Recombinant bacillus calmette guerin vaccine medicine for treating bladder cancer

Abstract

The invention discloses a recombinant bacillus calmette-guerin vaccine medicine for treating bladder cancer, and belongs to the technical field of biological medicine. The recombinant bacillus calmette guerin strain constructed by the invention has a remarkably improved treatment effect on NMIBC, and in a transplanted mouse bladder cancer model and an inducible rat bladder cancer model, the treatment effect of rBCG delta pknG on NMIBC is remarkably superior to that of traditional BCG. Compared with the traditional BCG, the effective rate of the rBCG delta pknG for short-term treatment of NMIBC is increased by 40-50%, and the survival rate of mice is increased by 20%.

Description

Technical Field

[0001] This invention relates to a recombinant BCG vaccine for the treatment of bladder cancer, belonging to the field of biomedical technology. Background Technology

[0002] Bacillus Calmette-Guérin (BCG), as a first-line immunotherapy for non-muscle invasive bladder cancer (NMIBC), has significantly reduced the risk of tumor recurrence and progression since the 1970s through bladder instillation. Its core mechanism relies on activating local immune responses (such as macrophage activation and cytotoxic T cell recruitment). However, current therapies still face multiple challenges, such as: only a portion of NMIBC patients respond positively to BCG treatment, with a short-term cure rate of only 40%; some patients experience side effects such as granulomatous cystitis and rare but serious systemic infections during treatment, leading to decreased patient compliance. Therefore, the development of recombinant Bacillus Calmette-Guérin (rBCG) has become an urgent need. Summary of the Invention

[0003] In view of the shortcomings of traditional BCG treatment for NMIBC, which has poor efficacy and certain side effects, this invention provides a new recombinant BCG strain and uses it as a drug for NMIBC.

[0004] This invention provides a recombinant BCG strain, which, compared to the original strain, reduces... ptpA Genes and / or pknG Gene expression.

[0005] In one embodiment, the starting strain is attenuated bovine tuberculosis bacillus BCG.

[0006] In one embodiment, the ptpA The gene has the nucleotide sequence shown in SEQ ID NO.1; pknG The gene has the nucleotide sequence shown in SEQ ID NO.2.

[0007] The present invention also provides a bladder cancer treatment drug, with the recombinant BCG strain as the sole active ingredient.

[0008] This invention provides the use of recombinant BCG (rBCG) in the preparation of a medicament for the treatment of bladder cancer.

[0009] In one embodiment, the drug comprises recombinant rBCG and a pharmaceutically acceptable carrier.

[0010] In one embodiment, the drug is an injectable formulation.

[0011] In one embodiment, the dosage form of the drug is suitable for bladder instillation.

[0012] The present invention also provides the use of the recombinant BCG strain, alone or in combination with other drugs, in medicaments for the prevention and / or treatment of bladder cancer.

[0013] In one embodiment, the bladder cancer includes, but is not limited to, non-muscle-invasive bladder cancer.

[0014] Beneficial effects: The recombinant BCG strain constructed in this invention significantly improves the therapeutic effect on NMIBC, among which rBCGΔ pknG In mice, the short-term treatment efficacy was as high as 60-70%. Furthermore, compared to the untreated group (18-day survival rate of 20%), mice in the conventional BCG treatment group had a survival rate of approximately 50% during the 18-day treatment period, while rBCGΔ... pknG The survival rate of mice in the treatment group increased to 70% during the 18-day treatment period. In summary, rBCGΔ pknG The treatment of NMIBC is significantly more effective than traditional BCG and significantly improves the survival rate of NMIBC. Attached Figure Description

[0015] Figure 1 This is a schematic diagram illustrating the process of constructing a transplanted bladder cancer mouse model.

[0016] Figure 2 This is a schematic diagram showing the frequency and dosage of BCG infusion in mice with transplanted bladder cancer.

[0017] Figure 3 This is a schematic diagram showing the BCG perfusion frequency and dose in mice with induced bladder cancer.

