Establishment method of indirect ELISA (enzyme-linked immuno sorbent assay) for detecting mycobacterium bovis Lprl

Abstract

The invention discloses a method for establishing indirect ELISA (enzyme-linked immunosorbent assay) for detecting mycobacterium bovis Lprl, which comprises the following steps: preparing mycobacterium bovis Lprl protein, taking the purified protein as an antigen, and determining conditions such as optimal antigen coating concentration, serum dilution, serum incubation time, secondary antibody dilution concentration, incubation time and the like. The established indirect ELISA detection method does not have cross reaction with other bovine pathogens, the specificity is good, the detection accuracy is high, and the total coincidence rate of test results of intradermal allergy with bovine tubercle bacillus is 95.8%; the intra-batch variation coefficient of the detected samples is 2.43%-3.61%, the inter-batch variation coefficient is 2.83%-3.96%, and the intra-batch variation coefficient and the inter-batch variation coefficient are both smaller than 10%. A new diagnosis target is developed, the established indirect ELISA method has the characteristics of high sensitivity, strong specificity, good repeatability and the like, the operation is easy, and a new method is provided for the detection work of the mycobacterium bovis.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, and in particular relates to a method for establishing an indirect ELISA for detecting Mycobacterium bovis Lprl. Background Technology

[0002] Mycobacterium bovis ( Mycobacterium bovis This disease seriously endangers public health and the high-quality development of the livestock industry. It can infect various livestock such as cattle, sheep, and pigs, and can also be transmitted to humans through direct contact or consumption of unsterilized dairy products. Current quarantine methods mainly include the tuberculin skin test (TST) and the interferon-gamma release test (IGRA). IGRAs are in vitro detection methods based on T-cell immunity that can rapidly report MTB infection results. They use ESAT6-CFP10 recombinant protein as the key stimulating antigen. Studies have shown that the positive rate of these methods is 85% higher than that of bovine PPD skin tests (see: Mu Wei. Expression of the bovine Mycobacterium tuberculosis cfp10-esat6 fusion gene and its expression product in the preliminary application of diagnosis [D]. Beijing: China Institute of Veterinary Drug Control, 2009). However, due to the small molecular weight and low immunogenicity of ESAT6 and CFP10 proteins, false negative results are common, leading to low detection sensitivity (see: Li Wu, Deng Guangcun, Liu Xiaoming, et al. Construction and expression of eukaryotic co-expression vectors of Mycobacterium tuberculosis CFP10, ESAT6, Ag85A and Ag85B antigens [J]. Chinese Journal of Biotechnology, 2014, 30(2):265-273.). Furthermore, their specificity is not high, and they are expensive, making them unsuitable for the development of my country's livestock industry.

[0003] Therefore, providing a method for establishing an indirect ELISA (iELISA) for detecting Mycobacterium bovis that is sensitive, specific, easy to operate, and standardized is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0004] In view of this, the present invention establishes an indirect ELISA detection method for detecting antibodies against Mycobacterium bovis using the cell surface lipoprotein Lprl protein of Mycobacterium bovis as the coating antigen.

[0005] This invention provides an indirect ELISA method for detecting Mycobacterium bovis, comprising the following steps: (a) The enzyme-labeled plate was coated with a coating solution containing bovine tuberculosis antigen, and then washed after incubation; the bovine tuberculosis antigen is the Lprl protein with the amino acid sequence shown in SEQ ID NO:1; (b) Block the coated microplate with blocking solution, incubate and then wash; (c) Add the serum to be tested as the primary antibody, incubate, and then wash. (d) Add enzyme-labeled secondary antibody, incubate, and then wash; (e) Add the substrate to initiate a colorimetric reaction, and then add the stop solution to terminate the reaction; (f) Detect the color development signal and determine the result based on the signal.

[0006] Specifically, in step (a), the coating concentration of the Lprl protein is 20 μg / mL, and the coating conditions are overnight at 4°C for 16 hours.

[0007] Specifically, in step (b), 5% skim milk is used as the sealing solution, and the mixture is sealed at 37°C for 0.5 hours.

[0008] Specifically, in step (c), the sample to be tested is serum diluted 1:50 and incubated at 37°C for 1.5 hours.

[0009] Specifically, in step (d), the enzyme-labeled secondary antibody is diluted to 1:6000 and incubated at 37°C for 1.5 hours.

