TCR mRNA rapid synthesis method and application thereof

The method of synthesizing TCR mRNA through two rounds of PCR amplification and IVT solves the problem of complex and time-consuming TCR mRNA synthesis process, and realizes efficient and low-cost TCR synthesis and rapid screening, which is suitable for TCR screening and verification of multiple antigens.

CN121610563APending Publication Date: 2026-03-06FUDAN UNIV SHANGHAI CANCER CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511538519.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-27
Publication Date
2026-03-06

AI Technical Summary

Technical Problem

Existing TCR mRNA synthesis methods rely on plasmid construction, which is complex and time-consuming, making it difficult to achieve high-throughput screening and rapid validation. This is especially true in TCR screening for multiple antigens, where it is cumbersome and carries the risk of viral packaging and random integration.

Method used

Using complementary primers and a fixed fragment, a double-stranded TCR template was rapidly synthesized through two rounds of PCR amplification. This template was then combined with IVT to synthesize TCR mRNA. TCR-specific screening was performed using Jurkat cells, and TCR recognition ability was verified in human primary T cells, simplifying the TCR synthesis and verification process.

Benefits of technology

It shortens the TCR mRNA synthesis time, reduces costs, enables high-throughput screening and rapid validation, is suitable for efficient screening of specific TCRs, and avoids the cumbersome vector construction and virus packaging process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121610563A_ABST
    Figure CN121610563A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of immunotherapy, and discloses a TCR mRNA rapid synthesis method and application thereof, a TCR double-stranded template is rapidly synthesized through two rounds of PCR amplification by adopting a mode of complementary CDR3 + J region primer + fixed fragment '5' UTR + V region 'and' C region + 3 'UTR' fragment, and then TCR mRNA is synthesized through IVT. According to the application, the reliability of the method is confirmed through first-generation sequencing, TCR specific screening is carried out by co-transforming alpha / beta double-stranded mRNA into Jurkat cells, and finally, the TCR recognition capability is further verified by co-transforming alpha / beta double-stranded mRNA into human primary T cells. The synthesis period is short, vector construction is avoided, time cost is saved, TCR synthesis flexibility is improved, and high-throughput screening of specific TCRs can be achieved in a short time.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the technical field of immunotherapy, and in particular to a method for rapid synthesis of TCR mRNA and its application. Background Technology

[0002] T cell receptors (TCRs) are proteins on the surface of T cells responsible for specifically recognizing antigenic peptides that bind to the major histocompatibility complex (MHC) molecule. Two types of TCRs exist in humans: TCRαβ and TCRγδ, with 95% of T cells expressing TCRαβ.

[0003] A mature heavy chain TCR gene consists of four parts: a variable region (V), a polymorphic region (D), a linker region (J), and a constant region (C) (VDJC). Light chain TCRs lack the D region (VJC). Both heavy and light chain TCRs have three complementarity-determining regions (CDRs). CDR3 is encoded by a portion of V, all of D, a portion of J, and the linker region between VD and DJ. This highly diverse sequence results in dual specificity in the TCR antigen recognition process: MHC restriction and antigen specificity.

[0004] Adoptive metastasis of tumor antigen-specific T cells from the patient's own tissues presents a promising therapeutic strategy. However, these naturally occurring anti-tumor cells are limited in origin, difficult to isolate, and challenging to scale up in vitro, preventing their clinical application. In recent years, the advent of single-cell RNA sequencing (scRNAseq) technology has enabled the identification of paired TCRα / β sequences in thousands of tumor-infiltrating T cells within a complete transcriptome context. Researchers have been able to isolate TCR-encoding genes from tumor-reactive T cells and introduce them into ordinary T cells to confer tumor-specific killing capabilities, resulting in a large number of functional effector T cells. Existing studies have shown that these TCR-modified T cells are comparable to natural T cell clones in anti-tumor efficacy. Multiple clinical trials have also confirmed their feasibility, safety, and therapeutic potential in various tumors. [1,2] However, the number of anti-tumor TCRs that have been identified and validated for clinical use remains limited, which greatly restricts the widespread application of this powerful strategy.

