In-vitro preparation method of myocardial cells under supergravity condition

By culturing and analyzing cardiomyocytes under simulated hypergravity conditions using in vitro preparation methods, the high cost of hypergravity research has been solved, the effects of hypergravity on cardiomyocytes have been revealed, and new protective strategies have been provided, demonstrating significant potential for medical applications.

CN121495840APending Publication Date: 2026-02-10SHAOGUAN COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511626614.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-07
Publication Date
2026-02-10

AI Technical Summary

Technical Problem

Existing technologies for hypergravity experiments are costly and facilities are scarce, resulting in a lack of research on the effects of hypergravity on organisms, especially on the specific effects on cardiomyocytes. This hinders a deeper understanding of the impact of hypergravity environments on human health and the development of protective measures.

Method used

A method for preparing cardiomyocytes in vitro under hypergravity conditions is provided, including two-dimensional matrix adherent culture, mixing with matrix gel to form a three-dimensional culture system, and culturing in a 3G hypergravity environment. Transcriptome sequencing and epigenetic analysis are combined to detect cardiomyocyte-specific genes and epigenetic markers.

Benefits of technology

This study achieved the simulation of hypergravity in vitro, reduced research costs, revealed the effects of hypergravity on cardiomyocytes, provided new molecular and epigenetic regulatory mechanisms, and offered candidate targets for the development of protective drugs or intervention strategies, thus possessing significant translational medical value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121495840A_ABST
    Figure CN121495840A_ABST
Patent Text Reader

Abstract

The invention relates to the field of aerospace biology and cell biology, in particular to an in-vitro preparation method of myocardial cells under a supergravity condition. Comprising the following steps: step 1, performing adherent culture on myocardial cells on a two-dimensional matrix; 2, mixing the myocardial cells subjected to two-dimensional culture in the step 1 with matrigel to form a three-dimensional culture system; step 3, placing the three-dimensional culture system obtained in the step 2 in a supergravity environment for culture; wherein the gravity intensity of the supergravity environment is 3G, and the treatment time is 12-96 hours. The invention provides a complete and repeatable myocardial cell in-vitro preparation method under the supergravity condition for the first time. A stable 3G supergravity environment can be provided, the damage of high shear force to cells is effectively reduced, the core pain point that a traditional supergravity experiment depends on expensive and rare parabola flight or a large centrifugal machine is solved, and the research cost and the technical threshold are greatly reduced.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of aerospace biology and cell biology, and particularly relates to a method for preparing myocardial cells in vitro under hypergravity conditions. BACKGROUND

[0002] With the deepening of human exploration of the universe, space missions are increasing, and the exposure time of humans in space environment is gradually lengthening. The space environment has many special factors, such as weightlessness, radiation, isolation in a closed space, etc. The influence of these factors on human health has attracted widespread attention. Among them, weightlessness will lead to muscle atrophy and bone damage in the human body, because the frequency of muscle use in the human body decreases and the stability of the skeleton decreases in weightlessness; space radiation is mainly composed of high-energy protons and heavy ions, which can penetrate air and most matter, damage living organisms, and higher doses can cause hematopoietic dysfunction, decreased immune system function, DNA variation, cancer and other diseases. Space flight has multiple effects on the genomes of astronauts. It has been found through research that the dynamics of telomere length and gene expression patterns of astronauts who have flown in space have changed, and the intestinal microbiota has also been deeply affected. In addition, long-term space missions will also bring psychological challenges to astronauts, such as space loneliness, social isolation, changes in sleep patterns, increased psychological stress, etc. These psychological problems will further affect the physical health and work efficiency of astronauts.

[0003] Although research on the influence of various factors in the space environment on human health has made some achievements, there are still many deficiencies in the research on the influence of gravity changes on the human body. Gravity changes include microgravity and hypergravity, which will cause hydrostatic pressure and fluid shear flow, thereby having a strong impact on in vitro and in vivo systems. At present, research on the influence of microgravity is relatively more, for example, the microgravity environment leads to the disappearance of the hydrostatic pressure gradient, the transfer of body fluids to the head, and a series of physiological adjustments, leading to myocardial atrophy, increased arterial stiffness, and degradation of cardiopulmonary function, etc. However, there is a lack of research on the influence of hypergravity experienced by astronauts during launch (about 3.2g) and reentry into Earth's orbit (about 1.4g), as well as exposure to artificial gravity during the entire mission (about 3-4g) to counteract microgravity.