[0010] Specifically, step (f) includes the following steps: 1) Obtain OD by determining negative standards 450nm The mean X and standard deviation S are used to determine the positive and negative cutoff values ​​of the indirect ELISA method. The positive cutoff value includes a positive cutoff value and a negative cutoff value. The positive cutoff value is X+3S and the negative cutoff value is X+2S. 2) Measure the sample to be tested. If the OD of the sample to be tested... 450nm If the OD value of the test sample is greater than or equal to the positive threshold, the test sample is determined to be positive; if the OD value of the test sample is less than or equal to the positive threshold, the test sample is determined to be positive. 450nm If the OD value of the sample is less than the positive threshold and greater than or equal to the negative threshold, the sample is considered suspicious; if the OD value of the sample is less than the positive threshold and greater than or equal to the negative threshold, the sample is considered suspicious. 450nm If the value is less than the negative threshold, the sample to be tested is determined to be negative.

[0011] The present invention also provides an ELISA detection kit for implementing the above detection method, comprising an enzyme-labeled plate coated with an Lprl protein having an amino acid sequence as shown in SEQ ID NO:1.

[0012] Specifically, the kit also includes enzyme-labeled secondary antibody, blocking solution, washing solution, diluent, positive control sample, negative control sample, colorimetric solution, and stop solution.

[0013] The present invention also provides the use of Lprl protein, with an amino acid sequence as shown in SEQ ID NO:1, as a detection target in the preparation of a kit for detecting or identifying Mycobacterium bovis.

[0014] The beneficial effects of this invention are as follows: It is the first time that Lprl protein has been used as an antigen, opening up a new target for the detection of Mycobacterium bovis. A highly efficient and specific indirect ELISA method has been successfully established. Through systematic optimization of key parameters such as antigen coating concentration, blocking conditions, serum dilution and reaction time, and enzyme-labeled secondary antibody dilution concentration and reaction time, the established method exhibits high sensitivity, strong specificity, and high detection accuracy. The overall concordance rate with the bovine tuberculin intradermal allergy test is 95.8%. The coefficients of variation for intra-assay and inter-assay repeatability tests are both less than 10%, indicating that the method possesses excellent reproducibility and stability. This invention provides reliable technical tools and data support for large-scale epidemiological surveillance and laboratory testing of Mycobacterium bovis in clinical practice. Attached Figure Description

[0015] Figure 1 This invention uses SDS-PAGE to analyze protein expression in Escherichia coli; Figure 2 This invention uses SDS-PAGE to analyze the expression form of fusion proteins; where M is a marker; 1 is the supernatant; and 2 is the precipitate. Figure 3 The SDS-PAGE method of this invention is used to analyze the protein purification effect; wherein, M is Marker; 1 is flow-through buffer; 2 is elution buffer 1; 3 is elution buffer 2; Figure 4 The protein was identified by Western blotting using anti-His-mouse as the primary antibody. Figure 5 To verify the reactivity of the antigen with positive serum using Western blot. Detailed Implementation

[0016] The embodiments of the present invention will be described in detail below with reference to specific examples. These embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Rather, they should be understood as a more detailed description of certain aspects, characteristics, and implementations of the invention. Unless otherwise specified, all instruments, reagents, and materials used in the following embodiments are commercially available, and all experimental operations are standard procedures in the art.

[0017] The main reagents and consumables used in this invention are as follows: BryGolid™ His-tag purification resin (catalog number: DS0110) was purchased from Beyotime Biotechnology Co., Ltd.; ELISA plates (96 wells / plate) were purchased from Kangwei Reagent Biotechnology Co., Ltd.; TMB two-component chromogenic solution (PR1210) and ELISA stop solution (C1058) were purchased from Beijing Solarbio Science & Technology Co., Ltd.; protein marker (10-180kDa, MP102-01) was purchased from Nanjing Novizan Biotechnology Co., Ltd.; IPTG (I8070) was purchased from Beijing Solarbio Science & Technology Co., Ltd.; skim milk powder (1172GR500) and PVDV membrane (0.22μm, TM-PVDF-R-22) were purchased from Biosharp Beijing Lanjieke Technology Co., Ltd.; ECL chemiluminescence solution (CW0064M) was purchased from Kangwei Reagent Biotechnology Co., Ltd.; rabbit anti-bovine IgG / HRP (0.1ml / vial, SE233) The following were purchased from Beijing Solarbio Science & Technology Co., Ltd.: Goat anti-mouse IgG (H+L) antibody (96uL / vial, HS002-02) was purchased from Quanshijin Biotechnology Co., Ltd.; Bovine tuberculosis ELISA antibody detection kit was purchased from Wuhan Keqian Biotechnology Co., Ltd.; Bovine tuberculosis mycobacterium positive serum, bovine paratuberculosis mycobacterium positive serum, Brucella positive serum, Campylobacter jejuni and Campylobacter fetus positive serum samples were preserved by the laboratory of the College of Animal Science and Technology of Shihezi University.