[0005] TCR validation mainly includes two parts: TCR double-strand synthesis and TCR specificity identification. Currently, TCR-T construction primarily involves two technical pathways: viral vector transduction and non-viral vector introduction. While viral vectors can integrate the TCR gene into the cell genome, this requires complex and time-consuming processes such as vector construction, virus preparation, and cell screening. [3] While non-viral mRNA transduction is generally considered safer and faster, it only provides short-term expression. Current methods allow for the assembling of a full-length αβTCR chain by linking the TCR-specific V(D)J region to a vector backbone using restriction endonucleases. [4,5] Furthermore, introducing the T7 promoter into the structure enables the rapid preparation of αβTCR mRNA. [6] This is beneficial for the subsequent transfection process.

[0006] However, all of the above methods require one or more rounds of vector construction, which, limited by the speed of plasmid library construction, increases the time cycle for TCR validation, making it difficult to perform high-throughput screening in the short term. Furthermore, stable expression usually requires viral packaging and infection, further increasing the risk of random integration. Therefore, there is still a need to find more convenient and efficient methods for TCR synthesis and validation.

[0007] References:

[0008] [1]ISHIHARA M,KITANO S,KAGEYAMA S,et al.NY-ESO-1-specific redirectedT cells with endogenous TCR knockdown mediate tumor response and cytokinerelease syndrome[J].Journal for immunotherapy of cancer,2022,10(6).

[0009] [2]HAFEZI M,LIN M,CHIA A,et al.Immunosuppressive Drug-ResistantArmored T-Cell Receptor T Cells for Immune Therapy of HCC in Liver TransplantPatients[J].Hepatology(Baltimore,Md),2021,74(1):200-13.

[0010] [3]HE J,XIONG X,YANG H,et al.Defined tumor antigen-specific T cellspotentiate personalized TCR-T cell therapy and prediction of immunotherapyresponse[J].Cell research,2022,32(6):530-42.

[0011] [4]KROPP K N, T J,FATHO M,et al.A bicistronic vectorbackbone for rapid seamless cloning and chimerization ofαβT-cell receptorsequences[J].PloS one,2020,15(9):e0238875.

[0012] [5]WANG X,SONG X,LI Y,et al.Integrated system for screening tumor-specific TCRs,epitopes,and HLA subtypes using single-cell sequencing data[J].Journal for immunotherapy of cancer,2025,13(7).

[0013] [6]EHRENFRIED A R,ZENS S,STEFFENS L K,et al.T-Cell-Based Platform forFunctional Screening of T-Cell Receptors Identified in Single-Cell RNASequencing Data Sets of Tumor-Infiltrating T-Cells[J].Bio-protocol,2024,14(8):e4972. Summary of the Invention

[0014] To provide a more convenient method for TCR synthesis and validation, this application presents a rapid TCR mRNA synthesis method and its application. The method employs complementary primers and a fixed fragment approach, rapidly synthesizing a TCR double-stranded template through two rounds of PCR amplification, followed by IVT synthesis of TCR mRNA. The reliability of the method is confirmed by first-generation sequencing. TCR-specific screening is performed by co-transforming α / β double-stranded mRNA into Jurkat cells, and TCR recognition ability is further validated by co-transforming α / β double-stranded mRNA into human primary T cells. The synthesis cycle is short, enabling high-throughput screening of specific TCRs in a short period.

[0015] Firstly, this application provides a method for rapid synthesis of TCR mRNA, which employs the following technical solution:

[0016] A method for rapid synthesis of TCR mRNA includes the following steps:

[0017] S1. Design of CDR3+J region-long primers

[0018] Design one or more primers based on the TCRα / βCDR3+J region sequence, wherein:

[0019] If one primer is designed, the 5' end of the primer contains a sequence complementary to the C-terminus of the V region of the TCR, and the 3' end of the primer contains a sequence complementary to the N-terminus of the C region of the TCR;

[0020] If multiple primers are designed, they are designated as F primer and R primer respectively. The 5' end of the F primer contains a sequence complementary to the C end of the V region of the TCR, and the 5' end of the R primer contains a sequence complementary to the N end of the C region of the TCR. Furthermore, there is a complementary sequence between the F primer and the R primer.

