TaSIZ1 protein, TaSIZ1 gene and related biological materials in improving drought resistance of plants
By knocking out the wheat TaSIZ1 gene using CRISPR/Cas9 gene editing technology, the problem of the unclear role of the TaSIZ1 gene in regulating drought resistance was solved, which significantly improved the drought resistance of wheat and enhanced the fresh weight and survival rate of the aboveground parts.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANDONG UNIV
- Filing Date
- 2026-01-30
- Publication Date
- 2026-06-05
AI Technical Summary
The regulatory role of the wheat TaSIZ1 gene in drought resistance is unclear in existing technologies, making it difficult to target and utilize this gene for drought-resistant breeding.
By knocking out or silencing the wheat TaSIZ1 gene using CRISPR/Cas9 gene editing technology, designing specific guide single-stranded RNA (sgRNA), and constructing an expression vector, the TaSIZ1 gene can be rendered ineffective, thereby enhancing plant drought resistance.
This study significantly increased the aboveground fresh weight of wheat under drought stress, reduced wilting, and enhanced survival rate, providing a practical method for breeding drought-resistant wheat.
Smart Images

Figure CN121592708B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the application of TaSIZ1 protein, TaSIZ1 gene and related biomaterials in improving plant drought resistance. Background Technology
[0002] Drought and water scarcity are significant limiting factors for wheat production, particularly in major wheat-producing areas. Existing high-yielding varieties have high requirements for fertilizer and water, and there is an urgent need for high-yielding and stable-yielding varieties that can be developed with reduced irrigation. Therefore, in-depth analysis of the molecular regulatory mechanisms of wheat drought resistance is of great significance for breeding new drought-resistant varieties.
[0003] Post-translational modification is a crucial mechanism for plants to rapidly alter protein function during environmental stress responses. SUMOylation, through an E1-E2-E3 enzyme cascade, covalently links ubiquitin-like small molecule modifiers to lysine residues of substrate proteins, participating in responses to various abiotic stresses such as drought. The SUMO E3 ligase SIZ1, as a core component of this modification system, plays a decisive role in the regulation of plant stress resistance. Currently, the regulatory role of the wheat TaSIZ1 gene in drought resistance remains unclear, and its functional mechanism lacks systematic research, making it difficult to target this gene for drought-resistant breeding. Summary of the Invention
[0004] To address the shortcomings of existing technologies, the purpose of this invention is to provide the application of TaSIZ1 protein, TaSIZ1 gene and related biomaterials in improving plant drought resistance.
[0005] To achieve the above objectives, the present invention provides the following technical solution:
[0006] In a first aspect, the present invention provides the application of TaSIZ1 protein, TaSIZ1 gene and related biomaterials in improving plant drought resistance, wherein the TaSIZ1 protein includes TaSIZ1-1A, TaSIZ1-1B and TaSIZ1-1D;
[0007] The amino acid sequence of TaSIZ1-1A is as follows (A1) or (A2):
[0008] (A1) A protein containing the amino acid residues shown in SEQ ID NO:4;
[0009] (A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in (A1).
[0010] The amino acid sequence of TaSIZ1-1B is as follows (B1) or (B2) or (B3):
[0011] (B1) A protein containing the amino acid residues shown in SEQ ID NO:5;
[0012] (B2) A protein containing the amino acid residues shown in SEQ ID NO:6;
[0013] (B3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins shown in (B1) to (B2).
[0014] The amino acid sequence of TaSIZ1-1D is as follows (C1) or (C2) or (C3):
[0015] (C1) A protein containing the amino acid residues shown in SEQ ID NO:7;
[0016] (C2) A protein containing the amino acid residues shown in SEQ ID NO:8;
[0017] (C3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the proteins shown in (C1) to (C2).
[0018] The TaSIZ1 gene is derived from wheat, and its three copies (A, B, and D) in wheat are shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively. The above applications are achieved by silencing, knocking down, or eliminating the TaSIZ1 gene.
[0019] Preferably, the protein tag may be a Flag tag, His tag, MBP tag, HA tag, Myc tag, GST tag and / or SUMO tag, etc.