[0018] The antigen selected in this invention is the Lprl protein of Mycobacterium bovis, with the amino acid sequence shown in SEQ ID NO:1, which is consistent with the sequence in the NCBI database with accession number WP_003407725.1. Analysis using the bioinformatics analysis tool PRED-LIPO predicts that the Lprl protein is a lipid-modified and glycosylated cell surface lipoprotein of Mycobacterium bovis. Due to its high expression on the bacterial surface and strong immunogenicity, Lprl induces a specific antibody response in tuberculous cattle. Therefore, selecting recombinant Lprl protein is a potential antigen for developing novel and more accurate serological diagnostic tools for tuberculosis, helping to supplement existing bacteriological diagnostic methods and achieve more convenient auxiliary diagnosis. As a key surface molecule involved in host immune interaction, the functional region or epitope of Lprl may become a candidate target for novel vaccine design.

[0019] Example 1: Preparation of Lprl protein 1. Induced expression of recombinant proteins The recombinant plasmid was constructed by General Biotechnology (Anhui) Co., Ltd., and its DNA sequence is shown in SEQ ID NO:2. A kanamycin-resistant pET-28a(+) vector was selected as the expression backbone. Seamless cloning technology was used for construction, which relies on highly homologous sequences at both ends of the insert fragment to the ends of the linearized vector for efficient recombination. The synthesized double-stranded DNA fragment was used as the insert fragment, and its sequence was carefully designed: the 5' end (TGTTTAACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCATCATCATCATCACTCACGAGGTGC, SEQ ID NO:3) contains an optimized ribosome binding site and a sequence encoding an additional 6×His tag; the 3' end (AGCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGATGAGATGGATCGGCGTCCTGGTGA, SEQ ID NO:4) precisely introduces an XhoI restriction enzyme site upstream of it. Following the operating procedures of the seamless cloning kit, the purified linearized vector and the synthetic DNA fragment were mixed at a molar ratio of 1:2, and homologous recombination reaction was carried out at 50°C.

[0020] The recombinant plasmid pET28a-Lprl, which had been verified by enzyme digestion and sequencing, was transformed into BL21(DE3) competent Escherichia coli. Positive single colonies were picked and inoculated into LB broth containing 10 μg / mL kanamycin and cultured overnight at 37°C with a shaker. The next day, the culture was scaled up at a 1:100 ratio to 600 mL of LB broth containing 10 μg / mL kanamycin. When the bacterial culture OD... 600 When the protein concentration reached 0.6-0.8, IPTG was added to a final concentration of 1 mmol / L, and expression was induced at 37℃. Cells were collected by centrifugation at 10000 r / min at 0 h, 2 h, 4 h, 6 h, and 8 h after induction. Protein expression was verified by SDS-PAGE electrophoresis. After Coomassie brilliant blue staining and destaining, the results showed (e.g.) Figure 1 The recombinant expression strain pET28a-Lprl / BL21(DE3) was induced to produce a protein of approximately 21 kDa, which was in line with expectations.

[0021] 2. Identification of protein expression forms and purification of proteins A small amount of bacterial cells collected after induced expression were resuspended in PBS, lysed by sonication, and centrifuged at 10000g for 10 min at 4℃. The supernatant and precipitate were separated, and the expression pattern was confirmed by SDS-PAGE analysis, confirming that the expression product was inclusion body expression. The results are as follows. Figure 2 As shown, inclusion body purification was subsequently performed.

[0022] Take the remaining collected bacterial cells, perform ultrasonic lysis and centrifugation under the above conditions, discard the supernatant, resuspend the precipitate in Inclusion Body Binding Buffer, centrifuge and discard the supernatant, incubate overnight at 4°C to dissolve the inclusion bodies, filter through a 0.22 μm microporous membrane; pour Ni agarose gel into a column and equilibrate with Inclusion Body Binding Buffer; load the protein liquid onto the column and allow it to flow through naturally; wash the column with 15 column volumes of Inclusion Body Binding Buffer; elute with 5 column volumes of Inclusion Body Elution Buffer and collect the elution peak.

