Phosphoenolpyruvate carboxylase mutant with enhanced thermal stability and application of phosphoenolpyruvate carboxylase mutant
By mutating specific amino acid sequences of phosphoenolpyruvate carboxylase, the problems of insufficient thermal stability and catalytic efficiency of the enzyme were solved, resulting in higher thermal stability and oxaloacetic acid production rate, making it suitable for industrial applications.
Patent Information
- Application Number
- CN202411043581.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-31
- Publication Date
- 2026-02-10
AI Technical Summary
The existing phosphoenolpyruvate carboxylase has insufficient thermal stability and catalytic efficiency, which limits its application in in vitro enzyme catalysis systems.
The thermostability and catalytic efficiency of phosphoenolpyruvate carboxylase can be improved by performing single-point or combined mutations in specific amino acid sequences, including P424S, N513R, R683F, V800P, and C886R.
The mutant exhibits significantly improved thermal stability and a substantial increase in the production rate of oxaloacetic acid, making it suitable for industrial applications.
Smart Images

Figure BDA0004972952920000051 
Figure BDA0004972952920000071 
Figure BDA0004972952920000081
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular biology and bioengineering, specifically to a phosphoenolpyruvate carboxylase mutant and its applications. Background Technology
[0002] Phosphoenolpyruvate carboxylase is a carbon-fixing enzyme that synthesizes oxaloacetate from phosphoenolpyruvate and inorganic one-carbon compounds. First discovered in spinach leaves, this enzyme has a molecular size of 100–110 kDa and exists primarily as a homotetramer within cells (Lorrenne C, et al. Differential Expression, Tissue-Specific Distribution, and Posttranslational Controls of Phosphoenolpyruvate Carboxylase. 2021). Cloning phosphoenolpyruvate carboxylase from *Escherichia coli* has provided a more accurate understanding of its protein sequence. Currently, phosphoenolpyruvate carboxylases are mainly found in plants, algae, and bacteria; they have not been found in animals or fungi (Katsura I, et al. PHOSPHOENOLPYRUVATE CARBOXYLASE: A New Era of Structural Biology. 2004).
[0003] Phosphoenolpyruvate carboxylase is a key enzyme in the C4 pathway, which plays a crucial connecting role in glycolysis and the TCA cycle. Furthermore, oxaloacetate, the first carbon fixation product of the C4 pathway, is a precursor to many organic acids and amino acids (Martha L. The Roles of Organic Acids in C4 Photosynthesis. 2016). By constructing phosphoenolpyruvate carboxylase for carbon fixation in vitro, compared to in vivo microbial methods, better mass transfer (Pattarawan I, et al. Enzymes, In Vivo Biocatalysis, and Metabolic Engineering for Enabling a Circular Economy and Sustainability. 2021), more efficient carbon fixation and the synthesis of oxaloacetate, a precursor to various organic acids and amino acids, can be achieved. Compared to in vivo enzyme catalysis, in vitro enzyme catalysis systems have higher requirements for enzyme activity and stability. Therefore, obtaining phosphoenolpyruvate carboxylase with good thermal stability and activity will be more conducive to the construction of in vitro enzyme catalysis systems (Sharma A, et al. Enzyme engineering: current trends and future perspectives. 2021). Summary of the Invention
[0004] The purpose of this invention is to provide a phosphoenolpyruvate carboxylase mutant with higher enzyme thermal stability and catalytic reaction efficiency.
[0005] The second objective of this invention is to provide the application of a phosphoenolpyruvate carboxylase mutant in the preparation of oxaloacetate, wherein the phosphoenolpyruvate carboxylase mutant exhibits significantly improved enzymatic thermostability for carbon fixation to obtain oxaloacetate compared to the wild-type enzyme.
[0006] To achieve the above objectives, the present invention provides a phosphoenolpyruvate carboxylase mutant. The amino acid sequence of the mutant, compared to the wild-type phosphoenolpyruvate carboxylase (derived from Cannabis sativa) shown in SEQ ID NO.1, includes single-point mutations or combination mutations at the following sites: the single-point mutation is one of the following: proline P at position 424 is mutated to serine S; asparagine N at position 513 is mutated to arginine R; arginine R at position 683 is mutated to phenylalanine F; valine V at position 800 is mutated to proline P; and cysteine C at position 886 is mutated to arginine R. The combination mutation is a combination of two or more of the single-point mutations.
[0007] In a preferred embodiment, single-point mutations include:
[0008] The proline (P) at position 424 is mutated to serine (S), and this mutation is conventionally named P424S.