[0020] Preferably, the TaSIZ1 gene is derived from wheat, and its three copy coding sequences A, B, and D in wheat are shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively; the application is achieved by silencing, knocking down, or eliminating the TaSIZ1 gene.
[0021] Preferably, the gene silencing is post-transcriptional gene silencing, that is, gene inactivation at the post-transcriptional level by specifically inhibiting target RNA, including antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.
[0022] Preferably, knocking out the three copies (TaSIZ1-1A, TaSIZ1-1B, and TaSIZ1-1D) of the TaSIZ1 gene in wheat can be achieved using gene editing technology through homologous recombination (HR) or non-homologous end joining (NHEJ) repair, resulting in the deletion, addition, truncation, or replacement of the TaSIZ1 gene sequence; alternatively, it can be achieved by adding an exogenous donor template, thereby causing a mutation in the wheat TaSIZ1 protein, which will prematurely terminate its translation.
[0023] The present invention also provides a method for improving the drought resistance of wheat, which includes silencing, knocking down or eliminating the endogenous TaSIZ1 gene in wheat. The TaSIZ1 gene has three copies, A, B and D, in wheat, and its coding sequence is shown in SEQ ID NO:1~SEQ ID NO:3. The method is achieved by simultaneously silencing or eliminating the three copies A, B and D of the TaSIZ1 gene in wheat.
[0024] In this invention, improving plant drought resistance includes changes in at least one of the following indicators: increasing the fresh weight of the aboveground parts of the plant, reducing the degree of wilting of the plant under drought stress, and / or increasing the survival rate of the plant under drought stress.
[0025] The aboveground fresh weight refers to the fresh weight of the wheat plant from the ground to its highest point. Reducing wheat wilting under drought stress means that wheat plants containing the wheat TaSIZ1 protein or related biological materials described in this invention exhibit lower wilting levels under drought stress than wheat plants containing wild-type parental TaSIZ1 protein. Improving wheat survival rate after rehydration following drought stress means that wheat plants containing the wheat TaSIZ1 protein or related biological materials described in this invention exhibit higher survival rates after rehydration following drought stress than wheat plants containing wild-type parental TaSIZ1 protein.
[0026] In this invention, the plant is selected from at least one of rice, corn, soybean, sunflower, sorghum, wheat, alfalfa, cotton, barley, and millet. Wheat is preferred.
[0027] The present invention also provides a drought-resistant wheat, wherein the three copies A, B and D of the endogenous TaSIZ1 gene of the drought-resistant wheat are silenced, knocked down or knocked out, and the coding sequences of the three copies A, B and D of the TaSIZ1 gene are shown in SEQ ID NO:1~SEQ ID NO:3.
[0028] Preferably, the drought-resistant wheat is a homozygous mutant plant with endogenous TaSIZ1 gene knockout (or knockdown) or a heterozygous mutant plant.
[0029] Preferably, the drought-resistant wheat is a homozygous mutant plant with endogenous TaSIZ1 gene knockout or a homozygous mutant plant with endogenous TaSIZ1 gene knockdown.
[0030] Preferably, the drought-resistant wheat is an endogenous TaSIZ1 gene knockout heterozygous mutant plant or an endogenous TaSIZ1 gene knockdown heterozygous mutant plant.
[0031] Preferably, the drought-resistant wheat is a hybrid plant composed of a homozygous mutant plant with an endogenous TaSIZ1 gene knockout (or knockdown) and various inbred lines.
[0032] Preferably, the endogenous TaSIZ1 gene of the drought-resistant wheat is in a heterozygous state.
[0033] Preferably, the endogenous TaSIZ1 gene knockout homozygous mutant plant refers to a plant in which all TaSIZ1 alleles have been knocked out. In some embodiments, the endogenous TaSIZ1 gene knockdown homozygous mutant plant refers to a plant in which all TaSIZ1 alleles have been knocked down.
[0034] Those skilled in the art will readily understand that the knockout or knockdown homozygous mutant plant does not mean that all TaSIZ1 alleles in the plant maintain the same nucleotide sequence; it only requires that all TaSIZ1 alleles in the plant lose their corresponding function or have their function suppressed. For example, the knockout homozygous mutant plant may have all TaSIZ1 alleles knocked out, and its endogenous TaSIZ1 alleles may contain the same or different mutations that lead to the loss of TaSIZ1 gene function (e.g., insertion, deletion, substitution, rearrangement, etc.).
