly different. Stx2e variant is the only Stx subtype with high pathogenicity to pigs, and its encoding gene (Stx2e) is a key virulence factor of toxin-producing strains causing porcine edema disease. Porcine edema disease is an acute fatal disease of weaned piglets caused by specific serotypes of Stx2e gene-carrying Shiga toxin-producing Escherichia coli (such as O138, O139, O141 and other serotypes). Its pathogenesis is directly related to the action of Stx2e toxin: the toxin binds to the receptor on the surface of the intestinal epithelial cells of piglets, enters the blood circulation and targets the vascular endothelial cells, especially the blood vessels in the brain tissue, gastrointestinal mucosa and eyelid, etc., leading to increased vascular permeability and causing characteristic head and eyelid edema and neurological symptoms (such as ataxia, circling). Therefore, detecting Stx2e gene is of great significance for the diagnosis and prevention of porcine edema disease.

[0003] At present, the detection of porcine edema disease mainly relies on bacterial isolation and culture, but this method has obvious defects in timeliness and sensitivity, cannot directly detect Stx2e gene, and is complicated and time-consuming (3-5 days), making it difficult to achieve early warning. Some immunological detection methods target Stx2e protein, which can be quickly detected, but cannot distinguish between "gene carrying" and "toxin expression", can only detect expressed Stx2e protein, and has limited specificity due to cross-reaction with other Stx subtypes; the existing nucleic acid detection method (such as ordinary PCR) targets Stx2e gene, but has low sensitivity and cannot be quantified. Fluorescent quantitative PCR technology has been applied to microbial detection, and has advantages in sensitivity, specificity and speed. However, there is no diagnostic kit for rapid and accurate diagnosis of Stx2e toxin gene of porcine Shiga toxin-producing Escherichia coli in the prior art, so that the diagnosis and detection of Stx2e toxin gene of porcine Shiga toxin-producing Escherichia coli still has defects such as complicated operation, low sensitivity, and only qualitative but not quantitative. SUMMARY

[0004] To solve the above technical problems, the application provides a specific primer pair for detecting pig edema disease, the primer pair can specifically detect Stx2e gene-containing Shiga toxin-producing Escherichia coli.

[0005] To achieve the above object, the technical scheme provided by the application is as follows:

[0006] A specific primer pair for detecting pig edema disease, comprising a forward primer Stx2eF and a reverse primer Stx2eR; wherein the nucleotide sequence of the forward primer Stx2eF is shown as SEQ ID NO: 1, and the nucleotide sequence of the reverse primer Stx2eR is shown as SEQ ID NO: 2.

[0007] The application of the specific primer for detecting pig edema disease in preparing a product for detecting pig edema disease is adopted.

[0008] The application of the specific primer for detecting pig edema disease in preparing a reagent or kit for detecting pig edema disease is adopted.

[0009] A method for detecting pig edema disease, comprising the following steps:

[0010] (1) Using the genomic DNA of a sample to be tested as a template, amplifying by using the forward primer Stx2eF and the reverse primer Stx2eR or the reagent or kit, and performing real-time fluorescent quantitative PCR detection to obtain a Ct value;

[0011] (2) Determining whether the sample to be tested contains Stx2e toxin Escherichia coli according to the detection result Ct value: when the Ct value is < 36, it is determined to be positive, indicating that the sample to be tested contains Stx2e toxin Escherichia coli; when the Ct value is 36≤CT<37.5, it is determined to be false positive, and repeated detection is required; when the Ct value is ≥ 37.5 or no Ct value is contained, it is determined to be negative, indicating that the sample to be tested does not contain Stx2e toxin Escherichia coli;

[0012] The method is not used for disease diagnosis and treatment.

[0013] Further, the reaction system for detecting by using the real-time fluorescent quantitative PCR instrument in step (1) is as follows: qPCR SYBRGreen Master Mix 10 μL, template 2 μL, primer Stx2eF / Stx2eR (10 μM) 0.4 μL, and ddH2O 7.2 μL.

[0014] Further, the reaction procedure detected by the real-time fluorescent quantitative PCR instrument is as follows: 94℃ pre-denaturation for 8 min, then 40 cycles, each cycle including 94℃ denaturation for 10 s and 55℃ annealing and extension for 30 s.