[0021] Fixed segments in S2, V and C regions

[0022] Provide “5'UTR+V region” and “C region+3'UTR” segments, wherein the 5' end of the “5'UTR+V region” segment must contain the promoter sequence required for IVT, and the 5' end of the “C region+3'UTR” segment must contain the J region sequence;

[0023] S3, PCR

[0024] (1) One round of amplification:

[0025] Using a mixture of (5'UTR+V region) and (C region+3'UTR) fragments as a template, a first round of PCR amplification was performed using the primers designed in step S1 to obtain a first round of amplification products;

[0026] (2) Second round of expansion:

[0027] Add an upstream primer containing a promoter sequence and a downstream primer containing a polyT tail sequence to the first-round amplification product to perform a second round of PCR amplification, and obtain the second-round amplification product;

[0028] S4. In vitro transcription to synthesize TCR mRNA

[0029] The second-round amplification products were used as DNA templates to synthesize TCR mRNA via IVT.

[0030] Optionally, in step S1, the complementary sequence length in the primer is 15-24 nt; preferably, the complementary sequence length in the primer is 21 nt.

[0031] Optionally, in step S3, the mass ratio of (5'UTR+V region) fragments to (C region+3'UTR) fragments in the fragment mixture is 2:3.

[0032] Optionally, in step S3, the amplification procedure for one round is as follows: ① 98℃, 30s; ② 98℃, 10s; 42℃, 10s; 72℃, 15s; repeat 5-10 times; ③ 72℃, 30s; 4℃, ∞.

[0033] Optionally, in step S3, the procedure for the second round of amplification is as follows: ① 98℃, 30s; ② 98℃, 10s; 63℃, 10s; 72℃, 15s; repeat 23-30 times; ③ 72℃, 30s; 4℃, ∞.

[0034] Optionally, in step S3, the sequence of the upstream primer containing the promoter sequence is shown in SEQ ID NO.9, and the sequence of the downstream primer containing the polyT tail sequence is shown in SEQ ID NO.10.

[0035] Optionally, the method further includes a step of validating the expression of the TCR mRNA, the validation step comprising:

[0036] T cell suspension and K562 cell suspension with HLA typing matched by counting antigens were taken separately, mixed and transfected with TCR mRNA, and target peptide or target mRNA was added, mixed and cultured, and the supernatant was collected to detect IL-2 concentration.

[0037] Optionally, the method further includes a step of functionally validating the TCR mRNA, the validation step comprising:

[0038] T cells and B cells were mixed in a 2:1 ratio to form a suspension. After transfection with TCR mRNA and antigen mRNA, the cells were collected and stained with TNF-α antibody and CD137 antibody. The TCR-T activation status was detected by flow cytometry.

[0039] Secondly, this application provides a TCR mRNA synthesized using the aforementioned rapid TCR mRNA synthesis method.

[0040] Thirdly, this application provides a method for rapid synthesis of TCR mRNA and its application in TCR screening.

[0041] The technical problem that this application aims to solve is:

[0042] 1. Traditional TCR mRNA synthesis relies on plasmid construction. A common method involves combining the α and β strands into the same vector containing the T7 promoter, followed by processes such as culture and cloning to obtain the plasmid. Finally, a linear template is obtained through enzyme digestion / PCR, and the target mRNA is obtained via IVT. However, the unique feature of TCR double strands is that the V and C regions have relatively limited types and long sequences, while the CDR3 and J regions have varied sequences or shorter lengths. Based on this, this application designs long primers for the CDR3+J region, which are amplified in two rounds in the same PCR system with a fixed fragment. This enables the synthesis of two TCR template strands and further synthesis of the target mRNA within one day, avoiding vector construction problems, significantly shortening the mRNA synthesis cycle, and reducing production costs.