[0035] Preferably, the endogenous TaSIZ1 gene knockout heterozygous mutant plant refers to a plant in which at least one of the TaSIZ1 alleles is not knocked out and at least one is knocked out. In some embodiments, the endogenous TaSIZ1 gene knockdown heterozygous mutant plant refers to a plant in which at least one of the TaSIZ1 alleles is not knocked down and at least one is knocked down.
[0036] Preferably, the drought-resistant wheat plants, compared with wild plants, exhibit changes in at least one of the following indicators: increased fresh weight of the aboveground parts of the plant, reduced wilting degree of the plant under drought stress, and / or increased survival rate of the plant under drought stress.
[0037] The beneficial effects of this invention are as follows:
[0038] This invention reveals for the first time the regulatory role of the TaSIZ1 gene in wheat drought resistance. By designing a specific guide single-stranded RNA (sgRNA) for the TaSIZ1 gene, an expression vector for knocking out the TaSIZ1 gene in wheat was constructed. Through genetic transformation of wheat, the TaSIZ1 gene knockout progeny Tasiz1-6 was obtained. # and Tasiz1-13 # Compared with the wild type, the TaSIZ1 gene knockout mutant showed significantly higher aboveground fresh weight and significantly lower wilting under drought conditions. Rehydration treatment of plants after drought stress significantly improved the survival rate of the TaSIZ1 gene knockout mutant, which can significantly enhance the drought resistance of wheat and provide a practical method for breeding stress-resistant wheat. Attached Figure Description
[0039] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0040] Figure 1 The above are the identification results of T0 generation gene-edited wheat transgenic lines in the embodiments of the present invention; wherein, lane M is Transgen 2K plus marker, lane water is the result of negative control amplification using water as template, lanes 1 to 22 are T0 generation wheat transgenic lines respectively, and lane JW1 is wild-type wheat variety JW1.
[0041] Figure 2 This is the gene editing result of the TaSIZ1 knockout strain in the embodiments of the present invention.
[0042] Figure 3 The amino acid sequence of wild-type TaSIZ1-1A in this embodiment of the invention is compared with that of the knockout homozygous line Tasiz1-6. # A schematic diagram of the amino acid sequence alignment results for TaSIZ1-1A.
[0043] Figure 4 The images show the plant morphology of wild-type wheat JW1, TaSIZ1 gene overexpression line, and TaSIZ1 gene knockout homozygous line under normal growth conditions in the embodiments of the present invention.
[0044] Figure 5 This is a comparison of the fresh weight of the aboveground parts of wild-type wheat JW1, TaSIZ1 gene overexpression lines, and TaSIZ1 gene knockout pure groups under normal growth conditions in the embodiments of the present invention. Different letters above the bars indicate statistically significant differences between the groups.
[0045] Figure 6The images show the plant morphology of wild-type wheat JW1, TaSIZ1 gene overexpression line, and TaSIZ1 gene knockout homozygous line under drought stress in the embodiments of this invention.
[0046] Figure 7 This is a comparison of the fresh weight of the aboveground parts of wild-type wheat JW1, TaSIZ1 gene overexpression line and TaSIZ1 gene knockout homozygous line under drought stress in the embodiments of the present invention. Different letters above the bars indicate statistically significant differences between the groups.
[0047] Figure 8 The images show the plant morphology of wild-type wheat JW1, TaSIZ1 gene overexpression line, and TaSIZ1 gene knockout homozygote line under rehydration conditions after drought stress in the embodiments of the present invention.
[0048] Figure 9 The survival rates of wild-type wheat JW1, TaSIZ1 overexpressing lines, and TaSIZ1 knockout homozygous lines were compared under rehydration conditions after drought stress. Different letters above the bars indicate statistically significant differences between the groups. Detailed Implementation
[0049] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0050] Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions.
[0051] Unless otherwise specified, all experimental materials used in the following examples were purchased from conventional biochemical reagent companies.
[0052] As mentioned earlier, identifying key genes that control the aboveground fresh weight of wheat, the degree of wilting of wheat under drought stress, and the survival rate of wheat under drought stress has important application value for wheat strain improvement and high-yield breeding.
