Genetically engineered bacterium for improving rate-limiting enzyme to promote xanthophyll synthesis and application of genetically engineered bacterium

Abstract

The invention discloses a genetically engineered bacterium for improving rate-limiting enzyme to promote xanthophyll synthesis and application of the genetically engineered bacterium, and belongs to the technical field of genetic engineering. According to the genetically engineered bacterium, a lycopene-producing strain is taken as a starting bacterium, and coding genes of a lycopene epsilon-cyclase mutant, lycopene beta-cyclase, a carotene beta-hydroxylase mutant and carotene epsilon-hydroxylase are extrinsic introduced; according to the invention, a lycopene epsilon-cyclase mutant with higher enzymatic activity and / or a carotene beta-hydroxylase mutant with higher enzymatic activity are / is utilized to improve the limitation of a rate-limiting enzyme in the lutein synthesis process, and further, the lutein synthesis route is subjected to compartment regulation and control; and the lycopene epsilon-cyclase and / or the lycopene beta-cyclase are / is positioned in the intracellular lipid droplets, so that the synthesis of the lutein is comprehensively enhanced.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a genetically engineered bacterium with a modified rate-limiting enzyme to promote lutein synthesis and its application. Background Technology

[0002] Lutein, chemically known as 3,3'-diol-α-carotene, also called plant lutein or marigold pigment, is a natural pigment synthesized in higher plants and algae. It is an important component of the macular pigment in the retina, a carotenoid that accumulates in specific sites in the body and functions as part of a system. Because the human body cannot synthesize it, it must be obtained through external intake.

[0003] Currently, lutein is mainly obtained through extraction from marigolds, mostly in the form of lutein esters. However, its natural content is low, and plant cultivation suffers from problems such as significant environmental and climatic influences, large land occupation, and high labor demands. Microbial fermentation refers to the process of using microorganisms to transform raw materials into products needed by humans through specific metabolic pathways under suitable conditions. Due to its advantages such as high controllability, high production efficiency, and environmental friendliness, it has become an important research direction to replace traditional agricultural extraction. Therefore, developing efficient microbial cell factories for lutein production is an important research topic in this field.

[0004] In previous studies, our research group successfully constructed a *Saccharomyces cerevisiae* strain capable of heterologously producing lutein using a three-stage dynamic regulation strategy, providing a new approach for microbial fermentation production of lutein. However, its lutein yield still lags behind that of other high-yielding carotenoids. Biotechnology and Bioengineering , 2023, 120(2): 536-552).

[0005] The production efficiency of microbial cell factories is directly affected by the catalytic activity and expression level of pathway enzymes. In the lutein biosynthesis pathway, lycopene cyclase and carotene hydroxylase have been identified as major flux control nodes. Studies have shown that lycopene ε-cyclase has significantly lower catalytic efficiency compared to lycopene β-cyclase, leading to a greater metabolic flux flowing to the β-carotene synthesis pathway. Plant-derived cytochrome P450 hydroxylases face multiple challenges during heterologous expression, such as poor protein stability and low catalytic efficiency. Metabolic Engineering ,2017, 40:165-175).

[0006] Therefore, how to improve the rate-limiting enzyme in the lutein biosynthesis pathway to remove the rate-limiting step and promote lutein synthesis is a technical problem that needs to be solved by those skilled in the art. Summary of the Invention

[0007] The purpose of this invention is to provide a strategy suitable for improving the rate-limiting enzyme in the lutein synthesis pathway and removing the rate-limiting step in lutein production by Saccharomyces cerevisiae, thereby solving the problem of low lutein yield.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides a genetically engineered bacterium that improves the rate-limiting enzyme in the lutein synthesis pathway. The genetically engineered bacterium is based on a lycopene-producing strain and is exogenously introduced with lycopene ε-cyclase gene, lycopene β-cyclase gene, carotene β-hydroxylase gene and carotene ε-hydroxylase gene. The lycopene ε-cyclase is obtained by mutating the wild-type lycopene ε-cyclase with the amino acid sequence shown in SEQ ID NO.1. The mutations are: at least one of the following: histidine at position 151 is mutated to arginine and glutamic acid at position 368 is mutated to valine; arginine at position 367 is mutated synonymously; valine at position 450 is mutated to alanine; or lysine at position 425 is mutated to arginine; or valine at position 37 is mutated to alanine; or isoleucine at position 306 is mutated synonymously; or lysine at position 206 is mutated to glutamic acid and valine at position 122 is mutated to alanine; or arginine at position 350 is mutated synonymously; or tyrosine at position 259 is mutated synonymously; or serine at position 10 is mutated synonymously; or lysine at position 292 is mutated to arginine. And / or, the carotene β-hydroxylase is obtained by mutating wild-type carotene β-hydroxylase with the amino acid sequence shown in SEQ ID NO.3, with the mutation being: methionine at position 347 is mutated to phenylalanine; or leucine at position 417 is mutated to isoleucine; or phenylalanine at position 439 is mutated to methionine; or threonine at position 531 is mutated to proline.

[0009] This invention uses lycopene-producing strains as the starting bacteria and introduces exogenous lycopene ε-cyclase, lycopene β-cyclase, carotene β-hydroxylase, and carotene ε-hydroxylase genes through biological techniques such as CRISPR-Cas9 gene editing to construct a lutein synthesis pathway. Specifically, lycopene ε-cyclase catalyzes the formation of an ε-ring at the end of the carbon skeleton of the substrate; lycopene β-cyclase catalyzes the formation of a β-ring at the end of the carbon skeleton of the substrate; carotene ε-hydroxylase hydroxylates the ε-ring of the substrate; and carotene β-hydroxylase hydroxylates the β-ring of the substrate. Lycopene synthesizes α-carotene through β-cyclization and ε-cyclization, and α-carotene synthesizes lutein through β-hydroxylation and ε-hydroxylation.