[0043] 2. TCR screening for a single antigen often involves several or even dozens of pairs of α and β chains. Each chain, due to its unique combination of V, CDR3, J, and C regions, requires unique vector construction, which places demands on the speed of plasmid library construction. If TCR screening is performed for multiple antigens, the process becomes even more cumbersome. This application avoids this by modularizing the TCR synthesis process, enabling flexible combinations of different sequences, and rapidly obtaining different α and β chain mRNAs. Combined with Jurkat cell IL-2 ELISA detection, high-throughput screening of specific TCRs can be achieved in a short period of time.

[0044] In summary, this application includes at least one of the following beneficial technical effects:

[0045] 1. Shorten TCR mRNA synthesis time: This application uses a limited number of pre-prepared V and C region fragments and one or two long primers to obtain TCRα / β DNA templates through two rounds of PCR, and then obtains the target TCR mRNA through IVT; the entire process can be completed within one day. Compared with commonly used vector-dependent TCR fragment synthesis methods, it omits processes such as cloning and vector construction, greatly shortening the time and improving efficiency.

[0046] 2. Reduced synthesis cost: This application splits the long TCR sequence into three parts: V region, CDR3+J region, and C region. Only the V region and C region fragments are synthesized in advance, which reduces the cost compared to synthesizing the full-length TCR. In addition, the synthesis process involved in this application eliminates the costs of bacterial culture, clone screening, and other processes.

[0047] 3. Enables high-throughput screening: Due to the simple primer design and PCR process of the CDR3+J region, the synthesis time and cost will not increase significantly due to the increase in the number of candidate TCRs, making it suitable for high-throughput screening of specific TCRs.

[0048] 4. Increased validation flexibility: The modular synthesis process used in this application can achieve different combinations of V and C regions as needed without repeated synthesis; in addition, the separate synthesis and mixed transfection of TCRα / β mRNA chains are more conducive to the validation of candidate TCRα / β pairs containing repeating α or β chains, making it faster and more flexible.

[0049] 5. Shorten validation time: TCR mRNA can be directly transfected into Jurkat or T cells, which can achieve high expression and function in a short period of time, avoiding the cumbersome process of stable cell line construction. Attached Figure Description

[0050] Figure 1 This is a schematic diagram of a rapid TCR mRNA synthesis method;

[0051] Figure 2 This is a graph showing the results of two rounds of PCR amplification and IVT in Example 1. Figure 2 A is an agarose gel electrophoresis image of 5'UTR+TRAV1-2, mTRAC1+3'UTR, 5'UTR+TRBV5-6, mTRBC1+3'UTR, the second-round amplification product of the α chain (E7α), and the second-round amplification product of the β chain (E7β).

[0052] Figure 2 B represents the Sanger sequencing results for E7α and E7β; Figure 3 C is an agarose gel electrophoresis image of E7αTCR mRNA and E7βTCR mRNA obtained by IVT using purified E7α and E7β as DNA templates.

[0053] Figure 3 This is a diagram showing the verification results of E7α / βTCR mRNA expression in Example 2. Figure 3 Figure A shows the positive rate of mTRBC in Jurkat-CD8 cells transfected with E7α / βTCR mRNA. Figure 3 Figure B shows the protein expression results of E7α / βTCR mRNA in HEK293T cells; Figure 3 C represents the positive rate of mTRBC in CD4+ T cells transfected with E7α / βTCR mRNA. Figure 3 D is a graph showing the positive rate of mTRBC in CD8+ T cells transfected with E7α / βTCR mRNA.