[0004] Currently, hypergravity research is facing many difficulties, the most important of which is the limited selection of experimental design and the extremely high cost. The selection of designing hypergravity experiments is mainly parabolic flight experiments or using special large-diameter centrifuges in specific space research centers. Parabolic flight experiments need to use special aircraft to simulate a hypergravity environment for a short time through a parabolic flight trajectory, but this experimental method is very costly, the cost of each flight is extremely high, and the flight time is limited, and the number and time of experiments that can be conducted are greatly limited. Using special large-diameter centrifuges not only has a high cost of equipment itself, but also has a high running and maintenance cost, and such equipment is usually only available in a few specific space research centers, and the distribution is extremely limited, resulting in very few available research facilities.

[0005] Due to the high cost and few facilities of hypergravity experiments, research on the effects of hypergravity on living organisms is lacking. For example, detailed evidence of the safety of myocardium under hypergravity is still missing. Although it is known that hypergravity experienced by parabolic flight and jet fighter pilots will cause orthostatic intolerance and motion sickness, change the vestibular cardiovascular reflex, but little is known about how hypergravity specifically affects the development, function of cardiomyocytes and the related molecular mechanisms. This has hindered a deep understanding of the effects of hypergravity environments on human health and the development of corresponding protective measures and treatment methods. Therefore, it is of great practical significance and urgent need to develop an economical and efficient hypergravity source for in vitro research. SUMMARY

[0006] Based on this, the purpose of the present application is to provide a method for preparing myocardial cells in vitro under hypergravity conditions, which solves the problems in the prior art.

[0007] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows.

[0008] The present application provides a method for preparing myocardial cells in vitro under hypergravity conditions, comprising:

[0009] Step one, adherent culture of myocardial cells on a two-dimensional substrate;

[0010] Step two, mixing the myocardial cells cultured in two dimensions in step one with Matrigel to form a three-dimensional culture system;

[0011] Step three, culturing the three-dimensional culture system obtained in step two in a hypergravity environment;

[0012] Among them, the gravity strength of the hypergravity environment is 3G, and the treatment time is 12-96 hours.

[0013] In some embodiments of the present application, the two-dimensional substrate is a polystyrene cover glass coated with gelatin; the adherent culture comprises: inoculating the myocardial cells on the polystyrene cover glass coated with gelatin, and culturing under the condition of 1G gravity acceleration.

[0014] In some embodiments of the present application, the culturing time under the condition of 1G gravity acceleration is 1-2h.

[0015] In some embodiments of the present application, the polystyrene cover glass coated with gelatin solution is placed in a well plate, and then the myocardial cells are inoculated, and the inoculation density of the myocardial cells is 3-4×10 4 cells / cover glass.

[0016] In some embodiments of the present application, the mixing ratio of the myocardial cells and the Matrigel is 1-1.5×10 4 cells per 200μL mixture.

[0017] In some embodiments of the present application, after mixing the myocardial cells and the Matrigel, the mixture is incubated at 37℃ for 30-45min to solidify the Matrigel.

[0018] The present application also provides the application of the myocardial cells prepared by the method for preparing myocardial cells in vitro under the condition of hypergravity in the research of the influence of gravity change on the biology of myocardial cells.

[0019] In some embodiments of the present application, the kit comprises a primer pair for detecting the expression level of the myocardial cell specific gene TNNI1 and / or TNNI3, and the sequence of the primer pair is shown as SEQ ID NO: 1-4.

[0020] In some embodiments of the present application, the kit further comprises a primer pair for detecting the expression level of the DNA methyltransferase MET1 gene, and the sequence of the primer pair is shown as SEQ ID NO: 5 and 6.

[0021] In some embodiments of the present application, the kit further comprises an antibody for detecting an epigenetic marker, and the epigenetic marker comprises 5-methyldeoxycytidine and acetylated histone H4.

[0022] Based on the technical scheme of the present application, compared with the prior art, the present application has the following beneficial effects: the present application first provides a complete and repeatable method for preparing myocardial cells in vitro under the condition of hypergravity. It can provide a stable 3G hypergravity environment, effectively reduce the damage of high shear force to cells, solve the core pain point of traditional hypergravity experiments which rely on expensive and rare parabolic flight or large centrifuges, and greatly reduce the research cost and technical threshold.