[0023] 3. Protein purification, identification, and reaction-genicity verification Take an appropriate amount of elution buffer, add 5× protein electrophoresis SDS buffer, boil the sample, and perform SDS-PEAG gel electrophoresis. The results are as follows: Figure 3 As shown, the target protein was obtained in the elution buffer. Subsequently, the electrophoresis gel was transferred to a 0.22 PVDF membrane, and Western blotting was performed using His-mouse as the primary antibody and goat anti-mouse as the secondary antibody. The results are as follows. Figure 4 As shown, a protein with high purity was obtained.

[0024] To verify the reactivity, another purified protein sample was boiled and subjected to SDS-PAGE gel electrophoresis in the same manner, then transferred to a PVDF membrane. Western blot analysis was performed using bovine tuberculosis-positive serum as the primary antibody and rabbit anti-bovine IgG as the secondary antibody. The results are as follows: Figure 5 This indicates that the antigen has good reactivity.

[0025] Example 2: Optimization and Determination of Key Reaction Conditions for Indirect ELISA Detection Method The Lprl protein prepared in Example 1 was diluted with ELISA protein coating buffer and coated onto an ELISA plate. The plate was incubated overnight at 4°C for 16 hours. The coating buffer was discarded, and the plate was washed three times with PBST and blotted dry. The plate was blocked with 5% skim milk powder (200 μL per well) and incubated at 37°C. The blocking buffer was discarded, and the plate was washed three times and blotted dry. Using bovine tuberculosis-positive serum as the primary antibody, the plate was incubated at 37°C (100 μL per well). After washing three times and blotting dry, the plate was incubated with rabbit anti-bovine IgG ELISA-labeled secondary antibody (100 μL per well) for 1.5 hours. The secondary antibody was discarded, the plate was washed five times, and blotted dry. 100 μL of chromogenic buffer was added to each well, and the plate was incubated for 20 minutes. Then, 50 μL of stop buffer was added to each well. This is the initial basic procedure for the ELISA method. The optimal conditions were then determined through trial and error.

[0026] 1. Determination of optimal antigen coating concentration and optimal serum dilution The optimal antigen coating concentration and serum dilution were determined using a square matrix titration method. The antigen was diluted to final concentrations of 2.5 μg / mL, 5 μg / mL, 10 μg / mL, and 20 μg / mL using carbonate buffer (pH 9.6). Serial dilutions were performed on standard negative and positive sera with PBST at ratios of 1:50, 1:100, 1:200, and 1:500. Each antigen coating concentration and serum dilution was repeated in triplicate. The primary antibody was blocked and incubated for 1 hour. Other reaction conditions and procedures followed the initial basic ELISA procedure described above. Positive serum OD was selected. 450nm The optimal antigen coating concentration and serum dilution are those where the value is close to 1.0 and the P / N value is at its maximum.

[0027] The experimental results are shown in Table 1. When the antigen coating concentration is 20 μg / mL and the serum dilution is 1:50, the P / N value is the largest, so it is taken as the optimal antigen coating concentration and the optimal serum dilution.

[0028] Table 1 Determination of Optimal Antigen Coating Concentration and Optimal Serum Dilution

[0029] Note: P indicates positive serum OD 450nm N represents negative serum OD 450nm P / N indicates positive serum OD 450nm With negative serum OD 450nm The ratio of .

[0030] 2. Determine the optimal closing time Applying the optimal conditions selected above, the blocking time was set as a single variable. 5% skim milk was used as the blocking solution, and four blocking times were set: 0.5h, 1h, 1.5h, and 2h at 37℃. Other reaction conditions and procedures followed the initial basic procedure of the ELISA method described above. For each blocking time, one standard negative serum sample and three different standard positive serum samples were used for testing, with three replicates for each. Finally, the blocking time corresponding to the highest P / N value was selected as the optimal one.

[0031] The test results are shown in Table 2. The sealing time was set to 0.5h, 1h, 1.5h and 2h respectively. The results showed that the P / N value of the test results was the highest when the sealing time was 0.5h at 37℃. Therefore, the optimal sealing time was selected as 0.5h.

[0032] Table 2 Determination of Optimal Closure Conditions

[0033] 3. Determine the optimal action time of serum. Using the optimal conditions screened above, set the serum incubation time as a single variable, with four serum incubation times of 0.5 h, 1.0 h, 1.5 h, and 2.0 h at 37 °C. Other reaction conditions and procedures refer to the initial basic process of the above ELISA method. For each incubation time, one standard negative serum and three different standard positive sera were used for detection, with 3 replicates for each. Finally, when the P / N value is the largest, the corresponding serum incubation time is the best.