[0054] Figure 4 This is a comparison chart of the results of E7α / βTCR mRNA gradient transfection of Jurkat-CD8 cells in Comparative Example 1 and Example 1. Figure 4 A is a comparison chart of transfection efficiency at different concentrations. Figure 4 B is a comparison chart of the positive rate of Tetramer;

[0055] Figure 5 This is a diagram showing the results of validating the antigen recognition and presentation function of E7α / βTCR mRNA in Jurkat-CD8 cells in Example 3. Figure 5 A is a statistical graph showing the concentration of secreted IL-2 in the supernatant of co-cultured with K562-HLA-A*02:01 target cells and E7 peptide after E7 TCRα / β mRNA was transfected into Jurkat-CD8 cells. Figure 5 B is a statistical graph showing the concentration of secreted IL-2 in the supernatant of co-cultured Jurkat-CD8 cells transfected with E7 TCRα / β mRNA and K562-HLA-A*02:01 target cells transfected with E7 mRNA for 36 h.

[0056] Figure 6 This is a diagram showing the results of validating the antigen recognition and presentation function of E7α / βTCR mRNA in HLA-A*0201T cells in Example 3. Figure 6 A is a statistical graph showing the concentration of secreted IL-2 in the supernatant after HLA-A*0201T cells were co-cultured with K562-HLA-A*02:01 target cells and E7 peptides for 36 h following transfection of E7 TCRα / β mRNA. Figure 6 B is a statistical graph showing the concentration of secreted IL-2 in the supernatant of co-cultured HLA-A*0201T cells transfected with E7 TCRα / β mRNA and K562-HLA-A*02:01 target cells transfected with E7 mRNA for 36 h.

[0057] Figure 7 A schematic diagram illustrating B cell-specific activation of TCR-T cells;

[0058] Figure 8 This is a graph showing the TCR-T specificity detection results in Example 4, where... Figure 8 A shows the IFN-γ secretion results detected by ELISpot after co-incubating E7 TCR-T cells with B cells that present E7 peptide / express E7 mRNA. Figure 8 B represents the proportion of CD137-positive CD4+ TCR-T cells; Figure 8 C represents the proportion of CD4+TCR-T cells that are positive for TNF-α. Figure 8D represents the proportion of CD137-positive CD8+TCR-T cells; Figure 8 E represents the proportion of CD8+TCR-T cells that are positive for TNF-α.

[0059] Figure 9 This is a diagram showing the rapid synthesis and validation results of neoBC and mNA2 target-specific TCR mRNAs in Example 5. Figure 9 A is an agarose gel electrophoresis image of the amplification products after two rounds of PCR. Figure 9 B represents the Sanger sequencing results. Figure 9 C is an agarose gel electrophoresis image of TCR mRNA obtained by IVT using purified TCRα / β double-stranded DNA as a template; Figure 9 D is a graph showing the proportion of mTRBC-positive cells transfected with Jurkat-CD8 cells based on the predicted TCR mRNA from the neoBC target. Detailed Implementation

[0060] The present application will be further described below with reference to the accompanying drawings and embodiments, but this is not intended to limit the scope of the application.

[0061] Unless otherwise specified, the materials and equipment used in the various embodiments of this application are all commercially available products in the art.

[0062] Example 1

[0063] E7 TCR mRNA rapid synthesis

[0064] A schematic diagram of the rapid TCR mRNA synthesis method is shown below. Figure 1 As shown, the "5'UTR+V region" and "C region+3'UTR" fragments, which were enzyme-digested and fixed, were mixed with the designed intermediate primers and added to the PCR system. The fragments were bridged by the first round of PCR. Then, two primers with T7 promoter and PolyT120 were added respectively to amplify the full-length template by the second round. Finally, TCR mRNA was synthesized by in vitro transcription.

[0065] To verify the feasibility of the method in this application, the reported E7 TCR sequence was first used as a verification sequence for the synthesis process. Reference: JIN BY, CAMPBELL TE, DRAPER LM, et al. Engineered Tcells targeting E7 mediate regression of human papillomavirus cancers in amurine model[J]. JCI insight, 2018, 3(8).