[0009] The asparagine (N) at position 513 is mutated to arginine (R), and this mutation is conventionally named N513R;
[0010] The arginine (R) at position 683 is mutated to phenylalanine (F), and this mutation is conventionally named R683F;
[0011] The valine (V) at position 800 is mutated to proline (P), and this mutation is conventionally named V800P.
[0012] The cysteine (C) at position 886 is mutated to arginine (R), and this mutation is conventionally named C886R.
[0013] As a preferred embodiment, the combined mutation is a combination of two, three, or four mutations from the single-point mutations, wherein the combined mutation includes at least the mutation of proline P at position 424 to serine S.
[0014] As a preferred embodiment, the combined mutation also includes at least a mutation at position 800, where valine V is mutated to proline P.
[0015] As a preferred embodiment, the combined mutation is a mutation of proline P at position 424 to serine S and a mutation of valine V at position 800 to proline P.
[0016] As a preferred embodiment, the combined mutation is a mutation of proline P at position 424 to serine S, a mutation of valine V at position 800 to proline P, and a mutation of cysteine C at position 886 to arginine R.
[0017] As a preferred embodiment, the combined mutation is as follows: proline at position 424 (P) is mutated to serine (S), valine at position 800 (V) is mutated to proline (P), cysteine at position 886 (C) is mutated to arginine (R), and asparagine at position 513 (N) is mutated to arginine (R).
[0018] The present invention also provides a recombinant vector or recombinant bacteria encoding the gene of a phosphoenolpyruvate carboxylase mutant.
[0019] This invention also provides the application of the phosphoenolpyruvate carboxylase mutant in the preparation of oxaloacetic acid, using the phosphoenolpyruvate carboxylase mutant as a catalyst to prepare oxaloacetic acid with phosphoenolpyruvate and inorganic one-carbon compounds as substrates.
[0020] As a preferred embodiment, the inorganic one-carbon compound includes carbonates and bicarbonates.
[0021] The advantage of this invention is that, compared with the wild-type enzyme, the phosphoenolpyruvate carboxylase mutant provided by this invention has significantly improved thermal stability and the production rate of carbon fixation to prepare oxaloacetic acid, and has good prospects for industrial application. Detailed Implementation
[0022] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to specific examples. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the materials and reagents used are commercially available. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0023] Example 1: Preparation of phosphoenolpyruvate carboxylase
[0024] The plasmid containing wild-type phosphoenolpyruvate carboxylase (derived from Cannabis sativa, sequence shown in SEQ ID NO. 1) was transformed into BL21(DE3) to obtain recombinant bacteria.
[0025] Recombinant bacteria were inoculated into 50 ml of LB containing 50 mg / L kanamycin and cultured at 37°C and 220 rpm for 6-8 h. Then, 2% of the bacteria were inoculated into 100 ml of LB and cultured at 37°C. When the OD600 reached 0.6-0.8, IPTG was added to a final concentration of 0.2 mM and induced at 18°C and 220 rpm for 16-18 h.
[0026] (2) Centrifuge at 6000 rpm and 4℃ for 5 min to collect bacterial cells. Discard the supernatant and resuspend the bacterial cells in an appropriate amount of pH 8.0 buffer containing 10 mM imidazole, 300 mM NaCl, and 50 mM NaH2PO4. Turn on the cooling water circulator in advance to cool down to 5℃. Then add the resuspended bacterial cells to a homogenizer for homogenization at a pressure of 600-800 bar and a flow rate of 35 for about 30 cycles until the bacterial solution becomes clear.
[0027] (3) Collect the lysed bacterial cells and centrifuge at 4000 rpm and 4℃ for 20 min. Prepare an elution buffer containing gradient concentrations of imidazole (0 mM, 10 mM, 60 mM, 100 mM, 120 mM, 200 mM, 500 mM) in pH 8.0, 300 mM NaCl, and 50 mM NaH2PO4. Pour the supernatant from the centrifugation into a nickel column and elute with the above buffer. Elute 5 column volumes with 0-100 mM imidazole buffer, 1 column volume with 120 mM imidazole buffer, and 5 column volumes with 200 mM imidazole buffer. Collect the eluent, wash several times with buffer containing 500 mM imidazole, then wash with pure water. Finally, store the chromatography column in a pH 8.0 buffer containing 300 mM NaCl and 50 mM NaH2PO4.