[0015] Further, when the detection result is determined as positive in step (2), the E. coli can be further quantified, that is, the standard curve is drawn.

[0016] The standard curve drawing comprises the following operation steps:

[0017] S1 Preparation of plasmid standard of Stx2e specific fragment of pig edema disease: a recombinant plasmid fluorescence quantitative PCR standard curve is constructed, a plasmid standard of Stx2e specific fragment of pig edema disease is prepared, qPCR is amplified and data is collected, a standard curve is drawn and analyzed, and a pET28a-Stx2e recombinant plasmid is obtained. The positive strain is obtained by transforming the pET28a-Stx2e plasmid into the DH5α competent cell. The logarithmic value of the copy number of the pET28a-Stx2e plasmid standard is taken as the abscissa, and the Ct value of the fluorescence quantitative result is taken as the ordinate, to establish the standard curve of the plasmid of the Stx2e specific fragment of pig edema disease.

[0018] S2 Construction of SYBR Green fluorescence quantitative PCR standard curve: the pET28a-Stx2e plasmid is extracted from the positive strain in step S1 by using a plasmid extraction kit, its concentration is determined, and its copy number is calculated; the standard is gradiently diluted, qPCR is amplified, and data is collected, and the standard curve is drawn and analyzed.

[0019] Further, the more specific steps of S1 preparation of plasmid standard of Stx2e specific fragment of pig edema disease are as follows: the Shiga toxin-producing E. coli (Stx2e) genomic DNA is extracted, the extracted genomic DNA is taken as a template, PcrsF / PcrsR is taken as a primer, ordinary PCR reaction amplification is carried out, the PCR product is subjected to agarose gel electrophoresis, if a 484 bp band appears in the detection group lane and no band appears in the negative control, then the gel is recovered; the target band of the ordinary PCR reaction amplification is recovered by using a DNA purification recovery kit, the recovered product is double-digested with a pET28a vector, and then linked to obtain a pET28a-Stx2e recombinant plasmid. The pET28a-Stx2e plasmid is transformed into a DH5α competent cell, and then coated on an LB solid culture medium containing 50 μL / mL of antibiotic Kan, and incubated at 37℃ overnight. Four single colonies are randomly picked and incubated in an LB liquid culture medium containing 50 μL / mL of antibiotic Kan at 37℃ and 180 r / min overnight. The cultured bacterial liquid is detected by PCR for qualitative analysis, and then sequenced to determine the positive strain, which is used for construction of the fluorescence quantitative PCR standard curve.

[0020] Further, the operation of constructing the SYBR Green fluorescence quantitative PCR standard curve in S2 is more specifically using the plasmid extraction kit to extract the pET28a-Stx2e plasmid from the positive strain in step S1, using the ultramicro spectrophotometer to measure the concentration, calculating the copy number according to the calculation formula copies=(concentration(ng / μL)×6.02×10 23 ×10 -9 ) / (660×base number), and gradient diluting the standard, using sterile ddH2O to perform 10 times series gradient dilution on the pET28a-Stx2e plasmid DNA, selecting seven dilution concentrations, and the pET28a-Stx2e plasmid standard is 1.36×10 8 ~ 1.36×10 2 copies / μL.

[0021] Amplifying qPCR and collecting data: the seven different concentrations of plasmid standards are detected in turn by using the real-time fluorescence quantitative PCR instrument, and the melting curve and amplification curve are collected, and three technical repeats are performed for each concentration.

[0022] Standard curve drawing and analysis: taking the logarithmic value of the copy number of the pET28a-Stx2e plasmid standard as the abscissa and the Ct value of the fluorescence quantitative result as the ordinate, a standard curve is established.

[0023] Further, the re-detection in step (2) is that when the Ct value is <37.5 and the standard amplification curve and the melting curve appear, it is determined to be positive, otherwise it is determined to be negative.

[0024] Compared with the prior art, the beneficial effects of the present application are:

[0025] The present application uses the SYBR Green fluorescence quantitative PCR system, combines specific primers (Stx2eF / R) and plasmid standards, and reduces the detection limit to 1.36×10 1 copies / μL, and has good sensitivity. Through the data, the detection result of the sample containing Stx2e gene-producing Shiga toxin E. coli inoculated by using the primer pair of the present application is highly consistent with the actual infection degree, and the pathogenic bacteria load can be dynamically quantified through the standard curve. This advantage can realize early warning of pig edema disease, and provides a key time window for early prevention and control. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 The Stx2e gene amplification result is shown in the figure, wherein 1 is a 2000 marker, 2-5 are Stx2e gene PCR products, and 6 is a negative control.