[0034] The comparison of the incubation times of the three groups of positive sera showed that (Table 3) when the serum incubation time was 1.5 h at 37 °C, the P / N value of the detection result was the highest. Therefore, the selected optimal serum incubation time was 1.5 h.

[0035] Table 3 Determination of the optimal serum incubation time

[0036] 4. Determine the optimal dilution of the enzyme-labeled antibody Using the optimal conditions screened above, set the dilution of rabbit anti-bovine IgG enzyme-labeled antibody as a single variable, with four dilutions of 1:2000, 1:4000, 1:6000, and 1:8000. For each dilution, one standard negative serum and three different standard positive sera were used for detection, with 3 replicates for each. Finally, when the P / N value is the largest, the corresponding dilution of the enzyme-labeled antibody is the best.

[0037] The comparison of the working concentrations of the four groups of enzyme-labeled antibodies showed that (Table 4) when the dilution of the enzyme-labeled antibody was 1:6000, the P / N value of the detection result was the highest. Therefore, the selected optimal dilution of the enzyme-labeled antibody was 1:6000.

[0038] Table 4 Determination of the optimal working concentration of the enzyme-labeled antibody

[0039] 5. Determine the cut-off values for positive and negative results of the indirect ELISA method Using 88 negative sera determined by the intradermal hypersensitivity test of clinical bovine tuberculin (PPD) (judged according to GB / T 18645-2020 "Diagnostic Techniques for Animal Tuberculosis"), ELISA detection was performed according to the detection method established under the optimal conditions, and the average value (X) and standard deviation (S) of the OD 450nm values of the negative serum samples were calculated. According to statistical principles, the cut-off values were determined. That is, when OD 450nm ≥X + 3S, it was judged as positive; when OD 450nm <X + 2S, it was judged as negative; those between the two were judged as suspicious.

[0040] The test results are shown in Table 5. Among the 88 sera, OD 450nmThe maximum value is 0.313, the minimum value is 0.03, the average value X is 0.123, and the standard deviation S is 0.065. Therefore, the lower limit of detection for positive samples is X + 3S = 0.318. To reduce the probability of false positives and false negatives in serum, the critical value plus or minus one standard deviation is set as the suspicious range, that is, when OD 450nm ≥0.318, it is judged as positive; when OD 450nm <X + 2S, that is, 0.253, it is judged as negative, and those between the two are judged as suspicious.

[0041] Table 5 Determination of the critical value of indirect ELISA

[0042] Performance evaluation of the established ELISA detection method in Example 3 1. Specificity test According to the established detection method, positive sera of Campylobacter jejuni ( Campylobacter jejuni ), Campylobacter fetus ( Campylobacter fetus ), Brucella ( Brucella ), Mycobacterium avium subsp. paratuberculosis ( Mycobacterium avium subspecies paratuberculosis ), etc. were detected simultaneously to verify whether there was a cross - reaction with other bovine pathogens. The test results of the specificity test are shown in Table 6. The OD 450 values of Campylobacter jejuni, Campylobacter fetus, Brucella, and Mycobacterium avium subsp. paratuberculosis were all less than the critical value, and only Mycobacterium bovis was positive, indicating that the established indirect ELISA antibody detection method of the present invention did not cross - react with the above - mentioned pathogens and had good specificity.

[0043] Table 6 Results of the specificity test

[0044] 2. Repeatability test Intra - batch repeatability test: The enzyme - labeled plates were coated with the recombinant protein Lprl expressed and purified in the same batch. According to the established ELISA reaction conditions, 3 positive sera with different antibody levels and 1 negative serum sample were detected, and 4 replicate wells were set for each sample, and the results were statistically analyzed.

[0045] Inter - batch repeatability test: The enzyme - labeled plates were coated with the recombinant protein Lprl expressed and purified in 4 different batches. According to the established ELISA reaction conditions, 3 positive sera with different antibody levels and 1 negative serum sample were detected, and 4 replicate wells were set for each sample, and the results were statistically analyzed.

[0046] The results (Table 7) show that the coefficient of variation (CV) for intra-batch repeatability tests was 2.43–3.61%, and the coefficient of variation for inter-batch repeatability tests was 2.83–3.96%, both less than 10%, indicating that the ELISA method established in this invention has good repeatability.