[0028] (4) Add the eluent collected at a concentration of 150 mM imidazole to an ultrafiltration membrane with a pore size of 10000 M WCO, centrifuge at 4200 g and 4 °C, then add a buffer containing 0 mM imidazole to remove the imidazole. When the remaining protein volume after centrifugation is about 0.5 ml, transfer the protein to a 1.5 mL centrifuge tube, add 0.5 mL of 50% molecular grade glycerol, mix well, and aliquot into small centrifuge tubes at 100 μL. Then store at -80 °C for later use.
[0029] Example 2: Determination of phosphoenolpyruvate carboxylase activity
[0030] The reaction system contained 50 mM Tris-HCl buffer at pH 8.0. 20 mM phosphoenolpyruvate, 60 mM sodium bicarbonate, and 10 mM magnesium chloride were added, along with an appropriate amount of purified enzyme. The system was then brought to 1 mL with water to obtain the reaction solution.
[0031] The reaction solution was reacted at 60℃ for 3 min. A sample was taken, and 1M hydrochloric acid was added at a volume ratio of 1:1 to terminate the reaction. The sample was placed on ice for 10 min, then centrifuged at 12000 rpm for 10 min. The supernatant was collected, and the content of oxaloacetic acid was detected by high performance liquid chromatography.
[0032] Enzyme activity was calculated based on the measured oxaloacetic acid concentration, and the enzyme activity unit (U) was defined as: the amount of enzyme required to catalyze the production of 1 μmol of product within 1 minute under the conditions of 60℃ and pH 8.0.
[0033] Example 3: Determination of the thermal stability of phosphoenolpyruvate carboxylase
[0034] The purified phosphoenolpyruvate carboxylase was heat-incubated at 50°C in a buffer solution of 300 mM NaCl and 50 mM NaH2PO4 at pH 8.0. The activity of the purified phosphoenolpyruvate carboxylase was measured after heat incubation for 0 h, 1 h, 2 h, 3 h, 4 h, and 5 h.
[0035] The reaction system contained 50 mM Tris-HCl buffer at pH 8.0. 20 mM phosphoenolpyruvate, 60 mM sodium bicarbonate, and 10 mM magnesium chloride were added, along with an appropriate amount of purified enzyme. The system was then brought to 1 mL with water to obtain the reaction solution.
[0036] The reaction solution was reacted at 60℃ for 3 min. A sample was taken, and 1M hydrochloric acid was added at a volume ratio of 1:1 to terminate the reaction. The sample was placed on ice for 10 min, then centrifuged at 12000 rpm for 10 min. The supernatant was collected, and the content of oxaloacetic acid was detected by high performance liquid chromatography.
[0037] Enzyme activity was calculated based on the measured oxaloacetic acid concentration, and the enzyme activity unit (U) was defined as: the amount of enzyme required to catalyze the production of 1 μmol of product within 1 minute under the conditions of 60℃ and pH 8.0.
[0038] The activity of phosphoenolpyruvate carboxylase purified by heat incubation at 50°C for 0 hours is defined as 100%.
[0039] Example 4: Construction of mutants
[0040] Using the pET28a recombinant plasmid containing the wild-type phosphoenolpyruvate carboxylase gene as a template, site-directed mutagenesis was performed at the aforementioned sites. Primers were designed using oligo7 software, and PCR site-directed mutagenesis was then performed. The primers are shown in Table 1.
[0041] Table 1. Primer sequences (SEQ ID NO.2~SEQ ID NO.13)
[0042]
[0043] Table 2. Reaction System
[0044] template 6μl DNA polymerase 50μl F primer 6μl R primer 6μl <![CDATA[ddH2O]]> 32μl Total volume 100μl
[0045] Table 3. PCR Cycle Process
[0046] preheating 98℃ for 5 minutes transsexual 98℃10s annealing 58℃30s extend 72℃ for 1 minute and 30 seconds Final extension 72℃ for 10 minutes
[0047] The denaturation-annealing-extension cycle was repeated 30 times. The DNA polymerase was purchased from Baori Biotechnology Co., Ltd. (Beijing). The PCR products were recovered, detected by agarose (1%) gel electrophoresis, and then ligated.
[0048] Table 4. Connection System
[0049] Amplified fragments 8μl carrier 2μl One-step ligase 10μl Total volume 20μl
[0050] After thorough mixing, the mixture was ligated at 50°C for 30 minutes. The ligase used in one step was purchased from Hanheng Biotechnology Co., Ltd. (Shanghai). The ligation product was transformed into E. coli, and single clones were selected and sequenced after being cultured on kanamycin-resistant plates to verify the sequence correctness, thus obtaining the mutant plasmid.