[0023] The present application not only observes that hypergravity leads to the decrease of myocardial cell viability, cycle arrest and morphological deterioration, but also reveals, for the first time in an in vitro model, that hypergravity induces whole-genome DNA hypermethylation and histone H4 deacetylation by up-regulating DNA methyltransferase MET1 gene, thereby regulating the expression of myocardial cell-specific genes (such as down-regulation of TNNI1 and up-regulation of TNNI3) through transcriptome sequencing and epigenetic analysis. This provides new experimental evidence and theoretical basis for understanding the molecular and epigenetic regulation mechanism of hypergravity stress.

[0024] The MET1-mediated epigenetic pathway discovered by the present application provides a new candidate target for developing protective drugs or intervention strategies (such as methylation inhibitors) for astronauts to cope with changes in gravity during launch, return and long-term space missions, which has important translational medical value. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Fig. 1 is a schematic diagram of a hypergravity centrifuge and its position during hypergravity treatment; wherein, Figure 1 Fig. 1A is a structural schematic diagram of a swing-bucket rotor; Figure 1 Fig. 1B is a physical diagram of a swing-bucket rotor; Figure 1 Fig. 1C is a schematic diagram of the position of an incubator and a hypergravity centrifuge during three-dimensional culture and hypergravity culture.

[0026] Figure 2 Fig. 2 is a schematic diagram of a three-dimensional cell culture system; wherein, Figure 2 Fig. 2A is a schematic diagram of a three-dimensional cell culture system; Figure 2 Fig. 2B is a cross-section of a 12-well culture plate containing Matrigel; Figure 2 Fig. 2C is a graph showing the morphological changes of cells in a three-dimensional culture system after 3G hypergravity treatment for 3 days, 5 days and 7 days.

[0027] Figure 3 Fig. 3 is a graph showing the morphological changes of myocardial cells after 3G hypergravity treatment for 12 hours and 24 hours compared with the control group.

[0028] Figure 4 Fig. 4 is a comparison of myocardial cells after 3G hypergravity treatment for 36 hours and 48 hours compared with the control group.

[0029] Figure 5 Fig. 5 is a comparison of myocardial cells after 3G hypergravity treatment for 72 hours compared with the control group.

[0030] Figure 6 Fig. 6 is a statistical graph of the effect of hypergravity treatment at different time points on myocardial cell viability detected by MTT method (*p<0.05, **p<0.01, ***p<0.001).

[0031] Figure 7 Statistical graph of the effect of 3G hypergravity on the cell cycle distribution of cardiomyocytes for flow cytometry analysis (p<0.05, **p<0.01).

[0032] Figure 8 Statistical graph of the effect of 3G hypergravity on the expression of TNNI1 and TNNI3 genes for qRT-PCR detection (*p<0.05, **p<0.01).

[0033] Figure 9 Heat map of differentially expressed genes obtained by RNA sequencing.

[0034] Figure 10 Statistical graph of the effect of 3G hypergravity on the expression of MET1 gene for qRT-PCR detection (p<0.05).

[0035] Figure 11 Statistical graph of the effect of 3G hypergravity on the levels of DNA methylation (5mdc) and histone H4 acetylation (AcH4) for flow cytometry detection (p<0.05). DETAILED DESCRIPTION

[0036] The technical solutions in the embodiments of the present application will be clearly and completely described below in combination with the embodiments in the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.

[0037] The specific embodiments will be described below.

[0038] Embodiment 1

[0039] 1. An in vitro preparation method of cardiomyocytes under hypergravity conditions, comprising the following steps:

[0040] (1) Obtaining and culturing of cardiomyocytes

[0041] Wild-type C57BL / 6 newborn mice (2-3 days old) were obtained, and the mice were sacrificed according to the standard procedure, and the hearts were isolated. A commercialized cardiomyocyte isolation kit (purchased from Thermo Fisher, product number 88281) was used and the standard operating procedure was followed to isolate the cardiomyocytes, so as to ensure high cell yield and high cell viability.