[0018] Figure 4 To establish a mouse model of transplanted bladder cancer and evaluate the efficacy of rBCG instillation therapy. rBCGΔ ptpA To knock out PtpA rBCG of the gene; rBCGΔ pknG To knock out pknG rBCG gene.

[0019] Figure 5 To establish an induced bladder cancer mouse model and evaluate the efficacy of rBCG instillation therapy. H&E staining was performed using hematoxylin-eosin. Detailed Implementation

[0020] The present invention will be further illustrated below through specific embodiments in order to better understand the present invention, but these embodiments do not constitute a limitation thereof.

[0021] Preparation of BCG vaccine: BCG was obtained from ATCC (catalog number 35737), rBCGΔptpA The construction method is based on patent application CN105477631A. rBCGΔ pknG The construction method is described in Example 1.

[0022] Example 1: Recombinant BCG strain BCGΔ pknG Construction and identification (1) Construct p0004S-Δ pknG plasmid Based on wild-type BCG, homologous recombination technology was used to construct... pknG Gene-deleted recombinant BCG strains (rBCGΔ) pknG The main process is as follows: Using BCG whole genome DNA as a template, two pairs of targeted... pknG Primers for the left and right arms of the gene: pknG -LS:TTTTTTTCCATAAATTGGTACACGCCATGGTCAATGCC; pknG -LA TTTTTTTTCATTTCTTGGTCAGACACCTAGCGCCTC; pknG -RS TTTTTTTTCCATAGATTGGATGCCCCGCCTAGCGTTCCTG; pknG -RA: TTTTTTTTCCATCTTTTGGGTCGAGGGCGGCGTTTGCTGG.

[0023] Amplification via polymerase chain reaction (PCR) pknG Homologous arm sequences on both sides of the gene. Reaction conditions: 95℃ for 3 min; 95℃ for 15 s; 58℃ for 15 s; 72℃ for 1 min, 30 cycles; 72℃ for 5 min. Digestion was performed using Van91I (cat# FD0714, Thermo Scientific). pknG The left and right homologous arms of the gene and the p0004S plasmid were ligated with the digested fragment, transformed into DH5α competent cells, and plated on LB agar plates containing 150 μg / mL hygromycin (cat#10843555001, Roche). Single colonies were picked and plasmids were extracted. Positive clones were confirmed by Van91I digestion.

[0024] (2) Construct phAE159-Δ pknG shuttle plasmid The p0004S-Δ enzyme constructed in step (1) was digested with PacI (cat# FD2204, Thermo Scientific) restriction enzyme. pknG Plasmids and phAE159 plasmid were ligated to the digested fragments. HB101 competent cells were transformed using a phage in vitro packaging kit (cat#MP5120, Epicentre) and plated on LB agar plates containing 150 μg / mL hygromycin. Single colonies were picked and plasmids were extracted. Positive clones were confirmed by PacI digestion, and the plasmid phAE159-Δ was constructed. pknG .

[0025] (3) Phage amplification Take 5 μg of the plasmid phAE159-Δ constructed in step (2). pknG Electroporation of Mycobacterium smegmatis mc 2 155 competent cells were added to 700 μL of 7H9 culture medium and recovered at 37℃ for 4 h. The recovered bacterial culture was then mixed with 0.7% agar and spread on 7H10 plates. The cells were incubated at 30℃ in the dark for 2–3 days.

[0026] Pick 4–5 plaques into an EP tube, add 200 μL of MP buffer, and incubate overnight at 4°C. Take 50 μL of the supernatant and add it to 300 μL of freshly cultured Mycobacterium smegma. 2 Add 155g of bacterial suspension to 0.7% agar and mix well. Spread the mixture onto 7H10 plates. Once the plaques have expanded and connected, add an appropriate amount of MP buffer and incubate overnight at 4°C. Aspirate the supernatant and filter it through a 0.22 μm filter. Store the phages at 4°C.