[0051] Example 5: Determination of the activity of phosphoenolpyruvate carboxylase mutant
[0052] The collected mutant containing phosphoenolpyruvate carboxylase was prepared into a pure enzyme using the preparation method of Example 1.
[0053] The reaction system contained 50 mM Tris-HCl buffer at pH 8.0. 20 mM phosphoenolpyruvate, 60 mM sodium bicarbonate, and 10 mM magnesium chloride were added, along with an appropriate amount of purified enzyme. The system was then brought to 1 mL with water to obtain the reaction solution.
[0054] The reaction solution was reacted at 60℃ for 3 min. A sample was taken, and 1M hydrochloric acid was added at a volume ratio of 1:1 to terminate the reaction. The sample was placed on ice for 10 min, then centrifuged at 12000 rpm for 10 min. The supernatant was collected, and the content of oxaloacetic acid was detected by high performance liquid chromatography.
[0055] Enzyme activity was calculated based on the measured oxaloacetic acid concentration, and the enzyme activity unit (U) was defined as: the amount of enzyme required to catalyze the production of 1 μmol of product within 1 minute at 60℃ and pH 8.0. The calculation results are shown in Table 5.
[0056] Example 6: Determination of the thermal stability of phosphoenolpyruvate carboxylase
[0057] The purified phosphoenolpyruvate carboxylase mutant enzyme was heat-incubated at 50°C in a buffer solution of 300 mM NaCl and 50 mM NaH2PO4 at pH 8.0. The activity of the purified phosphoenolpyruvate carboxylase was measured after heat incubation for 0 h, 1 h, 2 h, 3 h, 4 h, and 5 h.
[0058] The purified phosphoenolpyruvate carboxylase was heat-incubated at 50°C in a buffer solution of 300 mM NaCl and 50 mM NaH2PO4 at pH 8.0. The activity of the purified phosphoenolpyruvate carboxylase was measured after heat incubation for 0 h, 1 h, 2 h, 3 h, 4 h, and 5 h.
[0059] The reaction system contained 50 mM Tris-HCl buffer at pH 8.0. 20 mM phosphoenolpyruvate, 60 mM sodium bicarbonate, and 10 mM magnesium chloride were added, along with an appropriate amount of purified enzyme. The system was then brought to 1 mL with water to obtain the reaction solution.
[0060] The reaction solution was reacted at 60℃ for 3 min. A sample was taken, and 1M hydrochloric acid was added at a volume ratio of 1:1 to terminate the reaction. The sample was placed on ice for 10 min, then centrifuged at 12000 rpm for 10 min. The supernatant was collected, and the content of oxaloacetic acid was detected by high performance liquid chromatography.
[0061] Enzyme activity was calculated based on the measured oxaloacetic acid concentration, and the enzyme activity unit (U) was defined as: the amount of enzyme required to catalyze the production of 1 μmol of product within 1 minute under the conditions of 60℃ and pH 8.0.
[0062] The activity of 100% of the purified phosphoenolpyruvate carboxylase enzyme was defined as 0 h of heat incubation at 50°C. The half-life of the enzyme was defined as the heat incubation time required to retain 50% of its original activity. The half-life of the wild-type phosphoenolpyruvate carboxylase enzyme was defined as 100%. The calculation results are shown in Table 5.
[0063] Table 5. Calculation results of enzyme activity and stability
[0064]
[0065]
[0066] The results show that the stability of P424S, N513R, R683F, V800P, and C886R was improved, while their activity remained basically unchanged or improved.
[0067] Example 7: Preparation of combinatorial mutation of phosphoenolpyruvate carboxylase
[0068] As shown in Example 6, mutations at five sites increase the stability of phosphoenolpyruvate carboxylase. Therefore, the combination of these sites may result in a synergistic increase in activity. These sites were combined using the DNA Shuffling method, specifically as follows:
[0069] Primers were designed based on the phosphoenolpyruvate carboxylase sequence to amplify the entire gene. The specific primer sequences are (SEQ ID NO.14~SEQ ID NO.15):
[0070] F1-HindIII:gtggacagcaaatgggtcgcggatccatgtctaaccgtagcctgg
[0071] R1-BamHI:gtggtggtggtgctcgagttaaccggtgttctgcatgcccgctg
[0072] The above primer pairs were used to amplify five mutant genes: P424S, N513R, R683F, V800P, and C886R. The obtained DNA fragments were treated with DNase I for a short time and then amplified by PCR to obtain combined mutant phosphoenolpyruvate carboxylase fragments. Then, expression vectors were constructed using conventional gene cloning methods and transformed into Escherichia coli BL21(DE3) strain.