[0027] Figure 2Figure 1 is a schematic diagram of the amplification curve of the fluorescent quantitative PCR detection system in Example 3; wherein samples 1-7 are different concentrations of pET28a-Stx2e plasmid standard, i.e. 1.36 x 10 8 ~ 1.36 x 10 2 copies / μL, and 8 is a negative control.

[0028] Figure 3 Figure 2 is a schematic diagram of the melting curve of the fluorescent quantitative PCR detection system in Example 3.

[0029] Figure 4 Figure 3 is a schematic diagram of the standard curve of the fluorescent quantitative PCR detection system in Example 3.

[0030] Figure 5 Figure 4 is a schematic diagram of the sensitivity test of the fluorescent quantitative PCR detection system in Example 4; wherein samples 1-9 are different concentrations of pET28a-Stx2e plasmid standard, i.e. 1.36 x 10 8 ~ 1.36 x 10 0 copies / μL.

[0031] Figure 6 Figure 5 is a schematic diagram of the specificity test of the fluorescent quantitative PCR detection system in Example 5; wherein 1, 2 are pPET28a-Stx2e positive plasmid, 3, 4 are standard Shiga toxin-producing E. coli (containing Stx2e), 5-10 are Salmonella, Clostridium perfringens, Actinobacillus pleuropneumoniae, Staphylococcus, E. coli (not containing Stx2e), and a negative control.

[0032] Figure 7 Figure 6 is a schematic diagram of the amplification curve of the fluorescent quantitative PCR detection system in Example 7;

[0033] Figure 8 Figure 7 is a schematic diagram of the melting curve of the fluorescent quantitative PCR detection system in Example 7;

[0034] wherein, Figure 7 、 Figure 8 1 is a positive control, and 2-13 are samples to be tested. DETAILED DESCRIPTION

[0035] The application will be described in detail below with reference to the drawings, but it should be understood that the scope of protection of the application is not limited by the specific embodiments. The raw materials and reagents used in the examples are commercially available unless otherwise specified.

[0036] The strain used to prepare the standard plasmid in the embodiments of the application is a Shiga toxin-producing E. coli (containing Stx2e) screened and preserved by the laboratory, and can also be purchased on the market.

[0037] Example 1

[0038] Primer design

[0039] According to the genomic information of the sequenced Shiga toxin-producing E. coli, a pair of specific primers was designed for Stx2e, and the primers for Stx2e gene were synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd. The sequence is shown in Table 1:

[0040] Table 1 Fluorescent quantitative PCR primer sequence

[0041]

[0042] Example 2

[0043] Preparation of Shiga toxin-producing E. coli Stx2e specific fragment plasmid standard

[0044] 2.1: Extract the genomic DNA of Shiga toxin-producing E. coli (Stx2e),

[0045] 2.2: Using the extracted genomic DNA as a template, PcrsF / PcrsR as primers (as shown in Table 2), perform ordinary PCR reaction amplification;

[0046] 2.3: Perform agarose gel electrophoresis on the PCR product. If a 484bp band appears in the detection group lane, and no band appears in the negative control (sterile water as negative control), then perform gel recovery.

[0047] The reaction system is: 2x Green Taq Mix 10μL, PcrsF / PcrsR (10μM) 1μL, template 2μL, ddH2O 6μL.

[0048] The PCR reaction program is: 94℃ pre-denaturation for 5min, 94℃ denaturation for 15s, 54.5℃ annealing for 15s, 72℃ extension for 15s, a total of 30 cycles, 72℃ complete extension for 7min.

[0049] Table 2 Common PCR primer sequence

[0050]

[0051] 2.4: The target band amplified by ordinary PCR reaction was recovered by cutting gel with DNA purification recovery kit, the recovered product was double-digested with pET28a vector, and the pET28a-Stx2e plasmid was obtained by ligation. The pET28a-Stx2e plasmid was transformed into DH5α competent cells, and plated on LB solid medium containing 50 μL / mL antibiotic Kan, and incubated at 37 ℃ overnight; 4 single colonies were randomly picked and incubated in LB liquid medium containing 50 μL / mL antibiotic Kan at 37 ℃, 180 r / min overnight; the cultured bacterial liquid was detected by PCR for qualitative detection, and then sequenced to determine the positive strain. Figure 1 ), which was used for the construction of standard curve of fluorescent quantitative PCR.