[0042] (2) Two-dimensional culture of cardiomyocytes

[0043] A 0.2% (w / v) gelatin solution was evenly coated onto a 13 mm polystyrene coverslip for tissue culture, and placed in a 24-well plate. The gelatin was allowed to air dry or dried in a 37°C incubator to ensure firm adhesion. Purified cardiomyocytes were then cultured at 3.5 × 10⁻⁶ mm. 4 Cells were seeded at a density of 1000 cells / day on gelatin-coated coverslips and endothelial cell growth medium (Thermo Fisher Scientific, product number: CAT 22011) was added. The culture plate was placed in an incubator at 37°C and saturated with 5% CO2 and cultured for 1 hour and 30 minutes under a gravitational acceleration of 1g to allow the cells to adhere.

[0044] (3) Three-dimensional culture and hypergravity treatment of cardiomyocytes

[0045] like Figure 2 As shown in A, Corning Matrigel (Corning Corporation, product number 354237) was removed from the freezer and placed on ice to thaw slowly, avoiding excessive heat that could cause it to solidify. Using cooled pipette tips, the thawed Matrigel solution was mixed with the 2D cultured cell suspension (1 × 10⁶ cells / mL per chamber). 4 Mix thoroughly (200 μL per cell per chamber), then add the mixture to the culture vessel, followed by covering the surface of the mixture with a layer of matrix gel. Incubate the sample and the culture plate coated only with matrix gel at 37°C for 30-45 minutes to allow the matrix gel to solidify (e.g., ...). Figure 2 (As shown in B). Cells from the solidified three-dimensional culture system were seeded onto the surface of the matrix gel layer. The culture container was then transferred to the basket of a high-gravity centrifuge (manufacturer: DHS; model: PlateSmar), and the centrifuge was placed in a cell culture incubator to maintain environmental stability for 7 days of culture. The incubator conditions were: temperature 37℃, 5% CO2 saturation, with fresh endothelial cell growth medium replaced every two days to maintain the necessary nutrient environment for cell growth. Simultaneously, 1g of statically cultured cardiomyocytes was used as a control group. Samples were taken at preset time points (12, 24, 36, 48, 72, and 96 hours) to observe cell morphological changes and perform subsequent analysis.

[0046] The parameters of a centrifuge operating under high gravity are calculated using the relative centrifugal force (RCF) formula: RCF = 1.118 × r × (RPM / 1000) 2 (where r is the rotor radius in millimeters) to generate a stable 3G hypergravity field.

[0047] In this embodiment, a custom rotor with a diameter of 550 mm is used. This design can achieve a 3G gravitational intensity at a relatively low rotational speed of less than 650 rpm, effectively reducing the damage to cardiomyocytes caused by shear stress generated at high rotational speeds. Simultaneously, the rotor diameter is adaptable to the physical dimensions of the basket, the oscillation mechanism, and the placement requirements of the 6-well cell culture plate. The culture container employs a sealing device to ensure a good seal, preventing culture medium leakage that could contaminate the centrifuge and damage the equipment. The 6-well culture plate is fixed and adjusted within the incubator using a dedicated support, providing continuous and stable support for cell growth.

[0048] 2. Detection of the effects of hypergravity on cardiomyocytes

[0049] (1) Cell viability assay: Cell samples from the treatment group and the control group were collected at each time point (12, 24, 36, 48, 72 and 96 hours) of the hypergravity (3G) treatment. The 3-(4,5-dimethylthiazolyl-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay kit (product number: 475989) manufactured by Sigma-Aldrich (St. Louis, Missouri, USA) was used to detect the inhibitory effect of hypergravity (3G) on cardiomyocyte growth.

[0050] (2) Cell cycle: Cardiomyocytes at different hypergravity treatment time points were collected, washed twice with PBS, fixed in 1 ml of 70% cold ethanol in test tubes, and incubated overnight at -20°C. After incubation, the cells were centrifuged at 1000 rpm for 5 min, and the cell pellet was resuspended in 500 μL of propidium iodide (PI) / Triton X-100 staining solution containing 50 μg / mL PI (Roche, Penzberg, Germany), 0.1% (v / v) Triton X-100 (Sigma), and 100 μg / mL RNase (Sigma). The cells were then incubated on ice for 30 min and detected using FC 500 MCL. Cell cycle distribution was calculated based on 10,000 cells using ModFit LT software (Becton Dickinson, San Jose, CA, USA).