[0053] In view of this, this invention has conducted in-depth research on genes regulating drought resistance in wheat. Using the wild-type wheat variety JW1 as experimental material, this invention employed CRISPR / Cas9 gene editing technology to perform the following mutation treatments on the wheat TaSIZ1-1A, TaSIZ1-1B, and TaSIZ1-1D genes:
[0054] (1) The deletion of base G at position 1030 of the wheat TaSIZ1-1A gene sequence corresponding to SEQ ID NO:1 causes a frameshift mutation, changes the reading frame, and terminates the mutant protein TaSIZ1-1A prematurely at amino acid 251, resulting in loss of the corresponding gene function.
[0055] (2) A deletion of base G at position 1076 of the wheat TaSIZ1-1B gene sequence corresponding to SEQ ID NO:2, or a deletion of base C at position 1077 of the wheat TaSIZ1-1B gene sequence corresponding to SEQ ID NO:2; causing a frameshift mutation, changing the reading frame, and prematurely terminating the mutant protein TaSIZ1-1B from the 251st amino acid, resulting in the loss of the corresponding gene function.
[0056] (3) The G base at position 995 of the wheat TaSIZ1-1D gene sequence corresponding to SEQ ID NO:3 is deleted, or the C base at position 996 of the wheat TaSIZ1-1D gene sequence corresponding to SEQ ID NO:3 is deleted; causing a frameshift mutation, the reading frame changes, the mutant protein TaSIZ1-1D terminates prematurely from the 250th amino acid, and the corresponding gene function is lost.
[0057] The wheat TaSIZ1 mutant was obtained after the above mutation treatment. The amino acid sequence of the wheat TaSIZ1 mutant TaSIZ1-1A is shown in SEQ ID NO:4, the amino acid sequence of the wheat TaSIZ1 mutant TaSIZ1-1B is shown in SEQ ID NO:5 or SEQ ID NO:6, and the amino acid sequence of the wheat TaSIZ1 mutant TaSIZ1-1D is shown in SEQ ID NO:7 or SEQ ID NO:8.
[0058] Comparison between the wheat TaSIZ1 mutant and the wild-type wheat variety JW1 revealed that the TaSIZ1 mutant exhibited significantly increased aboveground fresh weight, significantly reduced wilting under drought stress, and significantly increased survival rate under drought stress, demonstrating significantly enhanced drought resistance. Therefore, mutations in the wheat TaSIZ1-1A, TaSIZ1-1B, and TaSIZ1-1D genes using existing genetic engineering techniques can yield wheat mutants with high drought resistance, laying the foundation for the breeding of drought-resistant wheat.
[0059] The high-fidelity enzyme required for PCR amplification was KOD-FX NEO (Toyobo); restriction endonuclease BsgI, restriction endonuclease BsaI and T4 ligase required for Gibson assembly were all purchased from NEB; gel recovery kit and plasmid extraction kit required for enzyme digestion fragment recovery were purchased from Thermo Fisher Scientific.
[0060] The wheat variety JW1 used in this invention is a new germplasm with good tissue culture ability bred by the Crop Research Institute of Shandong Academy of Agricultural Sciences. It is available to the public from the Crop Research Institute of Shandong Academy of Agricultural Sciences. This biological material is only used to repeat the relevant experiments of this invention and cannot be used for other purposes.
[0061] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0062] Example 1: Vector Construction
[0063] 1. Construction of gene editing vectors
[0064] (1) Design of sgRNA targeting TaSIZ1:
[0065] The IWGSC wheat genome database was used to design sgRNAs that can simultaneously target the coding region of the TaSIZ1 gene. The sgRNA sequence targeting the TaSIZ1 gene was determined, and its nucleotide sequence is: AAGTTCAGTTCAGGATGCAG (SEQ ID NO:9).
[0066] (2) Construction of gene editing vectors:
[0067] The example uses the plant CRISPR / Cas9 gene editing vector pBUE411, which contains the wheat U3 promoter TaU3 to initiate sgRNA. Cas9 mimics the characteristic of grass genes having a high 5' end GC content and is a genetically designed and synthesized plant codon-optimized gene.