[0052] Example 3

[0053] Establishment of standard curve

[0054] 3.1 Selection and preparation of standard

[0055] The pET28a-Stx2e plasmid was extracted from the positive strain of step (2.4) by using plasmid extraction kit (Tiangen Biochemical Technology Co., Ltd.), and the base number of pET28a-Stx2e plasmid was 5853 bp. The concentration of pET28a-Stx2e plasmid was 87 ng / μL measured by ultramicro spectrophotometer. According to the calculation formula copies=(concentration (ng / μL) x 6.02 x 10 23 x 10 -9 ) / (660 x base number), the copy number was calculated to be 1.36 x 10 10 copies / μL.

[0056] 3.2 Gradient dilution of standard

[0057] The pET28a-Stx2e plasmid DNA was diluted by 10 times series gradient with sterilized ddH2O, and 7 concentrations of 1.36 x 10 8 ~ 1.36 x 10 2 copies / μL of pET28a-Stx2e plasmid standard were obtained.

[0058] 3.3 qPCR amplification and data collection

[0059] 7 different concentrations of plasmid standard were detected in turn by real-time fluorescent quantitative PCR instrument, and 3 technical repeats were performed for each concentration, and sterile enzyme-free water was used as negative control:

[0060] The reaction system included: 10.0 μL of qPCR SYBR Green Master Mix, 2 μL of template, 0.4 μL of primers Stx2eF / Stx2eR (10 μM), and 7.2 μL of ddH2O.

[0061] The reaction program was as follows: pre-denaturation at 94 °C for 8 min, followed by 40 cycles, each cycle consisting of denaturation at 94 °C for 10 s, annealing and extension at 55 °C for 30 s, and finally, amplification curves were generated. Figure 2 ) and melting curve ( Figure 3 )collection.

[0062] 3.4 Plotting and Analysis of Standard Curves

[0063] A standard curve was constructed using the logarithm of the copy number of the pET28a-Stx2e plasmid standard as the x-axis and the Ct value of the quantitative PCR result as the y-axis. Figure 4 The formula is y = -3.5185x + 40.967 (R). 2 =0.9995). For example Figure 2 As shown, the melting curve shows a single peak between 78 and 80°C, indicating that the PCR product has good specificity, which also indicates that the primers in Example 1 have good specificity.

[0064] Example 4

[0065] Sensitivity test

[0066] The concentration was 1.36 × 10 8 ~1.36×10 0 Sensitivity tests were performed using positive standard plasmid pET28a-Stx2e (copies / μL), with three replicates for each gradient. The minimum detection concentration of the detection method in Example 4 was determined by observing the standard curve. A standard curve was established with Ct value on the ordinate and the logarithm of the copy number on the abscissa to evaluate the sensitivity of the detection method.

[0067] The results are as follows Figure 4 As shown, the minimum detection limit of the detection method in Example 4 is 1.36 × 10⁻⁶. 1 Amplification curves can be observed when the sample concentration is greater than 13.6 copies / μL.

[0068] Example 5

[0069] Specificity test

[0070] The nucleic acid of the above bacteria was extracted as a template, and a negative control (sterile water without enzyme) was set to perform a fluorescent quantitative PCR reaction, and whether the amplification curve could be established was observed to verify the specificity of the method.

[0071] The results are shown in Table 2. Figure 6 It is shown that only the Shiga toxin-producing E. coli (containing Stx2e) and the pPET28a-Stx2e positive plasmid produce specific amplification curves, and the fluorescence intensity of the amplification curve is high, and there is no non-specific amplification. The nucleic acid samples of other bacteria have no amplification curve, and no Ct value is observed. It is proved that the detection method constructed in Example 4 has high specificity, and the detection specificity reaches 100%.