[0051] (3) RNA extraction and qRT-PCR: Total RNA was extracted from primary cardiomyocytes using Trizol reagent (Invitrogen, USA). After checking its integrity and purity, 2 μg of RNA was reverse transcribed into cDNA using the Transcriptor first-strand cDNA synthesis kit (Roche), and the cDNA was directly used for PCR. 2 μL of cDNA from each sample was amplified by PCR using the Expand high-performance PCR system (Roche), with three technical replicates. The qRT-PCR experiment used the ΔCt method to standardize the raw data using two stably expressed endogenous control genes (ACTB) as references to obtain qRT-PCR data. Primer sequences are shown in Table 1.

[0052] Table 1 Primers

[0053] Primer name Sequence 5'-3' Number TNNI1-WT-Forward CAAGCCTGCTTCCTTCTGGA SEQ ID NO: 1 TNNI1-WT-Reverse GTTGGAGGATGTGAGAGCCA SEQ ID NO: 2 TNNI3-WT-Forward ATCTTCGTAGCCTTGGGGTG SEQ ID NO: 3 TNNI3-WT-Reverse AAATCCAACCACCCTTGCCT SEQ ID NO: 4 ACTB-WT-Forward CCTTCTGACCCATTCCCACC SEQ ID NO: 5 ACTB-WT-Reverse TACTTTGGGAGTGGCAAGCC SEQ ID NO: 6

[0054] (4) mRNA library construction and sequencing

[0055] Total RNA was extracted using Trizol reagent (Invitrogen, California, USA) according to the manufacturer's instructions. The quantity and purity of the total RNA were analyzed using a Bioanalyzer 2200 and RNA 6000 Nano LabChip kit (Agilent Technologies, California, USA), with a RIN value greater than 7.0. Approximately 5 μg of total RNA was used to bind to magnetic beads coated with poly(A) oligonucleotides to isolate poly(A) mRNA (Invitrogen). After purification, the mRNA was fragmented into small fragments using divalent cations at elevated temperatures. The cleaved RNA fragments were then constructed into cDNA libraries according to the protocol based on the Illumina RNA ligation method (Illumina, San Diego, USA). Briefly, the fragmented RNA was hydrolyzed at the 3' end by phosphatase and phosphorylated at the 5' end by PNK. The treated RNA was purified using the RNeasy MinElute kit (Qiagen) according to the manufacturer's instructions. The purified RNA was ligated with pre-adenylated 3' aptamers, allowing for subsequent ligation of 5' aptamers. Based on the aptamer sequence, reverse transcription and subsequent PCR were performed to create a cDNA construct. The average insert size of the end-pair library was 400 base pairs (±50 base pairs). Single-end sequencing was then performed on an Illumina Hiseq 4000 according to the vendor-recommended protocol.

[0056] (5) RNA sequencing and analysis

[0057] A cDNA library was constructed by technically processing mixed RNA from neonatal mouse heart samples and sequenced using an Illumina 4000 sequencing platform. RNA sequencing analysis was performed on six datasets obtained from mouse heart tissue samples at six different time points using 50-nucleotide paired-end reads, with three biological replicates for each time point. Reads were mapped to the Mus musculus reference genome vGRCm38 2 using TopHat v2.0.143. Transcripts and normalized counts were then processed using Cuffdiff v2.2.1 4. Differential expression analysis of normalized counts was performed using cummeRbund v2.12 5, a widely used R v3.2 package used in conjunction with Cuffdiff; the applicable threshold for the parameter α in the getSig function was ≤0.05. Finally, differentially expressed genes were visualized using heatmaps.

[0058] All data obtained from various experiments were normally distributed and analyzed using an unpaired two-tailed t-test. All data are presented as mean ± standard error. Statistical analysis was performed using GraphPad Prism software.

[0059] (6) Epigenetic analysis:

[0060] 1) CpG island analysis and genotyping

[0061] The selection of the MET1 gene was based on a bioinformatics survey. Therefore, methylation islands in the -1000 to +100 region of the AtTERT gene promoter were analyzed using CpGPlot, CpGIF, and PlantPan software. The CpG islands found in CpGPlot and CpGIF software were almost identical. Therefore, the met1 methyltransferase system with methylated CpG islands was selected. Specific primers were used to screen the collected samples. Primer sequences are shown in Table 2.