[0010] A key issue in lutein biosynthesis is the competitive utilization of intermediate metabolites: lycopene can be converted to α-carotene via the sequential catalysis of lycopene ε-cyclase and lycopene β-cyclase, or directly to β-carotene via a two-step catalysis of lycopene β-cyclase. When the catalytic efficiency of lycopene ε-cyclase is lower than that of lycopene β-cyclase, a greater metabolic flux will flow towards the β-carotene synthesis pathway. Therefore, to ensure a greater flow of precursors to the lutein synthesis pathway, it is necessary to enhance the catalytic activity of lycopene ε-cyclase.

[0011] This invention demonstrates that mutants obtained by mutating lycopene ε-cyclase at specific locations through directed evolution exhibit higher enzyme activity compared to wild-type cyclase, reducing the flow of precursors to competing pathways and allowing more precursors to be directed towards lutein synthesis.

[0012] Specifically, the mutation sites are: histidine at position 151 mutated to arginine and glutamic acid at position 368 mutated to valine; or a synonymous mutation of arginine at position 367; or valine at position 450 mutated to alanine; or lysine at position 425 mutated to arginine; or valine at position 37 mutated to alanine; or isoleucine at position 306 mutated to arginine; or lysine at position 206 mutated to glutamic acid and valine at position 122 mutated to alanine; or arginine at position 350 mutated to arginine; or tyrosine at position 259 mutated to tyrosine; or serine at position 10 mutated to arginine; or lysine at position 292 mutated to arginine. A synonymous mutation means that the mutated codon still corresponds to the original amino acid.

[0013] The present invention also provides mutants composed of the above-mentioned mutation combinations. Preferably, the combination mutation is such that histidine at position 151 is mutated to arginine, glutamic acid at position 368 is mutated to valine, and valine at position 450 is mutated to alanine.

[0014] In addition, the biosynthesis of lutein faces the problem of insufficient α-carotene hydroxylation efficiency. Previous studies constructed recombinant yeast strains that produce lutein by exogenously introducing phytoene synthase, phytoene dehydrogenase, wild-type lycopene ε-cyclase, lycopene β-cyclase, carotene β-hydroxylase, and carotene ε-hydroxylase genes. Research showed that compared to other high-yielding carotenoid engineered strains, this recombinant strain had relatively low lutein production, and there was a significant accumulation of α-carotene, the substrate catalyzed by carotene β-hydroxylase. Furthermore, carotene β-hydroxylase, as a P450, was poorly expressed in the heterologous host. Therefore, it is necessary to improve the catalytic activity of carotene β-hydroxylase.

[0015] The present invention demonstrates that mutants obtained by mutation at a specific position of carotene β-hydroxylase exhibit higher enzyme activity than wild-type carotene β-hydroxylase, thereby enhancing the conversion of intermediate products into lutein.

[0016] Specifically, the mutations are: methionine at position 347 is mutated to phenylalanine; or leucine at position 417 is mutated to isoleucine; or phenylalanine at position 439 is mutated to methionine; or threonine at position 531 is mutated to proline.

[0017] In this invention, the starting bacteria are microorganisms known in the art that synthesize lycopene, including bacteria and fungi. The coding sequence is optimized based on the codon preferences of the host cell.

[0018] Preferably, the starting strain is an engineered strain constructed by exogenously introducing truncated HMG-CoA reductase genes, gerany-gerany pyrophosphate synthase genes, phytoene synthase genes, and phytoene dehydrogenase genes into yeast. HMG-CoA reductase is a key rate-limiting enzyme in the MVA pathway. Gerany-gerany pyrophosphate synthase catalyzes the conversion of FPP to GGPP, phytoene synthase catalyzes the conversion of GGPP to phytoene, and phytoene dehydrogenase catalyzes the conversion of phytoene to lycopene.

[0019] Specifically, the nucleotide sequence of the truncated HMG-CoA reductase gene is shown in SEQ ID NO.5; the nucleotide sequence of the geraniol pyrophosphate synthase gene is shown in SEQ ID NO.6; the nucleotide sequence of the phytoene synthase gene is shown in SEQ ID NO.7; and the nucleotide sequence of the phytoene dehydrogenase gene is shown in SEQ ID NO.8.

[0020] In one specific embodiment of the present invention, the starting strain is a lycopene-producing Saccharomyces cerevisiae engineered strain YCF01, YTB01, or YTL-E0.

[0021] Specifically, the nucleotide sequence of the wild-type lycopene ε-cyclase gene is shown in SEQ ID NO.2; the sequence information of the lycopene β-cyclase gene can be found in NCBI's GenBank: AY177204; the sequence of the wild-type carotene β-hydroxylase gene is shown in SEQ ID NO.4; and the sequence information of the carotene ε-hydroxylase gene can be found in NCBI's GenBank: NP_190881.2.

[0022] In one specific embodiment of the present invention, when the starting strain is yeast, the synonymous mutations of the lycopene ε-cyclase mutant encoding gene are as follows: the arginine at position 367 is mutated to codon AGA; the isoleucine at position 306 is mutated to codon ATC; the arginine at position 350 is mutated to codon AGA; the tyrosine at position 259 is mutated to codon TAC; and the serine at position 10 is mutated to codon TCG. The lycopene ε-cyclase encoded by the above synonymous mutations exhibits higher enzyme activity.

[0023] Furthermore, this invention provides compartmentalized regulation of the lutein synthesis pathway by localizing lycopene ε-cyclase and / or lycopene β-cyclase within intracellular lipid droplets. This shortens the distance between the substrate and its catalytic converting enzymes and concentrates the products within hydrophobic organelles, reducing the toxicity of the products to the cells. Studies have shown that localizing lycopene ε-cyclase and / or lycopene β-cyclase within intracellular lipid droplets can increase lutein production.