[0072] Example 6

[0073] Repeatability test

[0074] The positive standard plasmid pET28a-Stx2e with concentrations of 1.36×10 7 , 1.36×10 5 , 1.36×10 3 copies / μL were simultaneously subjected to fluorescent quantitative PCR test, three batches of repeated tests were performed at different time periods, and three repetitions were performed for each gradient in each batch of repeated test, that is, 3 times of intra-group test and 3 times of inter-group test, and the standard deviation (SD) and the coefficient of variation (CV) of intra-group and inter-group were calculated according to the detected Ct value. The repeatability of the method was evaluated according to the intra-group and inter-group variation coefficient results.

[0075] The repeatability test results (Table 3) show that the intra-group variation coefficient of the real-time fluorescent quantitative PCR detection method for pET28a-Stx2e is between 0.52% and 1.44%; the inter-group variation coefficient is between 0.07% and 0.86%, and the intra-group and inter-group variation coefficients are less than 1.44%. It is proved that the detection method established in Example 4 has good repeatability.

[0076] Table 3 Repeatability test results

[0077]

[0078] In summary, the Stx2eF / Stx2eR specific primer and the SYBR Green fluorescent quantitative PCR system can be used for sensitive detection of pig edema, and the minimum detection limit of the fluorescent quantitative PCR method is 1.36×10 1copies / μL; the specificity is strong, and the Stx2e toxin-producing E. coli can be effectively distinguished from other bacteria, and the repeatability is excellent, thereby providing an efficient and economic solution for early warning and precise prevention and control of pig edema disease.

[0079] Example 7

[0080] Detection of pig edema disease samples

[0081] Twelve oral fluid samples of piglets were collected from a suspected pig edema disease fattening farm as test samples, and DNA of the test samples was extracted by using an automatic nucleic acid extraction kit as a template; and a Shiga toxin-producing E. coli screened and preserved in the laboratory was used as a positive control.

[0082] (1) Real-time fluorescent quantitative PCR detection was performed by using a forward primer Stx2eF: GCCCGGTGTGACAACTATT and a reverse primer Stx2eR: CCAGTGAGTGACGACTGATTT, and a Ct value was obtained;

[0083] (2) According to the detection results, the Ct value of sample 2 was 34.9, indicating that the sample contained Stx2e toxin-producing E. coli, and the pathogen load could be quantified dynamically by using a standard curve; the test samples 3-13 did not contain the Ct value, indicating that the test samples did not contain Stx2e toxin-producing E. coli. In order to verify the accuracy of the detection results, amplification curves and melting curves were collected, and the results are shown in Figure 7 、 Figure 8 The results show that the detection results of the application are accurate.

[0084] The foregoing description of specific exemplary embodiments of the application is intended for purposes of illustration and example only. These descriptions are not intended to limit the application to the precise form disclosed, and obviously many changes and modifications can be suggested to one skilled in the art without departing from the spirit or scope of the application. The examples were chosen and described in order to explain the principles of the application and its practical application and to enable others skilled in the art to best utilize the application, as well as various embodiments and various modifications as are suited to the particular use contemplated. It is intended that the scope of the application be defined by the following claims and their equivalents.

Claims

1. A specific primer pair for detecting swine edema disease, characterized in that: It includes a forward primer Stx2eF and a reverse primer Stx2eR; wherein the nucleotide sequence of the forward primer Stx2eF is shown in SEQ ID NO:1, and the nucleotide sequence of the reverse primer Stx2eR is shown in SEQ ID NO:

2.

2. Application of the specific primers for detecting swine edema disease as described in claim 1 in the preparation of products for detecting swine edema disease.

3. Application in the preparation of reagents or kits for detecting swine edema disease using the specific primers for detecting swine edema disease as described in claim 1.

4. A method for detecting swine edema disease, characterized in that, Includes the following steps: (1) Using the genomic DNA of the sample to be tested as a template, amplify it using the forward primer Stx2eF and the reverse primer Stx2eR as described above, or the reagent or kit described above, and perform real-time fluorescence quantitative PCR detection to obtain the Ct value; (2) Determine whether the sample contains Stx2e toxin Escherichia coli based on the Ct value of the test result: when the Ct value is <36, it is considered positive; when the Ct value is 36≤CT<37.5, it is considered a false positive and needs to be tested again; when the Ct value is ≥37.5 or there is no Ct value, it is considered negative. The method described is not intended for disease diagnosis and treatment.

5. The method for detecting swine edema disease according to claim 4, characterized in that: The reaction system described in step (1) for detection by real-time fluorescence quantitative PCR instrument is as follows: 10 μL qPCR SYBR Green Master Mix, 2 μL template, 0.4 μL primers Stx2eF / Stx2eR (10 μM), and 7.2 μL ddH2O.