[0062] Table 2

[0063] Primer name Primer sequence 5' - 3' Number MET1-wild type-F GCCTGGTCAAGTGGACTTCATC SEQ ID NO: 7 MET1-wild type-R CCATTCTTCACAGAGCATGCC SEQ ID NO: 8 Mutant allele-F GATTGTGTCTCTACTACAGAGGC SEQ ID NO: 9 Mutant allele-R TGGACGTGAATGTAGACACGTCG SEQ ID NO: 10

[0064] Polymerase chain reaction (PCR) reaction: performed in a 25 μL volume containing 10 ng DNA, 1X PCR buffer, 1.5 mmol magnesium chloride, 0.2 mmol deoxyribonucleoside triphosphate, 0.4 μmol each of forward and reverse primers, and 0.625 units of DNA polymerase (Takara Bio Inc., Japan).

[0065] The PCR procedure was as follows: 94℃ for 5 minutes, followed by 30 cycles, each cycle consisting of 94℃ for 30 seconds, 56℃ for 30 seconds, and 72℃ for 30 seconds, with a final induction at 72℃ for 10 minutes to complete DNA amplification. PCR products were observed by electrophoresis on a 1% agarose gel.

[0066] 2) Gene expression analysis

[0067] cDNA was synthesized using REVERTAID (RevertAid cDNA Synthesis Kit, Thermo Fisher Scientific, USA) according to the manufacturer's instructions. Then, reverse transcription (RT)-PCR was performed in a 20 μL volume using the TaKaRa kit (TaKaRa Corporation, Japan), following the manufacturer's protocol. Actin was used as an internal control in the PCR reaction. Quantitative RT-PCR (qRT-PCR) amplification was performed in a final 20 μL volume containing 10 ng cDNA, 0.4 μmol of each primer, and SYBR Green PCR Master Mix, using an iQ5 real-time thermal cycler (Bio-Rad Laboratories, USA).

[0068] The PCR conditions were: 94℃ for 3 minutes, 50 cycles, with each cycle consisting of 94℃ for 10 seconds, 52℃ for 10 seconds, 72℃ for 10 seconds, and finally 72℃ for 10 minutes.

[0069] (3) Evaluation of epigenetic markers

[0070] DNA methylation epigenetic markers, namely 5mdc (5-methyldeoxycytidine) and histone H4 acetylation (acetylated histone H4; AcH4), were detected by flow cytometry. Protein levels (anti-5mdc antibody) were assessed and per-cell intensity quantification was performed on 10,000 cells labeled with specific antibodies using flow cytometry.

[0071] (7) Statistical analysis

[0072] All experiments were repeated three times. Gene expression levels were analyzed using the normalized calibrator method (21). Data analysis was performed using Graphpad Prism version 10 (Graphpad software, USA). A p-value less than 0.05 was considered statistically significant.

[0073] 3. Experimental Results

[0074] (1) Three-dimensional cultured cell morphology

[0075] The results are as follows Figure 2As shown in C, the changes in cell morphology of the three-dimensional culture system after 3 days, 5 days and 7 days of 3G hypergravity treatment can be observed. As the treatment time progresses, the cell morphology gradually shows differences from the control group.

[0076] (1) Comparison of cell morphology under different hypergravity treatment times

[0077] 12-hour and 24-hour treatment groups (e.g.) Figure 3 As shown in the figure): Compared with the 1G control group, after 12 hours and 24 hours of 3G hypergravity treatment, the number of cardiomyocytes was significantly reduced, and the cell morphology and structure were significantly changed. Some cells shrank, deformed, and lost their normal spindle or polygonal shape.

[0078] 36-hour and 48-hour treatment groups (e.g.) Figure 4 As shown in the figure): after the exposure time to hypergravity was extended to 36 hours and 48 hours, the number of cardiomyocytes decreased further, the morphological characteristics were more significantly different, the intercellular connections were reduced, and some cells showed apoptosis-like morphology (such as cell shrinkage and nuclear condensation).

[0079] 72-hour processing group (e.g.) Figure 5 As shown in the figure): After 72 hours of treatment, the number of cardiomyocytes dropped to a low level, and the morphological characteristics were most different from those of the control group. Most of the cells lost their normal cardiomyocyte morphology and cell viability decreased significantly.