[0073] After screening, three mutants were obtained that maintained the original activity but had improved stability, and were named M1, M2 and M3, respectively. Plasmids were extracted from the three mutants and sequenced.
[0074] The enzyme activity and thermostability of the three mutants were determined according to the methods in Examples 5 and 6, as shown in Table 6.
[0075] Table 6. Enzyme activity and thermal stability of the three mutants
[0076] mutant mutation site Enzyme activity (U / mg) Enzyme activity percentage (%) Half-life percentage (%) M1 P424S, V800P 168.4 114.7 405.6 M2 P424S, V800P, C886R 213.6 145.5 732.7 M3 P424S, N513R, V800P, C886R 197.8 134.7 982.4
[0077] Example 8: Production of oxaloacetic acid by a variant of phosphoenolpyruvate carboxylase
[0078] The reaction system contained 50 mM Tris-HCl buffer at pH 8.0. 200 mM phosphoenolpyruvate, 600 mM sodium bicarbonate, 10 mM magnesium chloride, and 0.01-0.1 g / L of different phosphoenolpyruvate carboxylase mutants were added separately. Water was added to bring the volume to 1 mL, and the reaction was allowed to proceed for 1 h. The oxaloacetic acid content was then determined by high-performance liquid chromatography (HPLC). Details are shown in Table 7 below.
[0079] Table 7. Oxaloacetic acid production levels in different mutant strains
[0080] enzymes Production rate (mM / min) Production (mM) Increase the percentage (%) wild 0.89 53.1 100 P424S 1.32 79.1 149 N513R 1.16 69.8 131 R683F 1.09 65.4 123 V800P 1.35 81.2 153 C886R 1.47 88.1 166 M1 1.64 98.6 186 M2 2.10 125.8 237 M3 2.38 142.7 269
[0081] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A phosphoenolpyruvate carboxylase mutant, characterized in that, Compared with the wild-type phosphoenolpyruvate carboxylase shown in SEQ ID NO.1, the amino acid sequence of the mutant includes single-point mutations or combination mutations at the following sites: the single-point mutation is one of the following: proline P at position 424 is mutated to serine S, asparagine N at position 513 is mutated to arginine R, arginine R at position 683 is mutated to phenylalanine F, valine V at position 800 is mutated to proline P, and cysteine C at position 886 is mutated to arginine R; the combination mutation is a combination of two or more of the single-point mutations.
2. The phosphoenolpyruvate carboxylase mutant according to claim 1, characterized in that, The combined mutation is a combination of two, three, or four mutations from the single-point mutations, and the combined mutation includes at least the mutation of proline P at position 424 to serine S.
3. The phosphoenolpyruvate carboxylase mutant according to claim 2, characterized in that, The combined mutations also include at least one mutation at position 800, where valine (V) is mutated to proline (P).
4. The phosphoenolpyruvate carboxylase mutant according to claim 2, characterized in that, The combined mutation is that proline P at position 424 is mutated to serine S, and valine V at position 800 is mutated to proline P.
5. The phosphoenolpyruvate carboxylase mutant according to claim 2, characterized in that, The combined mutations are: proline P at position 424 is mutated to serine S, valine V at position 800 is mutated to proline P, and cysteine C at position 886 is mutated to arginine R.
6. The phosphoenolpyruvate carboxylase mutant according to claim 2, characterized in that, The combined mutations are: proline P at position 424 is mutated to serine S, valine V at position 800 is mutated to proline P, cysteine C at position 886 is mutated to arginine R, and asparagine N at position 513 is mutated to arginine R.
7. A recombinant vector or recombinant bacterium encoding the gene of the phosphoenolpyruvate carboxylase mutant according to any one of claims 1-6.
8. The use of the phosphoenolpyruvate carboxylase mutant according to any one of claims 1-6 in the preparation of oxaloacetic acid, characterized in that, Oxaloacetic acid was prepared using the phosphoenolpyruvate carboxylase mutant as a catalyst and phosphoenolpyruvate and inorganic one-carbon compounds as substrates.
9. The application of the phosphoenolpyruvate carboxylase mutant according to claim 8 in the preparation of oxaloacetic acid, characterized in that, The inorganic one-carbon compounds include carbonates and bicarbonates.