[0068] pBUE411 was ligated to the sgRNA designed in step (1) using Gibson assembly to obtain pBUE411-TaSIZ1. The nucleotide sequence information of pBUE411-TaSIZ1 is as follows: pBUE411 is a plant binary expression vector from patent application number "202411320638.3". The nucleotide sequence of TaPND is obtained by replacing the bases at positions 802 to 821 with AAGTTCAGTTCAGGATGCAG (SEQ ID NO:9), which is the nucleotide sequence of pBUE411-TaSIZ1.
[0069] (3) Transformation and identification:
[0070] The pBUE411-TaSIZ1 was transformed into *E. coli* using the following protocol: 15 μL of the ligation product was added to competent *E. coli* Transgen 5α cells and incubated on ice for 30 min. After heat shock at 42°C for 45 s, the cells were immediately incubated on ice for 2 min. Antibiotic-free liquid LB medium was added, and the cells were incubated at 37°C on a shaker for 40 min. The resulting culture was then spread onto solid LB agar plates containing kanamycin and incubated upside down at 37°C for 12 h. Three single clones were selected for sequencing using the primers pBUE411-F and pBUE411-R. pBUE411-F: TTGTAAAACGACGGCCAGTG (SEQ ID NO: 10); pBUE411-R: TGCACTGCAGGCATGCAA (SEQ ID NO: 11).
[0071] Sequencing results showed that the target sequence of sgRNA was detected, and the TaU3 promoter sequence was detected upstream of the target sequence. The sequencing results indicate that the expression cassette E1 containing sgRNA was successfully assembled into the pBUE411 binary expression vector, which proves that the CRISPR / Cas9 gene editing vector of TaSIZ1, namely the recombinant binary expression vector pBUE411-TaSIZ1, was successfully constructed.
[0072] 2. Construction of overexpression vectors
[0073] (1) Cloning of the TaSIZ1 coding sequence
[0074] This experiment was conducted on the wheat variety Chinese Spring (… Chinese spring The sequence of the TaSIZ1-1A gene was amplified from the cDNA of CS using primers TaSIZ1-F (ATGGCGGACCTGGCTTCCTCC, SEQ ID NO:12) and TaSIZ1-R (CTCAGAGTCAGAATCTATTGATAAAC, SEQ ID NO:13).
[0075] The PCR products were recovered using the GeneJET Gel Extraction Kit from Thermo Scientific and then sent to Qingdao Qingke Biotechnology Co., Ltd. for sequencing.
[0076] (2) Construction of overexpression vector pLGY02-TaSIZ1-YFP
[0077] The experimental procedures for the TaSIZ1 product addition A reaction, pENTRY vector linearization, T4 ligation, and LR reaction were carried out in accordance with the patent application number "2025117248021". Finally, the overexpression vector pLGY02-TaSIZ1-YFP was constructed.
[0078] Example 2: Obtaining and Identifying Transgenic Offspring
[0079] 1. Obtained by genetically modified offspring
[0080] The recombinant expression vectors pBUE411-TaSIZ1 and pLGY02-TaSIZ1-YFP constructed in Example 1 were transformed into Agrobacterium EHA105 competent cells, respectively. The specific implementation plan is as follows:
[0081] Thaw EHA105 Agrobacterium competent cells stored at -80℃ in an ice-water bath. Under aseptic conditions, add 1 µg of plasmid DNA to the competent cells, mix gently, and incubate in an ice-water bath for 5 min. Quickly freeze the centrifuge tubes in liquid nitrogen for 5 min, then rapidly place them in a 37℃ water bath for 5 min without agitation. Finally, place the centrifuge tubes in an ice-water bath for 5 min. Under aseptic conditions, add 800 µL of antibiotic-free YEB medium and incubate at 28℃ with shaking for 2–3 h to allow the cells to recover. Centrifuge at 5000 rpm for 3 min, discard the supernatant, collect the cells, add 100 µL of sterile water, gently resuspend the cells by pipetting, and spread on YEB plates containing the appropriate antibiotics, rifampin, and streptomycin. Incubate upside down in a 28℃ incubator for 2–3 days.