[0027] The bacteriophages were serially diluted, and 100 μL of each dilution was added to freshly cultured Mycobacterium smegmatis mcg. 2 Mix 155% bacterial suspension with 0.7% agar, spread on 7H10 plates, and incubate at 30°C in the dark for 2–3 days. Calculate the plaque titer.

[0028] (4) rBCGΔ pknG Construction of recombinant BCG strains To prepare competent strains of wild-type BCG, the phage constructed in step (3) was mixed with competent BCG at a ratio of 1:10 and incubated in the dark for 3–4 h. 10 mL of 7H9 medium (containing OADC enrichment broth) was added and incubated at 37°C for 16–20 h. BCG was collected by centrifugation and spread on 7H10 plates containing 75 μg / mL hygromycin. The plates were cultured at 37°C for 4–6 weeks, and positive clones were picked.

[0029] (5) rBCGΔ pknGIdentification of recombinant BCG strains Select the single colonies prepared in step (4) and incubate them statically at 37°C for 3 weeks in 7H9 medium. Collect the bacterial culture and extract the genomic DNA of the strain. pknG Primers designed based on the left and right homologous arm sequences of the gene pknG -up and pknG -down.

[0030] pknG -up:AACAGCTTGTTCGACGGGAT; pknG -down: ACGTTTTGGCATTCTTGCCC.

[0031] PCR amplification and identification. PCR conditions: 95℃ for 3 min; 95℃ for 15 s; 58℃ for 15 s; 72℃ for 3 min, 30 cycles; 72℃ for 5 min. Strains correctly identified by PCR were sent for genomic DNA sequencing to confirm the presence of BCG in the recombinant BCG vaccine. pknG The gene segment was completely knocked out.

[0032] The results are as follows Figure As shown, PCR identification confirmed that wild-type BCG can be detected. ​ The gene (1012 bp), while the recombinant BCG strain rBCGΔ ​ Undetectable in China ​ The gene was replaced by a homologous recombination gene for hygromycin resistance (4120 bp). Simultaneously, gene sequencing results confirmed the presence of the recombinant BCG gene. ​ The genes were completely knocked out.

[0033] Example 2: Preparation of bladder cancer cells (1) Take a 10 cm cell culture dish that has been cultured overnight, containing about 80% of fluorescent MB49 cells, and discard the culture medium.

[0034] (2) Slowly add 2 mL of sterile PBS to wash away the residual culture medium.

[0035] (3) Add 500-600 μL of trypsin and rotate evenly to cover each cell with trypsin. Then remove the excess trypsin, rotate and tap to completely remove the cells from the cell culture dish, and add 3 mL of fresh DMEM cell culture medium containing 10% fetal bovine serum and mix by repeated pipetting.

[0036] (4) Collect cells by centrifugation, then resuspend the cells in 5 mL of PBS, wash the cells and centrifuge again. Repeat this step to wash the cells 3 times.

[0037] Example 3: Construction of a transplanted bladder cancer mouse model and rBCG instillation therapy 1. Construction of a transplanted bladder cancer mouse model The specific steps are as follows: (1) Disinfect the experimental tools, wipe the operating table with disinfectant, and then lay sterile gauze on the operating table.

[0038] (2) MB49 bladder cancer cells were suspended in PBS solution and placed on ice for later use. The expected yield was 1×10⁻⁶. 7 Cells / mouse.

[0039] (3) Intraperitoneal injection of isoflurane (300 μL / mouse) to anesthetize the mice. Shave the fur off the mouse's abdomen with a razor, and clean and disinfect the surgical site with povidone-iodine solution. Let the solution remain on the skin for 5-10 seconds, then wipe it off with an alcohol wipe. Repeat this step 3 times.

[0040] (4) Clamp only the skin layer with Adson forceps, and cut with iris scissors, making a 1 cm incision in the midline of the abdominal and pelvic skin. ​ a, 1b). Use Adson forceps and pointed forceps to separate the skin and muscle layers around the incision. Make a 1 cm incision with iris scissors, cutting along the white midline (called the white line) to expose the abdominal wall. ​ c). When cutting, use Edson forceps to clamp the tissue to form a small pelvic opening, and place sterile gauze around the incision to maintain the sterility of the surgical plane in the mouse.