[0024] Preferably, the genetically engineered bacteria integrate two copies of the lycopene ε-cyclase gene, one copy having an intracellular lipid droplet localization sequence inserted at its 5′ end, and the other copy having a cell membrane localization sequence inserted at its 5′ end.

[0025] Preferably, the 5′ end of the lycopene β-cyclase gene contains an intracellular lipid droplet localization sequence.

[0026] Preferably, the intracellular lipid droplet localization sequence uses the Pet10 sequence, with the nucleotide sequence shown in SEQ ID NO.9. The cell membrane localization sequence uses PM... SeV-C The sequence, the nucleotide sequence is shown in SEQ ID NO.10.

[0027] Preferably, the genetically engineered bacteria integrate three copies of carotene β-hydroxylase.

[0028] Preferably, the genetically engineered bacteria also integrate the ferredoxin 3 encoding gene and the root-type ferredoxin: NADP(H) oxidoreductase encoding gene. Both act as reductases of P450s, participating in electron transfer during P450 catalysis.

[0029] Another object of the present invention is to provide the application of the genetically engineered bacteria in the production of lutein. The application includes: inoculating the genetically engineered bacteria into YPD medium for fermentation, and then extracting lutein from the fermentation products.

[0030] The beneficial effects of this invention are as follows: (1) Compared with wild-type lycopene ε-cyclase, the lycopene ε-cyclase mutant provided by the present invention has higher enzyme activity, reduces the flow of precursors to competing pathways, and allows more precursors to flow to synthesize lutein. Compared with wild-type carotene β-hydroxylase, the carotene β-hydroxylase mutant provided by the present invention has higher enzyme activity, and enhances the conversion of intermediate products to lutein.

[0031] (2) The present invention uses a lycopene ε-cyclase mutant with higher enzyme activity and / or a carotene β-hydroxylase mutant with higher enzyme activity to improve the rate-limiting enzyme restriction in the lutein synthesis process, and then compartmentalizes the lutein synthesis pathway to locate lycopene ε-cyclase and / or lycopene β-cyclase in intracellular lipid droplets, thereby comprehensively enhancing the synthesis of lutein. Attached Figure Description

[0032] Figure 1 This is a conceptual diagram of a rate-limiting enzyme restriction strategy suitable for improving the production of lutein by Saccharomyces cerevisiae.

[0033] Figure 2 pUMRI-P CYC1 -Schematic diagram of the structure of the Lut2 plasmid.

[0034] Figure 3 Characterization diagram of a single-point cyclase mutant.

[0035] Figure 4 Characterization diagram of a single-point combination cyclase mutant.

[0036] Figure 5 The figure shows the liquid chromatography analysis results for the optimal mutant integrated into the lutein synthesis pathway.

[0037] Figure 6 This is a schematic diagram of the structure of the pUMRI-10-LUT1-97A3 plasmid.

[0038] Figure 7 Characterization diagram of carotene β-hydroxylase mutant.

[0039] Figure 8 This is a diagram showing the compartmentalization regulation of the lutein synthesis pathway. In the diagram, A is a schematic diagram of the compartmentalization localization concept of cyclases, and B is a liquid chromatography analysis result of the compartmentalization localization of cyclases.

[0040] Figure 9 The figure shows the results of liquid chromatography analysis for compartmentalized localization of lycopene β-cyclase. Detailed Implementation

[0041] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0043] The primers used in the following examples were synthesized by Beijing Qingke Biotechnology Co., Ltd. The PCR reaction kit was purchased from Dalian Baosheng Biotechnology Co., Ltd. The PCR purification kit was purchased from Suzhou Yuheng Biotechnology Co., Ltd. The TOROIVD One Step Fusion CloningMix was purchased from Toyobo.

[0044] The pUMRI backbone used in the following examples is a publicly available material, and its construction method can be found in the literature (Construction of lycopene-overproducing). Saccharomyces cerevisiae by combining directed evolution and metabolic engineering. Metabolic Engineering , 2015, 30:69-78).

[0045] The plasmids constructed in the following examples used the pUMRI-Ty4-PT-PM backbone. SeV-C - At - LCYE, plasmid pUMRI-P GAL1 -CrtYB, pUMRI-10-LUT1-97A3, plasmid pUMRI-22-RFNR1-FD3; the lycopene-producing Saccharomyces cerevisiae engineered strains YCF01 and YTB01 are publicly available materials, and their construction methods can be found in the literature (Heterologous biosynthesis of lutein in...). S. cerevisiae enabled by temporospatial pathway control. Metabolic Engineering , 2021, 67:19-28).

[0046] The construction method of the engineered Saccharomyces cerevisiae strain YTL-E0 can be found in the literature (Hierarchical dynamic regulation of...). Saccharomyces cerevisiae for enhanced lutein biosynthesis. Biotechnology and Bioengineering 2023, 120, 536–552.). The YTL-E0 strain is capable of producing lycopene, and its genome integrates all genes involved in lutein synthesis except for lycopene ε-cyclase.

[0047] In the examples below, the nucleotide sequences are from the 5' end to the 3' end from left to right.

[0048] Example 1: Construction of engineered bacteria capable of expressing various cyclase mutants 1. Constructing engineered bacteria expressing the lycopene α-cyclase mutant Lut2Ms (a) pUMRI-P CYC1 -Lut2 plasmid (see...) Figure 2 Using the PCR template, a point mutation kit and the primers listed in Table 1 were used to construct the mutant plasmid, including error-prone PCR and DpnI digestion of the template. Alternatively, the mutant plasmid could be used as a template to construct the mutant plasmid using a point mutation kit, resulting in plasmid pUMRI-P. CYC1 -Lut2Ms mutant library.