[0080] (2) Cell viability test results

[0081] like Figure 6 As shown (based on) Figure 5 (Statistical analysis of data) Compared with the 1G control group, 3G hypergravity significantly reduced the number of surviving cardiomyocytes at different treatment time points (12, 24, 36, 48, 72, and 96 hours), and the number of surviving cells gradually decreased with the extension of treatment time. This result suggests that hypergravity has a certain cytotoxic effect on cardiomyocytes, inhibiting cell growth and reducing cell viability.

[0082] (3) Cell cycle detection results

[0083] like Figure 7 As shown in Figures A through C, flow cytometry analysis revealed the distribution of cardiomyocytes in different phases of the cell cycle after 3G hypergravity treatment. Compared to the 1G control group: the proportion of cells in G1 phase decreased significantly, indicating that hypergravity treatment inhibited the transition of cells from G1 to S phase, affecting the initiation of the cell cycle. The number of cells in S phase and G2 / M phase increased significantly, suggesting that hypergravity may cause cell arrest in the S phase (DNA synthesis phase) and G2 / M phase (mitosis phase), leading to the accumulation of cells in these two phases.

[0084] Statistical significance: The data are the mean ± standard error (SEM) of three different biological replicate experiments, demonstrating that the change in cell cycle distribution is statistically significant.

[0085] (4) Cardiac cell-specific gene expression

[0086] like Figure 8 As shown, the expression changes of cardiomyocyte-specific genes TNNI1 and TNNI3 were detected by qRT-PCR:

[0087] TNNI1 gene (e.g.) Figure 8 A in Figure 8 (As shown in B in the figure): TNNI1 is a skeletal muscle-specific gene that maintains the structure of cardiomyocytes. After 3G hypergravity treatment, its expression level was significantly downregulated, indicating that hypergravity may seriously affect the structural development of muscle tissue and interfere with the normal structural formation of cardiomyocytes.

[0088] TNNI3 gene (e.g.) Figure 8 (As shown in A~C): TNNI3 is associated with myocardial ischemia, myocardial hypertrophy, and neuroendocrine inflammation. After exposure to 3G hypergravity, the expression of this gene was significantly upregulated, suggesting that hypergravity treatment may cause damage to cardiomyocytes and may trigger related pathophysiological processes (such as phosphorylation related to myocardial hypertrophy).

[0089] (5) Transcriptome sequencing results (differentially expressed genes)

[0090] like Figure 9 As shown in the heatmap analysis, transcriptome data from newborn mouse heart samples after 3G hypergravity treatment were analyzed. In the heatmap, the chromatographic bars change from red (high expression) to green (low expression) to represent changes in gene expression levels. Results show:

[0091] After exposure to hypergravity, multiple genes in the hearts of newborn mice showed significant differential expression (upregulation or downregulation).

[0092] Among them, genes involved in endothelial cell proliferation, angiogenesis, and immune cell adhesion were significantly downregulated, suggesting that hypergravity not only affects cardiomyocytes themselves, but may also indirectly affect the microenvironment of myocardial tissue (such as angiogenesis) and immune-related functions by regulating the expression of these related genes.

[0093] (6) Expression of epigenetic-related genes

[0094] like Figure 10 As shown, the effect of hypergravity on the transcriptional level of the epigenetic gene MET1 (DNA methyltransferase) was detected by qPCR:

[0095] When cardiomyocytes were exposed to a 3G hypergravity environment, the relative transcription level of the MET1 gene was significantly upregulated compared with the 1G control group.

[0096] The data are the mean ± standard error of three replicate experiments, demonstrating that the upregulation of MET1 gene expression is statistically significant, suggesting that hypergravity may affect DNA methylation by regulating the expression of this gene.

[0097] (7) Results of epigenetic marker detection

[0098] like Figure 11 As shown, flow cytometry was used to quantitatively analyze DNA methylation markers (5-methyldeoxycytidine; 5mdc) and histone H4 acetylation markers (acetylated histone H4; AcH4). The subjects were 10,000 cells labeled with specific antibodies. The results are as follows:

[0099] DNA methylation (5mdc): Compared with the 1G control group, the 5mdc level in the 3G hypergravity treatment group was significantly increased, indicating that the hypermethylation pattern of cardiomyocytes increased under hypergravity conditions, and this was statistically significant (* indicates P value <0.05).