[0082] Take JW1 wheat seeds 10-15 days after flowering and remove the embryos under sterile conditions. Pipette 1 mL of Agrobacterium suspension into a 1.5 mL EP tube and add 1.4 μL of acetylsylgenin (0.1 M), mix well. Infect with the prepared bacterial solution for 5 minutes, then place on co-culture medium and incubate in the dark at 23℃ for 3 days. After co-culture, place on resting medium and incubate in the dark at 25℃ for 5 days. Transfer callus tissue to selection medium 1, seal the culture dish with sealing film, and incubate in the dark at 25.5℃ for 2 weeks. After cutting the callus, transfer it to selection medium 2, seal the culture dish again with sealing film, and continue incubation in the dark at 25.5℃ for 2 weeks. After 2 weeks of callus selection, resistant callus showing green buds is transferred to regeneration medium. Seal the culture dish and incubate in a 25℃ incubator under light / dark (16 h / 8 h) conditions for 2 weeks. After 2 weeks of regeneration, transfer healthy seedlings to new resistance regeneration boxes. Once the seedlings have grown to a certain size, samples can be taken for testing.
[0083] The formulations of the co-culture medium, resting medium, screening medium 1, screening medium 2 and regeneration medium are described in the patent application number "2025117248021".
[0084] Genome DNA was extracted from young leaves of regenerated wheat using the CTAB method, and PCR identification was performed using primers from the BUE-DF1 and BUE-DR1 vectors.
[0085] BUE-DF1: TCATTGAGCAGATTTCCGAGT (SEQ ID NO: 14);
[0086] BUE-DR1:ATTTGCAGCTTTTCTAGGTCT (SEQ ID NO: 15).
[0087] The results are as follows Figure 1 As shown, the bands represent the successfully transformed T0 generation wheat transgenic lines, and a total of 22 positive transgenic lines were obtained.
[0088] 2. Identification of TaSIZ1 transgenic knockout progeny
[0089] The target sequence designed in this embodiment can directly target and edit homologous genes on the A, B, and D genomes. Therefore, it is necessary to simultaneously detect gene editing status of the three homologous copies of TaSIZ1-1A, B, and D. The Hi-TOM gene editing site detection kit was used, which completes the high-throughput library construction process through PCR and directly analyzes the variation information of multiple samples and multiple sites using Hi-TOM online software.
[0090] In this embodiment, specific primers (Seq-F1, Seq-R1, Seq-F2, Seq-R2) were designed for the sgRNA1 target sequence, which can simultaneously amplify genes TaSIZ1-1A, TaSIZ1-1B, and TaSIZ1-1D. In addition, the amplified fragments contain SNP sequences that can distinguish the ABD genome. After library construction, the amplified products were sequenced.
[0091] Seq-F1: GGAGTGAGTACGGTGTGCCTGCTCCCGATCTAGCCAC (SEQ ID NO: 16);
[0092] Seq-R1:GAGTTGGATGCTGGATGGCTTATCTGGAACGAGCACACA (SEQ ID NO: 17);
[0093] Seq-F2: gagttggatgctggatggACAGGTTTGGTGCATTCTTATGAATG (SEQ ID NO: 18);
[0094] Seq-R2: gagttggatgctggatggGACCTGGTTCTCAGTTGCTAGGC (SEQ ID NO: 19).
[0095] The first round of PCR was performed using leaf DNA from TaSIZ1 wheat knockout mutant plants as a template. The reaction system consisted of 1 μL gDNA (approximately 20 ng / μL), 10 μL 2× Taq Master Mix, 0.5 μL 10 μM Seq-F1 (or Seq-F2) and Seq-R1 (or Seq-R2), with sterile water added to a final volume of 20 μL. The PCR conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 20 s, for a total of 32 cycles; and a final extension at 72℃ for 5 min. After PCR, 5 μL of agarose gel was used for agarose gel electrophoresis to detect the PCR products, ensuring the presence and specificity of the target product. The second round of PCR was then performed using 12 μL Hi-TOM Mix, 1 μL of the first round PCR product, and sterile water added to a final volume of 20 μL. PCR reaction procedure: 94℃ denaturation for 2 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 25 s, for a total of 33 cycles; final extension at 72℃ for 5 min. Amplification products were mixed and recovered via gel electrophoresis. The recovered gel products were used as library construction and sequencing samples, which were then sequenced for verification.