[0041] (5) Locate the bladder. The bladder is located near the distal end of the incision (or in the subgastric region), behind the adipose tissue and large intestine. Slight pressure on the outside of the incision can help it rise through the incision. A fully distended bladder is easier to locate. Once located, gently grasp and remove the bladder using forceps. ​ d).

[0042] (6) Hold the bladder in place with pointed forceps or ceramic-coated cup forceps. Insert a 30 1 / 2 gauge needle with a syringe into the bladder fornix to aspirate urine. ​ e, 1f).

[0043] (7) Simultaneously, hold the bladder with pointed forceps or ceramic-coated cup forceps and expose the injection site by bringing the upper end of the bladder to the lower end of the abdominal cavity. ​ g). Using a syringe filled with cell suspension and a 30 1 / 2 gauge needle, puncture the bottom of the bladder ( ​ h). Before pressing the plunger of the syringe, ensure the needle is visible in the distal lumen of the bladder. After observation, inject 50 μL of cell suspension into the bladder lumen. ​ i), and absorb all the fluid at the injection site with a sterile cotton swab.

[0044] (8) Return the bladder to the body cavity and ensure all other organs are in place. Similarly, use sterile swabs to absorb excess fluid and blood from the abdominal cavity. ​ j). Pull up the abdominal tissue layers on both sides (including abdominal muscles, connective tissue, and peritoneum; this is the thick muscle layer observed by surgeons).

[0045] (9) Close the abdominal cavity by suturing the muscles and related layers, close the skin layer using surgical adhesive or automatic clips, and ensure that the incision is completely sealed. ​ k, 1l).

[0046] (10) One hour after the surgery, the mice were examined again and the water was returned to the cage.

[0047] 2. rBCG infusion therapy (1) Placebo group, BCG treatment group, and rBCGΔ group were set up respectively. ​ Treatment group, rBCGΔ ​ Processing group; processing steps are as follows: The placebo group received the following instillation: 50 μL of PBS per bladder instillation; BCG, rBCGΔ ​ rBCGΔ ​ The three treatments are as follows: 2×10 5 One dose of BCG was resuspended in 50 μL of PBS for bladder instillation treatment in one mouse (i.e., instillation volume of 2 × 10⁶ BCG per 20 g mouse body weight). 5 CFU). Perfusion frequencies in the placebo and treatment groups were as follows: ​ As shown: The first BCG perfusion therapy was performed on the 9th day after MB49 cell transplantation, followed by treatment every 3 days until the 18th day, for a total of 4 treatments.

[0048] (2) Before perfusion treatment, the mice were first anesthetized and placed in a supine position. The hind legs were fixed to the mat with transparent tape. The claws must be fully spread apart so that the urethral opening is clearly visible and easily accessible for catheter insertion. Note: For catheter insertion, a 24 G pediatric intravenous catheter is suitable for mice aged 8 to 10 weeks. Catheter selection is crucial to avoid leakage between the urethral wall and the catheter. Larger or older mice must use larger diameter catheters.

[0049] (3) Using small forceps, pinch one edge of the outside of the urethra and then very gently twist it toward the "head" of the mouse to expose the urethral opening.

[0050] (4) Remove the inner needle of the catheter and insert it into the urethra at a 45° angle, slightly toward the mouse's "tail". Do not force the catheter in; if you encounter resistance, simply twist the catheter very gently until it slides into the urethra. When the catheter is about 0.5-0.8 cm in the urethra, carefully insert the catheter parallel to the mouse's tail.