[0049] Constructing pUMRI-P CYC1 The primers required for the Lut2Ms mutant library are as follows: Lut2M1-F1: CTAGGAGATTGTTACGTGAAGAATTATTGAGGAG; Lut2M1-R1:CTTCACGTAACAATCTCCTAGAAAACTC; Lut2M1-F2:GAGGGTAGAAACTACTAAACAAATTAATTC; Lut2M1-R2: GTTTAGTAGTTTCTACCCTCAAAATTTCAGC; Lut2M2-F: TGCTGAAATTTTGAGAGAAGAAAACTAC; Lut2M2-R: CTTCTCTCAAAATTTCAGCAATAACAGATGC; Lut2M3-F: GTTTGCTATTTCACCAAAATAATTTAAGG; Lut2M3-R:ATTTGGTGAAATAGCAAACATATACAATGC; Lut2M4-F: TTAGATTACCTAGATGGATGTGGCAAGGTT; Lut2M4-R: TGCCACATCCATCTAGGTAATCTAAAAAAAT; Lut2M5-F: AATTTTATTTGCTCAAATGCAACAAAATAA; Lut2M5-R:GTTGCATTTGAGCAAATAAAATTTCAGAAC; Lut2M6-F:GGGTATTAGGATCTTAAAAACATACGAAGAA; Lut2M6-R:TATGTTTTTAAGATCCTAATACCCAAAGTA; Lut2M7-F1:TTGAACATGCTTGGAGGGAAACTATTGTTT; Lut2M7-R1: TCCCTCCAAGCATGTTCAATACATTTTTGT; Lut2M7-F2: AGCATCAGGTGAATTATTGCAATATGAAGT; Lut2M7-R2: GCAATAATTCACCTGATGCTGCACCTGAAG; Lut2M8-F:TTGTTAGACATTGTCAGAAGCACCTAAAT; Lut2M8-R:GACAATGTCTAACAACTGAATAACCTGTT; Lut2M9-F: TGGAAGCAGAATACCCAACTTTTTTGTATG; Lut2M9-R:AAAAAAGTTGGGTATTCTGCTTCCAATGAT; Lut2M10-F: TTCAGGTTCGAATCTTGTGTTGCAGTTAG; Lut2M10-R:ACAAGATTCCGAACCTGAAGAACCACCACC; Lut2M11-F:ATTTATTGAGAACTAAATTAATGTTAAGGT; Lut2M11-R: AATTTAGTTCTCAATAAATCAAATGGCATA.

[0050] Specifically, the amino acid sequence of wild-type lycopene α-cyclase is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.2.

[0051] Based on this, the histidine (H) at position 151 was mutated to arginine (R), i.e., the codon changed from CAT to CGT; the glutamic acid (E) at position 368 was mutated to valine (V), i.e., the codon changed from GAA to GTA, resulting in mutant Lut2M1; the arginine (R) at position 367 was mutated synonymously, i.e., the codon changed from AGG to AGA, resulting in mutant Lut2M2; the valine (V) at position 450 was mutated to alanine (A), i.e., the codon changed from GTT to GCT, resulting in mutant Lut2M3; the lysine (K) at position 425 was mutated to arginine (R), i.e., the codon changed from AAA to AGA, resulting in mutant Lut2M4; the valine (V) at position 37 was mutated to alanine (A), i.e., the codon changed from GTT to GCT, resulting in mutant Lut2M5; and the isoleucine (I) at position 306 was mutated... Synonymous mutations, i.e., the codon is changed from ATT to ATC, yielding mutant Lut2M6; mutating lysine (K) at position 206 to glutamic acid (E), i.e., the codon is changed from AAA to GAA; mutating valine (V) at position 122 to alanine (A), i.e., the codon is changed from GTT to GCT, yielding mutant Lut2M7; synonymous mutation of arginine (R) at position 350, i.e., the codon is changed from AGG to AGA, yielding mutant Lut2M8; synonymous mutation of tyrosine (Y) at position 259, i.e., the codon is changed from TAT to TAC, yielding mutant Lut2M9; synonymous mutation of serine (S) at position 10, i.e., the codon is changed from TCA to TCG, yielding mutant Lut2M10; mutating lysine (K) at position 292 to arginine (R), i.e., the codon is changed from AAA to AGA, yielding mutant Lut2M11.

[0052] The amino acid sequences of the mutants were compared, and molecular docking was used to infer that the amino acid regions of the active pocket were Gly115, Gly117, and Pro118.

[0053] (b) Using the plasmid carrying the cyclase mutant obtained in step a as a template, high-fidelity PCR was performed to obtain the lycopene α-cyclase mutant expression cassette. The primers required for constructing the cyclase mutant expression cassette are as follows: Lut2-F:ATAGAAAAAATATGATATGAATGAATATTCCACTTTCTTTGGATCCAGTTCATTTGGCG; Lut2-R:TGAGAAGTTGTTCTGAACAAAGTAAAAAAAAGAAGTATAACCTTCGAGCGTCCCAAAACC; ypl062w-Lut2-F:GAATATTTAGGCCGAATGGAATTATTCGTAACGTCATACGCGGATTAGAAGCCGCCGAG; ypl062w-Lut2-R:ATATGCAACAATGACGTCTCGGTGCTGGCCATGCCCCTCACTTCGAGCGTCCCAAAACC; Gal7101-Lut2-F:AGGACCACTCTTACATAACTAGAATAGCATTAAGAATCAGCGGATTAGAAGCCGCCGAG; Gal7101-Lut2-R:GGCAACTTGCCAAGAACTTCGCAAATGACTTTGACATATGCTTCGAGCGTCCCAAAACC.

[0054] Primer ypl062w-Lut2-F / R was used to obtain the lycopene α-cyclase mutant expression cassette integrated at the ypl062w site, primer Gal7101-Lut2-F / R was used to obtain the lycopene α-cyclase mutant expression cassette integrated at the Gal7101 site, and Lut2-F / R was used as a verification primer to confirm whether the cyclase mutant expression cassette was integrated into the yeast genome.