[0100] Histone H4 acetylation (AcH4): AcH4 levels changed rapidly after changes in gravity conditions. AcH4 levels decreased significantly after 3G hypergravity exposure, suggesting that hypergravity treatment inhibits the acetylation process of histone H4.

[0101] The results showed that hypermethylation patterns increased under hypergravity exposure, with statistically significant hypermethylation compared to the control group. Furthermore, histone acetylation, as measured by flow cytometry and anti-AcH4 antibody, changed rapidly after alteration of gravity conditions and significantly decreased after hypergravity exposure.

[0102] These observations are consistent with the upregulation of DNA methyltransferase (MET1) gene transcription detected by qPCR. Since 5mdc (5-methyldeoxycytidine) is primarily involved in maintaining symmetrical cytosine methylation, this suggests that DNA methylation may be involved in gene transcriptional regulation in response to gravity stress. Similarly, we analyzed histone acetylation. With prolonged exposure to simulated weightlessness, the presence of acetylated histone H4 gradually decreased, indicating that weightlessness leads to histone deacetylation.

[0103] 4. Summary

[0104] Understanding the full impacts of gravity variations is one of the greatest challenges facing space biology, as they have significant and pervasive effects on cell development. Importantly, this study provides an effective and cost-efficient strategy for simulating hypergravity effects in vitro. Our data indicate that hypergravity environments place severe stress on cardiomyocyte growth. However, this research also provides clues about gravitational stress-related epigenetic variations that contribute to adaptation and survival in environments with varying gravity. While this design for hypergravity research is promising, further testing and validation with real-world flight data are necessary in the future.

[0105] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0106] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A method for in vitro preparation of cardiomyocytes under hypergravity conditions, characterized in that, include: Step 1: Adhesive culture of cardiomyocytes on a two-dimensional matrix; Step 2: Mix the cardiomyocytes cultured in two dimensions in Step 1 with matrix gel to form a three-dimensional culture system; Step 3: Place the three-dimensional culture system obtained in Step 2 into a hypergravity environment for cultivation; The gravity intensity of the hypergravity environment is 3G, and the treatment time is 12 to 96 hours.

2. The in vitro preparation method according to claim 1, characterized in that, The two-dimensional matrix is ​​a gelatin-coated polystyrene coverslip; the adherent culture includes: seeding the cardiomyocytes onto the gelatin-coated polystyrene coverslip and culturing them under a gravitational acceleration of 1G.

3. The in vitro preparation method according to claim 2, characterized in that, The incubation time is 1-2 hours under a gravitational acceleration of 1g.

4. The in vitro preparation method according to claim 2, characterized in that, Polystyrene coverslips coated with gelatin solution were placed in well plates, followed by seeding of cardiomyocytes at a density of 3–4 × 10⁻⁴. 4 Cells / coverslip 5. The in vitro preparation method according to claim 1, characterized in that, The mixing ratio of the cardiomyocytes and matrix gel is 1~1.5×10⁻⁶ per 200 μL of mixture. 4 Each cell.

6. The in vitro preparation method according to claim 5, characterized in that, After the cardiomyocytes are mixed with the matrix gel, they are incubated at 37°C for 30-45 minutes to allow the matrix gel to solidify.

7. The application of cardiomyocytes obtained by the in vitro preparation method of cardiomyocytes under hypergravity conditions as described in any one of claims 1 to 5 in the study of the biological effects of gravity changes on cardiomyocytes.

8. A kit for detecting the effects of hypergravity on cardiomyocytes, characterized in that, The kit contains primer pairs for detecting the expression levels of cardiomyocyte-specific genes TNNI1 and / or TNNI3, the sequences of which are shown in SEQ ID NO:1 to SEQ ID NO:

4.

9. The reagent kit as described in claim 8, characterized in that, The kit also contains primer pairs for detecting the expression level of the DNA methyltransferase MET1 gene, the sequences of which are shown in SEQ ID NO: 5 and SEQ ID NO:

6.

10. The kit as described in claim 8 or 9, characterized in that, The kit also contains antibodies for detecting epigenetic markers, including 5-methyldeoxycytidine and acetylated histone H4.