[0096] Sequencing results revealed that all three edited transgenic lines exhibited frameshift mutations caused by insertions or deletions. The gene editing results for TaSIZ1-1A, TaSIZ1-1B, and TaSIZ1-1D are as follows: Figure 2 As shown, comparison revealed that the mutant proteins TaSIZ1-1A / B / D all terminated prematurely at amino acid 221, with a duration of 6... # Taking the strain as an example, the amino acid sequence encoded by its TaSIZ1-1A is as follows: Figure 3 As shown, the sgRNA was successfully converted to the Cas9 element and functioned, editing the TaSIZ1 gene and causing frameshift mutations in the three proteins TaSIZ1-1A, TaSIZ1-1B, and TaSIZ1-1D, resulting in the loss of the corresponding gene function.
[0097] Example 3 Phenotypic Identification
[0098] Taking homozygous knockout lines as an example, the representative types of wheat after TaSIZ1 gene knockout and TaSIZ1 gene overexpression were identified.
[0099] (1) Homozygous knockout line Tasiz1-6 # and Tasiz1-13# Obtaining:
[0100] To obtain homozygous knockout lines with three homologous copies of TaSIZ1-1A, TaSIZ1-1B, and TaSIZ1-1D, the self-crossed progeny of the gene-editing mutants were identified, resulting in homozygous mutants with simultaneous knockout of TaSIZ1-1A, TaSIZ1-1B, and TaSIZ1-1D. The TaSIZ1-1A, TaSIZ1-1B, and TaSIZ1-1D genes in the gene-edited progeny were amplified by PCR using Seq-F1 (or Seq-F2) and Seq-R1 (or Seq-R2). The PCR reaction system consisted of: 15 μL KOD-FX Neo buffer, 6 μL 2 mM dNTPs, 0.9 μL 10 μM Seq-F1 (or Seq-F2), 0.9 μL 10 μM Seq-R1 (or Seq-R2), 1 μL gDNA (approximately 20 ng / μL), 0.3 μL KOD-FX NEO, and ddH2O to a final volume of 30 μL. The PCR reaction program was as follows: 98℃ pre-denaturation for 2 min, 98℃ denaturation for 12 s; 58℃ annealing for 20 s, 68℃ extension for 45 s, for 35 cycles; 68℃ annealing for 5 min, and storage at 4℃.
[0101] After PCR, 5 μL of the PCR product was collected for agarose gel electrophoresis. Sequencing of the amplified products confirmed the results, thus allowing for the screening of the homozygous triple-copy gene knockout line Tasiz1-6. # and Tasiz1-13 # Among them, the homozygous three-copy gene knockout line Tasiz1-6 # The protein sequences encoded by the three copies of the TaSIZ1 gene are shown in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:7; the homozygous three-copy gene knockout line Tasiz1-13 # The protein sequences encoded by the three copies of the TaSIZ1 gene are shown in SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8.
[0102] (2) Homozygous overexpression line Tasiz1-7 # and Tasiz1-8 # Obtaining:
[0103] PCR amplification of the target gene was used to screen and identify positive wheat overexpression plants. The screening of positive transgenic lines followed the law of genetic segregation: first, positive plants in the T0 generation were identified; if their offspring (T1 generation) showed a segregation ratio of 3:1 (positive:negative), it indicated that the target gene was inserted at a single site; finally, lines without segregation (all positive) were selected from the T2 generation, which were then homozygous overexpression lines. Seven lines with similar expression levels were selected. # 8 # Further experimental analysis will be conducted.