[0055] (c) Transform the replacement fragment from step b, along with the corresponding guide RNA plasmid and the Cas9 plasmid, into Saccharomyces cerevisiae cells YCF01 (BY4741). , Δ lpp1 ::P TEF1 - tHMG1 -T CYC1 , Δ ho ::P PGK1 - CrtE03M -T ADH1 , Δ gal80 ::P PGK1 - CrtYB11M -T ADH1 , Δ dpp1 ::P TEF1 - CrtI -T CYC1 The fragments were spread onto amino acid-deficient SD plates. Using CRISPR-Cas9 gene editing technology, the target fragments were integrated into the ypl062w and Gal7101 sites of *Saccharomyces cerevisiae* cells YCF01. PCR was used to verify the correct integration.

[0056] (d) Pick a single colony of the engineered bacteria from the streaked plate and inoculate it into 5 mL of YPD medium and incubate for about 16 hours. Then, inoculate the strain into 50 mL of YPD liquid medium to allow the initial OD to reach the desired level. 600nm The concentration was 0.05. Fermentation was carried out in a constant temperature shaker at 220 rpm and 30℃ for 30 h, and then the temperature was increased to 24℃ and cultured for another 66 h.

[0057] Collect 0.2 mL of yeast fermentation broth into a 2 mL centrifuge tube, centrifuge at 12000 rpm for 2 min, discard the supernatant, then wash twice with 1 mL of distilled water, centrifuge again and discard the supernatant. Add approximately 0.5 mL of grinding beads (half 0.1 mm and half 0.5 mm zirconia beads) to the centrifuge tube, and add 200 μL of acetone to resuspend the bacterial cells. Place the centrifuge tube containing the beads and bacterial cells in an automated sample homogenizer and homogenize at 65 Hz for 5 min. After homogenization, add 800 μL of acetone to the centrifuge tube, mix thoroughly, and sonicate for 5 min. After sonication, place the centrifuge tube in a 4℃ centrifuge at 12000 rpm for 2 min, and collect the supernatant into a new 2 mL centrifuge tube. Filter the extract through a 0.22 μm organic filter for HPLC analysis.

[0058] The following conditions were used to detect various carotenoids and their contents in engineered strains of Saccharomyces cerevisiae by HPLC.

[0059] Analysis was performed using a Shimadzu LC-20AT high-performance liquid chromatography (HPLC) column with a YMC30 column. The column temperature was 40℃, the measurement wavelength was 450 nm, and the flow rate was 1 mL / min. Gradient elution was used, with the mobile phase consisting of acetonitrile and methanol (75:25) in pump A and methyl tert-butyl ether (MTBE) in pump B. Specific conditions were as follows: 0-10 min, mobile phase in pump B increased from 0% to 5%; 10-19 min, mobile phase in pump B increased from 5% to 14%; 19-29 min, mobile phase in pump B increased from 14% to 25%; 29-54 min, mobile phase in pump B increased from 25% to 50%; 54-66 min, mobile phase in pump B increased from 50% to 74%; 66.1 min, pump B returned to 0%.

[0060] HPLC analysis results are as follows Figure 3As shown, compared to the wild-type cyclase, the δ-carotene / lycopene ratio was increased under the catalysis of mutants Lut2M1, Lut2M2, Lut2M3, Lut2M4, Lut2M5, Lut2M6, Lut2M7, Lut2M8, Lut2M9, Lut2M10, and Lut2M11, demonstrating that the catalytic activities of mutants Lut2M1, Lut2M2, Lut2M3, Lut2M4, Lut2M5, Lut2M6, Lut2M7, Lut2M8, Lut2M9, Lut2M10, and Lut2M11 were all higher than those of the wild-type cyclase. Among them, the preferred mutants are Lut2M1, Lut2M2, and Lut2M3, and the more preferred mutant Lut2M1 has a catalytic efficiency that is 4 times that of the wild-type cyclase.

[0061] 2. Combinatorial mutation The preferred mutation sites V450A, R367R, H151R, and E368V were combined, and the combination method is described in [reference needed]. Figure 4 The method follows steps (a)-(d) above. Using the corresponding mutant plasmid as a template, the mutant plasmid is constructed using a point mutation kit and the primers in step (a), and then integrated into the Saccharomyces cerevisiae cells YCF01 to obtain the correctly integrated strain. After fermentation culture, the fermentation broth is analyzed by HPLC.

[0062] HPLC analysis results are as follows Figure 4 As shown, the new lycopene α-cyclase mutants still have higher activity than the wild-type cyclase. Among them, the mutant with the highest activity is V450A / H151R / E368V.

[0063] 3. The mutant integrates into the lutein synthesis pathway. Constructing the engineered strain of Saccharomyces cerevisiae YSMZ-01 (YTL-E0, Δgal80 ::UAS-P GAL1 - CYP97A3 -T CYC1 , Δ ho ::UAS-P GAL1 - CYP97A3 -T CYC1 In YTL-E0 single copy CYP97A3 Import two more copies on top of that. CYP97A3 It helps increase lutein production.

[0064] Wild-type lycopene α-cyclase and mutants Lut2M1, Lut2M2, and Lut2M3 were integrated into the lutein synthesis pathway. Specifically, using the plasmid carrying the lycopene α-cyclase mutant obtained above as a template, high-fidelity PCR was performed using the primers in step (b) to obtain the lycopene α-cyclase mutant expression cassette. The replacement fragment, along with the corresponding guide RNA plasmid and Cas9 plasmid, was transformed into Saccharomyces cerevisiae cells YSMZ-01. The target fragment was integrated into the ypl062w and Gal7101 sites of Saccharomyces cerevisiae cells YSMZ-01 using CRISPR Cas9 gene editing technology and plated on amino acid-deficient SD plates. PCR was used to verify that the correctly integrated strain was obtained.

[0065] After fermentation culture, the fermentation broth was analyzed by HPLC. The HPLC analysis results are as follows: Figure 5 As shown, the introduction of mutants Lut2M1 and Lut2M3 increased the α-carotene / β-carotene ratio, indicating that compared with wild lycopene α-cyclase, the cyclase mutants Lut2M1 and Lut2M3 indeed directed more precursors to the synthesis of the lutein pathway, which meets the requirements of this experiment.