[0051] (5) Using a 1 mL syringe, the needle of which must be inserted into the catheter, flush the bladder with 200-300 μL of sterile PBS to remove residual urine, and then aspirate all fluid from the bladder. Note: When injecting PBS, the bladder will fill, and swelling will occur between the mouse's hind legs; this confirms that the catheter insertion was correct. Most catheters have a dead volume, which must be taken into account when calculating the injection volume. (To prove that the insertion position is correct, irrigate with 100 μL of water / PBS; if 100 μL of water / PBS can still be aspirated, then the insertion position is correct).

[0052] (6) Empty the bladder by aspiration, and return 150 μL containing 1 × 10 6 Inject MB49 cells into the bladder via PBS. Assemble the syringe onto the catheter to prevent cell leakage. It is best to secure the syringe to a pad using transparent tape.

[0053] (7) After 1 hour, gently remove the catheter from the urethra and place the mouse in a cage under an incandescent light until it wakes up: this usually happens between 1 and 2 hours after the end of treatment. Wild-type BCG and rBCG (rBCGΔ) were detected in a mouse model of bladder cancer transplanted with fluorescent MB49 tumor cells. ​ and rBCGΔ ​ The efficacy of BCG or rBCG in treating NMIBC was assessed by instilling BCG or rBCG every 3 days for 4 instillations. Fluorescence intensity (i.e., tumor development) in the bladder region was measured using an in vivo imaging system in mice. Results showed that in the placebo group, tumor fluorescence intensity increased by approximately 20% after 18 days, indicating tumor progression; in the conventional BCG treatment group, tumor fluorescence intensity decreased by approximately 20% after 18 days, suggesting that BCG has a certain therapeutic effect on bladder cancer. rBCGΔ ​ In the treatment group, the tumor fluorescence intensity decreased by approximately 50% after 18 days of treatment, indicating that rBCGΔ ​ rBCGΔ has better therapeutic effects on bladder cancer than BCG. ​ In the treatment group, the tumor fluorescence intensity decreased by approximately 70% after 18 days of treatment, indicating that rBCGΔ ​ The treatment effect of bladder cancer is the most obvious. ​(a, 3b). In summary, both rBCGs were superior to wild-type BCG in treating bladder cancer. Furthermore, the mouse survival curves during treatment showed that the survival rate in the placebo group was only 20%, while the rBCG Δ... ​ The survival rate of mice in the conventional BCG treatment group was 40-50%, while that in the rBCGΔ group was... ​ The survival rate of mice in the treatment group was 70%, significantly higher than that of mice treated with rBCGΔ. ​ and BCG treatment group ( ​ c). In summary, rBCGΔ ​ The treatment of bladder cancer is significantly more effective than traditional BCG, and the survival rate in mice is the highest.

[0054] Example 4: Construction of an induced bladder cancer rat model and rBCG instillation therapy 1. Construction of an inducible rat model of bladder cancer The specific steps are as follows: (1) After confirming that the rats were in anesthetized state by anesthetizing them with 2% isoflurane for 5 minutes, the rats were bladder-washed twice by instilling 100 μL of physiological saline into the bladder.

[0055] (2) Inject 150 μL of N-Methyl-N-nitrosourea (MNU solution) (20 mg / mL) into each rat and keep the drug in the bladder for 1-2 hours. Infuse once every two weeks for a total of four times.

[0056] (3) After the infusion was completed, 0.1% N-butly-N-(4-hydroxybutyl)nitrosamine (BBN) was applied to the drinking water to accelerate the induction process of bladder cancer.

[0057] (4) Rats that develop hematuria after about 18 weeks are euthanized, and bladder tissue is taken for pathological staining to confirm whether the model has been successfully established.

[0058] 2. rBCG infusion therapy This step is the same as the mouse rBCG perfusion step in Example 2. The perfusion treatment frequency and perfusion dose for rats are as follows: ​ As shown: 5×10 6 One BCG cell was resuspended in 50 μL of PBS for instillation therapy in one rat. The first BCG instillation therapy was performed at week 18 after bladder cancer induction, followed by weekly instillation therapy until week 23, for a total of 6 treatments.