[0104] (3) Phenotypic identification:
[0105] The wild-type recipient variety JW1 and the TaSIZ1 overexpressing line (OE-Tasiz1-7) were respectively tested. # and OE-Tasiz1-8 # ) and the homozygous knockout lines obtained through screening (Tasiz1-6) # and Tasiz1-13 # The plants were grown in the greenhouse of Shandong University Qingdao Campus (120.41ºE, 36.07ºN) under the following conditions: light / dark = 16 h / 8 h; daytime temperature 22℃, nighttime temperature 16℃; humidity between 40% and 50%; and CO2 concentration between 500 ppm and 700 ppm. Wild-type control plants JW1 and TaSIZ1 gene knockout mutants were subjected to normal water treatment and drought stress treatment, respectively. In the normal treatment group, wheat seeds germinated under normal conditions and were transplanted into soil boxes after the first true leaf broke through the coleoptile. Each box contained 12 identical black pots. The cultivation substrate was a 3:1 mixture of vermiculite and Danish Pinsch Top peat moss. Each box was watered with 2 liters of wheat nutrient medium containing 5 mM nitrate. Subsequent watering was normal. In the drought stress treatment group, wheat seeds germinated under normal conditions and were transplanted into soil boxes after the first true leaf broke through the coleoptile. Each box contained 12 identical black pots. The cultivation substrate was a 3:1 mixture of vermiculite and Danish Pinsch Top peat moss. Each box was watered with 2 liters of wheat nutrient medium containing 5 mM nitrate. Subsequent watering was not provided, and the water was allowed to evaporate naturally. Twenty-three days after uniform planting, the aboveground fresh weight of plants in each treatment group was measured and counted. At the same time, a Canon high-performance SLR camera was used to take standardized photographs of the overall morphology of wild-type and gene knockout mutant plants under the same lighting, shooting distance and background conditions.
[0106] The results are as follows Figure 4 and Figure 5 As shown, under normal cultivation conditions, there was no difference in the fresh weight of the aboveground parts among wild-type, TaSIZ1 overexpressing, and homozygous knockout lines. Figure 6 , Figure 7 , Figure 8 and Figure 9As shown, after drought treatment, compared with the wild-type control, the TaSIZ1 gene knockout lines (Tasiz1-6) showed... # and Tasiz1-13 # The aboveground fresh weight of the plants was significantly higher, and the degree of wilting was significantly lower. After rehydration treatment, the plants under drought stress were allowed to recover for a period of time, and the survival rate of each group was calculated. It was found that the TaSIZ1 gene knockout lines (Tasiz1-6) showed significantly higher survival rates. # and Tasiz1-13 # The survival rates of the control group were significantly higher than those of the wild-type control. These results indicate that TaSIZ1 has a negative regulatory effect on drought resistance in wheat.
[0107] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. The application of the TaSIZ1 gene in improving wheat drought resistance, characterized by, The TaSIZ1 gene is derived from wheat, and its three copy coding sequences in wheat, A, B, and D, are shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively; the application is achieved by silencing or knocking out the TaSIZ1 gene. The TaSIZ1 gene knockout process includes: designing an sgRNA targeting the TaSIZ1 gene, and simultaneously knocking out three copies of the TaSIZ1 gene, A, B, and D, in wheat; the sequence of the sgRNA is shown in SEQ ID NO:
9.
2. The application as described in claim 1, characterized in that, The silence referred to is post-transcriptional silencing.
3. The application as described in claim 1, characterized in that, The knockout is achieved by using gene editing technology to repair the TaSIZ1 gene sequence through homologous recombination or non-homologous end joining, resulting in deletion, addition, truncation, or replacement.
4. The application as described in claim 1, characterized in that, The improvement of wheat drought resistance includes changes in at least one of the following indicators: increasing the fresh weight of wheat aboveground parts, reducing the degree of wilting of wheat under drought stress, and / or increasing the survival rate of wheat under drought stress.
5. A method for improving the drought resistance of wheat, characterized in that, This includes silencing or knocking out the endogenous TaSIZ1 gene in wheat, wherein the TaSIZ1 gene has three copies (A, B, and D) in wheat, and its coding sequence is shown in SEQ ID NO:1~SEQ ID NO:3; knocking out the endogenous TaSIZ1 gene in wheat includes: designing an sgRNA that targets the TaSIZ1 gene and simultaneously knocking out the three copies (A, B, and D) of the TaSIZ1 gene in wheat; the sequence of the sgRNA is shown in SEQ ID NO:9.
Citation Information
Patent Citations
Application of wheat TaPND gene
CN119410650B
SIZ1 protein separated from corn, coding gene of SIZ1 protein and application of SIZ1 protein and coding gene in variety improvement
CN113462661A
Method for adapting the stress of rice by expression of OsSIZ1 and OsSIZ2 protein
KR1020120035543A