[0066] Example 2: Construction of engineered bacteria capable of expressing various carotenoid β-hydroxylase mutants (a) Using pUMRI-10-LUT1-97A3 plasmid (see...) Figure 6 Using a template, a point mutation kit was used to construct the mutant plasmid, including error-prone PCR and DpnI digestion of the template, to obtain the plasmid pUMRI-P. GAL1 -CYP97Ms mutant library. Construction of pUMRI-P GAL1 The primers required for the CYP97Ms mutant library are as follows: 344-Ile-F: AATTGAGGGATGATATTATGACTATGTTGATTGCTGGTC; 344-Ile-R:ATCAACATAGTCATAATATCATCCCTCAATTGTTTAGAA; 347-Phe-F:ATGATTTAATGACTTTTTTGATTGCTGGTCATGAAACAT; 347-Phe-R:TGACCAGCAATCAAAAAAGTCATTAAATCATCCCTCAAT; 414-Val-F: GGTTGTATCCACAAGTTCCTGTTTTGATTAGGAGGTCTA; 414-Val-R:CTAATCAAAACAGGAACTTGTGGATACAACCTCAATGAT; 348-Met-F:ATTTAATGACTATGATGATTGCTGGTCATGAAACATCGG; 348-Met-R:TCATGACCAGCAATCATCATAGTCATTAAATCATCCCTC; 349-Phe-F:TAATGACTATGTTGTTTGCTGGTCATGAAACATCGGCGG; 349-Phe-R:GTTTCATGACCAGCAAACAACATAGTCATTAAATCATCC; 414-Ala-F:GGTTGTATCCACACACTCCTGTTTTGATTAGGAGGTCTA; 414-Ala-R:CTAATCAAAACAGGAGCTTGTGGATACAACCTCAATGAT; 416-Leu-F:ATCCACAACCACCTTGGTTGATTAGGAGGTCTATTGATA; 416-Leu-R:GACCTCCTAATCAACCAAGGTGGTTGTGGATACAACCTC; 417-Ile-F:CACAACCACCTGTTATTATTAGGAGGTCTATTGATAATG; 417-Ile-R:ATAGACCTCCTAATAATAACAGGTGGTTGTGGATACAAC; 418-Pro-F:AACCACCTGTTTTGCCAAGGAGGTCTATTGATAATGATA; 418-Pro-R:TCAATAGACCTCCTTGGCAAAACAGGTGGTTGTGGATAC; 439-Met-F:GGGGTGAAGATATTATGATTTCTGTTTGGAATTTACATA; 439-Mrt-R:TTCCAAACAGAATCATAATATCTTCACCCCTTTTTATT; 531-Pro-F:GTGCAACTATTCATCCAACAGAAGGTTTAAAATTAACTG; 531-Pro-R: TTTAAACCTTCTTGTTGGATGAATAGTTGCACCTGTTGTC.

[0067] Specifically, the amino acid sequence of wild-type carotene β-hydroxylase is shown in SEQ ID NO.3, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.4.

[0068] Based on this, point mutations were performed: leucine (L) at position 344 was mutated to isoleucine (I), i.e., the codon changed from TTA to ATT, resulting in mutant L344I; methionine (M) at position 347 was mutated to phenylalanine (F), i.e., the codon changed from ATG to TTT, resulting in mutant M347F; proline (P) at position 414 was mutated to valine (V), i.e., the codon changed from CCA to GTT, resulting in mutant P414V; leucine (L) at position 348 was mutated to methionine (M), i.e., the codon changed from TTG to ATG, resulting in mutant L348M; isoleucine (I) at position 349 was mutated to phenylalanine (F), i.e., the codon changed from ATT to TTT, resulting in mutant I349F; and proline (P) at position 414 was mutated to... The mutant P414A was obtained by mutating alanine (A) from codon CCA to codon GCT; the mutant V416L was obtained by mutating valine (V) at position 416 to leucine (L) from codon GTT to codon TGG; the mutant L417I was obtained by mutating leucine (L) at position 417 to isoleucine (I) from codon TTG to codon ATT; the mutant I418P was obtained by mutating isoleucine (I) at position 418 to proline (P) from codon ATT to codon CCA; the mutant F439M was obtained by mutating phenylalanine (F) at position 439 to methionine (M) from codon TTT to codon ATG; and the mutant T531P was obtained by mutating threonine (T) at position 531 to proline (P) from codon ACT to codon CCA.

[0069] Comparative analysis of the amino acid sequences of the above mutants revealed that the core functional regions were Ile176, Leu177, Ile180, Leu181, Ile292, Val443, Ile445, and Phe466, while the amino acid residues near the catalytic active site were Pro441, Ala377, Gly378, Thr381, Leu444, Ala554, and Thr555.

[0070] (b) Using the plasmid carrying the carotene β-hydroxylase mutant obtained in step a as a template, high-fidelity PCR was performed to obtain the carotene β-hydroxylase mutant expression cassette. The primers required for constructing the carotene β-hydroxylase mutant expression cassette are as follows: 911b-Lut1-CYP97A3-F:ACAATAAGGACATTTTCTTGGTGACAGATTCGTTAAGTTTCCTGAATTGGAGCGACCTCA; 911b-Lut1-CYP97A3-R: CCTTCACCCTCATCAATAATTTTCAATTCGTCGTTTCACCCTTCGAGCGTCCCAAAACC.

[0071] Primer 911b-Lut1-CYP97A3-F / R was used to obtain expression cassettes of carotene ε-hydroxylase and carotene β-hydroxylase mutants integrated into the 911b site. (c) The replacement fragment from step b, along with the corresponding guide RNA plasmid and Cas9 plasmid, was chemically transformed into *Saccharomyces cerevisiae* cells YSMZ-02 and plated on amino acid-deficient SD plates. The target fragment was then integrated into the 911b site of *Saccharomyces cerevisiae* cells YSMZ-02 using CRISPR Cas9 gene editing technology. PCR was used to verify the correct integration of the strain.