[0047] Table 7 Repeatability Tests

[0048] 3. Sensitivity test Positive sera under known backgrounds were serially diluted at 1:50, 1:100, 1:200, ..., 1:6400, and antibody titers were measured using the established indirect ELISA method to assess the sensitivity of the method. Three known positive sera and three known negative sera were then serially diluted using the same method and measured according to the established indirect ELISA method. OD 450nm A value ≥0.318 is considered positive (OD). 450nm A titer <0.253 was considered negative. The results (Table 8) show that the highest titer of positive serum remained positive even after a 1:800 dilution. This indicates that the indirect ELISA antibody detection method established in this study has high sensitivity.

[0049] Table 8 Sensitivity Tests for Indirect ELISA

[0050] 4. Compliance Rate Test Thirty-three positive serum samples and 39 negative serum samples, determined by the clinical bovine tuberculin (PPD) intradermal allergy test (based on GB / T 18645-2020 "Diagnostic Techniques for Animal Tuberculosis"), were used as test samples. The Lprl indirect ELISA method established in this invention and a commercially available kit were used for parallel detection, and the results of the two methods were compared and analyzed to evaluate the concordance rate of this method.

[0051] Table 9 shows a comparison of the positive and negative results of the commercial kit and the PPD test. The calculated overall concordance rate of the commercial kit is 88.89%, the true positive rate is 75.76%, and the true negative rate is 100%.

[0052] Table 10 shows a comparison of the positive and negative results of the ELISA method of this invention and the PPD detection. The calculation shows that the overall concordance rate of the ELISA detection method of this invention is 95.8%, the true positive rate is 90.9%, and the true negative rate is 100%, indicating that the established indirect ELISA antibody detection method has a high concordance rate with PPD and is superior to existing commercial kits.

[0053] Table 9 Comparison of commercial kits and PPD detection results

[0054] Table 10 Comparison of ELISA method and PPD detection results of the present invention

[0055] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An indirect ELISA method for detecting Mycobacterium bovis, characterized by, The method comprises the following steps: (a) coating an enzyme-labeled plate with a coating solution of Mycobacterium bovis antigens, incubating and then washing; the Mycobacterium bovis antigens are Lprl proteins with an amino acid sequence as shown in SEQ ID NO: 1; (b) blocking the coated enzyme-labeled plate with a blocking solution, incubating and then washing; (c) adding a serum sample to be tested as a primary antibody, incubating and then washing; (d) adding an enzyme-labeled secondary antibody, incubating and then washing; (e) adding a substrate for color development, then adding a stop solution to stop the reaction; (f) detecting the color development signal and determining the result according to the signal.

2. The indirect ELISA method according to claim 1, wherein In step (a), the coating concentration of the Lprl proteins is 20 μg / mL, and the coating condition is 4°C overnight for 16 h.

3. The indirect ELISA method according to claim 1, wherein In step (b), 5% skim milk is used as the blocking solution, and the blocking is performed at 37°C for 0.5 h.

4. The indirect ELISA method according to claim 1, wherein In step (c), the sample to be tested is serum diluted 1:50, and the incubation is performed at 37°C for 1.5 h.

5. The indirect ELISA method according to claim 1, wherein In step (d), the dilution of the enzyme-labeled secondary antibody is 1:6000, and the incubation is performed at 37°C for 1.5 h.

6. The indirect ELISA method according to claim 1, wherein Step (f) comprises the following steps: 1) Obtain OD by determining negative standards 450nm The mean X and standard deviation S are used to determine the positive and negative cutoff values ​​of the indirect ELISA method. The positive cutoff value includes a positive cutoff value and a negative cutoff value. The positive cutoff value is X+3S and the negative cutoff value is X+2S. 2) determining the sample to be tested, if the OD 450nm value of the sample to be tested is greater than or equal to the positive critical value, then the sample to be tested is determined to be positive; if the OD 450nm value of the sample to be tested is less than the positive critical value and greater than or equal to the negative critical value, then the sample to be tested is determined to be suspicious; if the OD 450nm value of the sample to be tested is less than the negative critical value, then the sample to be tested is determined to be negative.

7. An ELISA test kit for carrying out the method according to any one of claims 1 to 6, characterized in that The enzyme-labeled plate is coated with Lprl proteins with an amino acid sequence as shown in SEQ ID NO:

1.

8. The ELISA test kit as claimed in claim 7, wherein, The kit further comprises an enzyme-labeled secondary antibody, a blocking solution, a washing solution, a dilution solution, a positive control sample, a negative control sample, a color developing solution and a stop solution.

9. Use of Lprl proteins with an amino acid sequence as shown in SEQ ID NO: 1 as a detection target in the preparation of a kit for detecting or identifying Mycobacterium bovis.

Images