6. The method for detecting swine edema disease according to claim 5, characterized in that: The reaction procedures for the real-time quantitative PCR instrument were as follows: pre-denaturation at 94 °C for 8 min, followed by 40 cycles, with each cycle consisting of denaturation at 94 °C for 10 s and annealing extension at 55 °C for 30 s.

7. The method for detecting swine edema disease according to claim 4, characterized in that: In step (2), when the test result is confirmed to be positive, E. coli can be further quantified, i.e., a standard curve can be plotted. The standard curve plotting includes the following steps: Preparation of Stx2e-specific fragment plasmid standard for S1 porcine edema disease: A standard curve for recombinant plasmid fluorescence quantitative PCR was constructed, a standard for porcine edema disease Stx2e-specific fragment plasmid was prepared, qPCR was amplified and data was collected, the standard curve was plotted and analyzed, and the pET28a-Stx2e recombinant plasmid was obtained. The pET28a-Stx2e plasmid was transformed into DH5α competent cells to obtain positive strains. The standard curve for the porcine edema disease Stx2e-specific fragment plasmid was established with the copy number logarithm of the pET28a-Stx2e plasmid standard as the x-axis and the Ct value of the fluorescence quantitative result as the y-axis. S2 Construction of SYBR Green real-time PCR standard curve: pET28a-Stx2e plasmid was extracted from the positive strain in step S1, its concentration was measured, and its copy number was calculated; the standard was serially diluted, qPCR was amplified and data was collected, and the standard curve was plotted and analyzed.

8. The method for detecting swine edema disease according to claim 7, characterized in that: The more specific steps for preparing the Stx2e specific fragment plasmid standard for S1 swine edema disease are as follows: Genomic DNA of Shiga toxin-producing *Escherichia coli* (Stx2e) is extracted. Using the extracted genomic DNA as a template and PcrsF / PcrsR as primers, a conventional PCR reaction is performed. The PCR product is then subjected to agarose gel electrophoresis. If a 484bp band appears in the detection lane and no band appears in the negative control, the gel is recovered. The target band amplified by the conventional PCR reaction is excised and recovered using a DNA purification and recovery kit. The recovered product is double-digested with the pET28a vector and ligated to obtain the pET28a-Stx2e recombinant plasmid. The pET28a-Stx2e plasmid is transformed into DH5α competent cells and plated on LB solid medium containing 50 μL / mL of antibiotic Kan, and cultured overnight at 37 ℃. Four single colonies are randomly picked and cultured on LB liquid medium containing 50 μL / mL of antibiotic Kan at 37 ℃. The culture was carried out overnight with constant temperature shaking at ℃ and 180 r / min. The cultured bacterial solution was qualitatively detected by PCR and then sequenced to identify positive strains, which were used to construct a standard curve for quantitative real-time PCR.

9. The method for detecting swine edema disease according to claim 7, characterized in that: In step S2, the specific steps for constructing the SYBR Green real-time PCR standard curve are as follows: Extract the pET28a-Stx2e plasmid from the positive strain in step S1, determine its concentration using a micro spectrophotometer, and calculate the concentration using the formula: copies = (concentration (ng / μL) × 6.02 × 10⁻⁶). 23 ×10 -9 Calculate the copy number using (660 × bases); serially dilute the standard by using sterile ddH2O to perform 10-fold serial dilutions of pET28a-Stx2e plasmid DNA, selecting 7 dilutions of 1.36 × 10⁻⁶ bases. 8 ~ 1.36×10 2 pET28a-Stx2e plasmid standard in copies / μL; Amplification qPCR and data collection: Seven plasmid standards of different concentrations were sequentially detected using a real-time quantitative PCR instrument, and melting curves and amplification curves were collected; Standard curve plotting and analysis: A standard curve was established with the logarithm of the copy number of the pET28a-Stx2e plasmid standard as the x-axis and the Ct value of the quantitative fluorescence result as the y-axis.

10. The method for detecting swine edema disease according to claim 4, characterized in that: The retesting mentioned in step (2) is considered positive if the Ct value is <37.5 and a standard amplification curve and melting curve are present; otherwise, it is considered negative.

Images