[0072] The construction method of YSMZ-02 is as follows: Based on strain YTB01 (which, compared to YCF01, also incorporates the CrtYB gene), P is integrated at the ypl062w and gal7101 sites. TEF1 -PM SeV-C -Lut2M3 expression cassette (see Example 3), integrating T at the rox1 site PGK1 -FD3-P GAL2 -P GAL7 -RFNR1-T TPS1 Expression cassette (cloned from plasmid pUMRI-22-RFNR1-FD3, where FD3 encodes ferroredoxin 3 and RFNR1 encodes root-type ferroredoxin: NADP(H) oxidoreductase).

[0073] (d) The yeast obtained in step c was cultured in YPD according to the method of Example 1 and the product was detected by HPLC.

[0074] The results are as follows Figure 7As shown, compared with wild-type carotene β-hydroxylase, the production of lutein was increased under the catalysis of mutants M347F, L417I, F439M, and T531P, proving that the activity of the obtained carotene β-hydroxylase mutants was indeed improved, which meets the requirements of this experiment.

[0075] Example 3: Construction of engineered bacteria for compartmentalized lutein production This embodiment fuses a lipid droplet-localizing peptide with lycopene α-cyclase, allowing the lycopene α-cyclase to be localized within lipid droplets, which helps improve the utilization of lutein precursors. Furthermore, the lipid droplet-localizing peptide is fused with lycopene β-cyclase, allowing the lycopene β-cyclase to be localized within lipid droplets, which facilitates the accumulation of precursors within the lipid droplets. The method for constructing the engineered bacteria for compartmentalized lutein production is as follows: (a) Construction of plasmid pUMRI-P TEF1 -Pet10-Lut2M3 and pUMRI-P GAL1 -Pet10-CrtYB Using the Saccharomyces cerevisiae genome as a template, the lipid droplet localization peptide Pet10 sequence fragment (nucleotide sequence shown in SEQ ID NO. 9) was obtained by PCR amplification. Then, common molecular cloning techniques such as Gibosn were used to insert pUMRI-P... TEF1 -Upstream of Lut2M3 in the Lut2M3 plasmid and pUMRI-P GAL1 -Upstream of CrtYB in the CrtYB plasmid, the plasmid pUMRI-P was obtained. TEF1 -Pet10-Lut2M3 and pUMRI-P GAL1 -Pet10-CrtYB.

[0076] pUMRI-Ty4-PT-PM SeV-C - At - LCYE Using PM as a template, cell membrane localization sequences were obtained by PCR amplification. SeV-C The sequence fragment (nucleotide sequence as shown in SEQ ID NO. 10) was then used to perform PM cloning using common molecular cloning techniques such as Gibosn. SeV-C Add pUMRI-P sequence TEF1 -The upstream of the Lut2M3 plasmid yielded the pUMRI-P plasmid. TEF1 -PM SeV-C -Lut2M3.

[0077] (b) Using the pUMRI-P obtained in step a TEF1 -PM SeV-C -Lut2M3, pUMRI-P TEF1-Pet10-Lut2M3 and pUMRI-P GAL1 Using the -Pet10-CrtYB plasmid as a template, high-fidelity PCR was performed to obtain P. TEF1 -PM SeV-C -Lut2M3、P TEF1 -Pet10-Lut2M3 and P GAL1 -Pet10-CrtYB expression cassette. Required primers are as follows: Gal7101-Lut2-F:AGGACCACTCTTACATAACTAGAATAGCATTAAGAATCAGCGGATTAGAAGCCGCCGAG; Gal7101-Lut2-R:GGCAACTTGCCAAGAACTTCGCAAATGACTTTGACATATGCTTCGAGCGTCCCAAAACC; Pet10-YB-F:ATGAACTCTAAGCTAGTGAGGCCCACTGTAAACAGCCATTCGGATTAGAAGCCGCCGAG; Pet10-YB-R: TATAGATCAGATGGATCTGGTAATATGCGAGAGCCGTCAT.

[0078] (c) P in step b TEF1 -PM SeV-C -Lut2M3、P TEF1 -Pet10-Lut2M3 or P GAL1 The -Pet10-CrtYB expression cassette, along with the corresponding guide RNA plasmid and Cas9 plasmid, was chemically transformed into *Saccharomyces cerevisiae* cells YSMZ-01 and plated on amino acid-deficient SD plates. The target fragment was then integrated into the corresponding site in the genome using CRISPR Cas9 gene editing technology. PCR verification confirmed the correct integration of the strain.

[0079] Specifically, P TEF1 -PM SeV-C -Lut2M3 was inserted into the ypl062w and gal7101 sites, respectively, and the resulting strain was named YSE-03 (YSMZ-01). Δypl062w ::P TEF1 -PM SeV-C -LUT2-V450A-T CYC1 , Δgal1-7 ::P TEF1 -PM SeV-C -LUT2-V450A-T CYC1 ).

[0080] P TEF1 -Pet10-Lut2M3 is inserted at the ypl062w site, P TEF1 -PM SeV-C -Lut2M3 was inserted into the gal7101 site, and the resulting strain was named YSL-28 (YSMZ-01, Δypl062w ::P TEF1 -PET10- LUT2 -V450A-T CYC1 , Δgal1- 7 ::P TEF1 -PM SeV-C - LUT2 -V450A-T CYC1 ).

[0081] P TEF1 -Pet10-Lut2M3 is inserted at the ypl062w site, P TEF1 The -Pet10-Lut2M3 was inserted into the gal7101 site, and the resulting strain was named YSL-29 (YSMZ-01). Δypl062w ::P TEF1 -PET10- LUT2 -V450A-T CYC1 , Δgal1-7 ::P TEF1 -PET10- LUT2 -V450A-T CYC1 ).