[0059] H&E staining was used to analyze wild-type BCG and rBCG (rBCGΔ) ​ and rBCGΔ ​ The efficacy of rBCG in treating NMIBC was shown in the results: ​In the treatment group, bladder tumor tissue was virtually invisible, indicating that this group showed the most significant treatment effect for bladder cancer, followed by rBCGΔ. ​ .

[0060] The degree of tumor progression was quantitatively analyzed using pathological scoring (a lower pathological score indicates a lower degree of tumor progression). The H&E pathological scoring was performed according to the method published in "Evaluation of tumor-infiltrating lymphocytes using routine H&E slides predicts patient survival in resected non-small cell lung cancer". (1) The percentage of tumor stroma containing mononuclear immune cells (including lymphocytes and plasma cells) was scored according to the following criteria: 2 = 0–5%; 4 = 6–25%; 6 = 26–50%; 8 => 50%. To obtain an estimate of the average infiltrated area, the assessment of tumor-infiltrating lymphocytes was performed in multiple stroma regions.

[0061] (2) According to the scoring scheme in step (1), the different levels of tissue morphology characteristics are graded as follows: Grade 0: The stroma is completely loose or dense with a fibroblast-like appearance, and there are no / very few immune cells; 1 point: Tumor-infiltrating lymphocytes are loosely and scattered in the stroma; 2 points: Tumor-infiltrating lymphocytes are more often located near the tumor epithelial cells, and in some stroma areas, tumor-infiltrating lymphocytes form patchy lymphocyte aggregations; 3 points: Immune cells are highly densely infiltrated in the stroma.

[0062] The results showed that the placebo group had the highest pathology score (approximately 7 points) and rBCGΔ ​ The treatment group had the lowest pathology score (approximately 1 point), while rBCGΔ ​ The treatment group scored approximately 3 points, while the traditional BCG treatment group scored approximately 5 points. ​ a). Ki-67 expression levels are positively correlated with tumor proliferative activity. Further immunohistochemical analysis of bladder tissue revealed that the placebo group had the highest proportion of Ki-67-positive cells (7.5%), indicating the strongest tumor proliferative activity. rBCGΔ ​ The treatment group had the lowest percentage of Ki-67 positive cells (1.5%), indicating the worst tumor proliferative activity. Furthermore, rBCGΔ ​ The percentages of Ki-67 positive cells in the conventional BCG treatment group and the traditional BCG treatment group were 5.5% and 3.5%, respectively. ​ b). In summary, rBCGΔ ​ The treatment of bladder cancer is significantly more effective than traditional BCG.

[0063] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A recombinant BCG strain, characterized in that, Compared to the original strain, the recombinant BCG vaccine reduced... ptpA Genes and / or pknG Gene expression.

2. The recombinant BCG strain according to claim 1, characterized in that, The starting strain was attenuated bovine tuberculosis bacillus BCG.

3. The recombinant BCG strain according to claim 1 or 2, characterized in that, The ptpA The gene has the nucleotide sequence shown in SEQ ID NO. 1; pknG The gene has the nucleotide sequence shown in SEQ ID NO.

2.

4. The use of the recombinant BCG strain according to any one of claims 1 to 3 in the preparation of a medicament for treating bladder cancer.

5. The application according to claim 4, characterized in that, The drug comprises recombinant rBCG and a pharmaceutically acceptable carrier.

6. The application according to claim 4 or 5, characterized in that, The drug is an injectable preparation.

7. The application according to any one of claims 4 to 6, characterized in that, The drug is in a dosage form suitable for bladder instillation.

8. The use of the recombinant BCG strain of claim 1, alone or in combination with other drugs, in medicaments for the prevention and / or treatment of bladder cancer.

9. The application according to claim 8, characterized in that, The bladder cancer mentioned includes, but is not limited to, non-muscle-invasive bladder cancer.

10. A drug for treating bladder cancer, characterized in that, The recombinant BCG strain described in any one of claims 1 to 3 is the sole active ingredient.

Images