[0082] P GAL1 -Pet10-CrtYB is inserted into the int14 site of YSL-28, replacing the original insertion at that site. CrtYB Replacing it with Pet10-CrtYB, the resulting strain was named YSL-30 (YSL-28, Δint14 ::P GAL1 - PET10 - CrtYB -T CYC1 ), P GAL1 -Pet10-CrtYB was inserted into the int18 site of YSL-28, and the resulting strain was named YSL-31 (YSL-28, Δ int18 ::P GAL1 - PET10 - CrtYB -T CYC1 ).

[0083] (d) The yeast obtained in step c was cultured in YPD according to the method of Example 1 and the product was detected by HPLC.

[0084] The results are as follows Figure 8 As shown, localizing a single copy of the cyclase mutant Lut2M3 into intracellular lipid droplets increased lutein production by 72.3%.

[0085] The results are as follows Figure 9 As shown, directing CrtYB to lipid droplets increased lutein production by 18.7%. This demonstrates that compartmentalized regulation of the enzymes involved in lutein synthesis is beneficial for lutein production, which meets the requirements of this experiment.

[0086] The above experimental results indicate that introducing a lycopene α-cyclase mutant into the lutein synthesis pathway is beneficial for the flow of precursors into the lutein synthesis pathway; introducing a carotene β-hydroxylase mutant into the lutein synthesis pathway and compartmentalizing the enzymes involved in lutein synthesis are both beneficial for lutein synthesis; and integrating the above strategies also promotes lutein synthesis.

[0087] The above description is merely a specific embodiment of the present invention, intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly, and should not be construed as limiting the scope of protection of the present invention. All equivalent modifications or substitutions made based on the essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A genetically engineered bacterium that modifies the rate-limiting enzyme in the lutein synthesis pathway, wherein the genetically engineered bacterium is based on a lycopene-producing strain, and exogenously introduced with lycopene ε-cyclase gene, lycopene β-cyclase gene, carotene β-hydroxylase gene, and carotene ε-hydroxylase gene, characterized in that, The lycopene ε-cyclase is obtained by mutating the wild-type lycopene ε-cyclase with the amino acid sequence shown in SEQ ID NO.

1. The mutations are: at least one of the following: histidine at position 151 is mutated to arginine and glutamic acid at position 368 is mutated to valine; arginine at position 367 is mutated to alanine; valine at position 450 is mutated to alanine; or lysine at position 425 is mutated to arginine; or valine at position 37 is mutated to alanine; or isoleucine at position 306 is mutated to glutamic acid and valine at position 122 is mutated to alanine; or arginine at position 350 is mutated to alanine; or tyrosine at position 259 is mutated to alanine; or serine at position 10 is mutated to alanine; or lysine at position 292 is mutated to arginine. And / or the carotene β-hydroxylase is obtained by mutating the wild-type carotene β-hydroxylase with the amino acid sequence shown in SEQ ID NO.3, with the mutation being: methionine at position 347 is mutated to phenylalanine; or leucine at position 417 is mutated to isoleucine; or phenylalanine at position 439 is mutated to methionine; or threonine at position 531 is mutated to proline.

2. The genetically engineered bacterium with the modified rate-limiting enzyme in the lutein synthesis pathway as described in claim 1, characterized in that, The starting strain is an engineered strain obtained by exogenously introducing truncated HMG-CoA reductase gene, gerany-gerany pyrophosphate synthase gene, phytoene synthase gene, and phytoene dehydrogenase gene into yeast.

3. The genetically engineered bacterium with the modified rate-limiting enzyme in the lutein synthesis pathway as described in claim 2, characterized in that, The nucleotide sequence of the truncated HMG-CoA reductase gene is shown in SEQ ID NO.5; the nucleotide sequence of the geraniol-geraniol pyrophosphate synthase gene is shown in SEQ ID NO.6; the nucleotide sequence of the phytoene synthase gene is shown in SEQ ID NO.7; and the nucleotide sequence of the phytoene dehydrogenase gene is shown in SEQ ID NO.

8.

4. The genetically engineered bacterium of the modified lutein synthesis pathway rate-limiting enzyme as described in claim 1 or 2, characterized in that, The synonymous mutation of arginine at position 367 is a codon mutation to AGA; the synonymous mutation of isoleucine at position 306 is a codon mutation to ATC; the synonymous mutation of arginine at position 350 is a codon mutation to AGA; the synonymous mutation of tyrosine at position 259 is a codon mutation to TAC; and the synonymous mutation of serine at position 10 is a codon mutation to TCG.

5. The genetically engineered bacterium of the modified lutein synthesis pathway rate-limiting enzyme as described in claim 1 or 2, characterized in that, The genetically engineered bacteria integrate two copies of the lycopene ε-cyclase gene, one copy having an intracellular lipid droplet localization sequence inserted at its 5′ end, and the other copy having a cell membrane localization sequence inserted at its 5′ end.

6. The genetically engineered bacterium with the modified rate-limiting enzyme in the lutein synthesis pathway as described in claim 5, characterized in that, The 5′ end of the lycopene β-cyclase gene contains an intracellular lipid droplet localization sequence.

7. The genetically engineered bacterium with the modified rate-limiting enzyme in the lutein synthesis pathway as described in claim 5, characterized in that, The genetically engineered bacteria have integrated three copies of the carotene β-hydroxylase gene.

8. The genetically engineered bacterium of the modified lutein synthesis pathway rate-limiting enzyme as described in claim 1 or 2, characterized in that, The genetically engineered bacteria also integrate the feroxin 3 encoding gene and the root-type feroxin: NADP(H) oxidoreductase encoding gene.

9. The use of the genetically engineered bacteria as described in any one of claims 1-8 in the production of lutein.

Images