[0066] The specific steps are as follows:

[0067] 1. Design of CDR3+J region-long primers:

[0068] Two pairs of long primers (F and R) were designed based on the CDR3+J region sequences of the E7 TCRα / β strands, and named E7A-F, E7A-R, E7B-F, and E7B-R, respectively. Among them, the 5' end of primer F contains a 21nt sequence complementary to the C-terminus of region V, and the 5' end of primer R contains a 21nt sequence complementary to the N-terminus of region C. The corresponding F and R primers have a 21nt complementary sequence.

[0069] The specific sequence information is as follows:

[0070] E7A-F (see SEQ ID NO.1):

[0071] AAAGACTCTGCCTCTTACCTCTGCGCCAGCGTGGATGGCAACAATAGATTAGCCTTTGGCAAAGGCA;

[0072] E7A-R (see SEQ ID NO.2):

[0073] GGCGGGCTCGGGGTTCTGGATATTGGGGATCACCACCACCTGGTTGCCTTTGCCAAAGGCTAATC;

[0074] E7B-F (see SEQ ID NO.3):

[0075] GGGGACTCGGCCCTCTATCTCTGCGCCAGCAGCCTGGGCTGGCGGGGCGGCCGGTACAACGAGCAGTTCTTC;

[0076] E7B-R (see SEQ ID NO.4):

[0077] GGGGGTCACGTTCCTCAGGTCCTCCAGCACGGTCAGCCGGGTGCCGGGGCCGAAGAACTGCTCGTTGTACCG.

[0078] 2. Fixed segments in areas V and C

[0079] Amplify the target V and C regions of the E7 TCRα / β chains separately using plasmid vectors. BsaI endonuclease (product number: 15005ES, Yisheng Biotechnology (Shanghai) Co., Ltd.) was used to digest the corresponding plasmid. The digestion products were subjected to agarose gel electrophoresis and the target band was excised and recovered to obtain the "5'UTR+V region" and "C region+3'UTR" fragments, which were named 5'UTR+TRAV1-2, mTRAC1+3'UTR, 5'UTR+TRBV5-6 and mTRBC1+3'UTR, respectively.

[0080] This application uses the pUC57 plasmid vector (Shanghai Diwin Biotechnology Co., Ltd.), and adds an HA tag to the C-terminus of the C-region sequence to facilitate subsequent Western Blot detection, etc.

[0081] The specific sequence information is as follows:

[0082] 5'UTR+TRAV1-2 (see SEQ ID NO.5):

[0083] AATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGTGGGGAGTTTTCCTTCTTTATGTTTCCATGAAGATGGGAGGCACTACAGGACAAAACATTGACCAGCCCACTGAGATGACAGCTACGGAAGGTGCCATTGTCCAGATCAACTGCACGTACCAGACATC TGGGTTCAACGGGCTGTTCTGGTACCAGCAACATGCTGGCGAAGCACCTACATTTCTGTCTTACAATGTTCTGGATGGTTTGGAGGAGAAAGGTCGTTTTTCTTCATTCCTTAGTCGGTCTAAAGGGTACAGTTACCTCCTTTTGAAGGAGCTCCAGATGAAAGACTCTGCCTCTTACCTC;

[0084] mTRAC1+3'UTR (see SEQ ID NO.6):

[0085] AATATCCAGAACCCCGAGCCCGCCGTGTACCAGCTGAAGGACCCCAGGAGCCAGGACAGCACCCTGTGCCTGTTCACCGACTTCGACAGCCAGATCAACGTGCCCAAGACCATGGAGAGCGGCACCTTCATCACCGACAAGTGCGTGCTGGACATGAAGGCCATGGACAGCAAGAGCAACGGCGCCATCGCCTGGAGCAACCAGACCAGCTTCACCTGCCAGGACATCTTCAAGGAAACCAACGCCACCTACCCCAGCAGCGACGTGCCCTGCGACGCCACCCTGACCGAGAAGAGCTTCGAAACCGACATGAACCTGAACTTCCAGAACCTGCTGGTGATCGTGCTGAGGATCCTGCTGCTGAAGGTGGCCGGCTTCAACCTGCTGATGACCCTGAGGCTGTGGAGCAGCTACCCCTACGACGTGCCCGACTACGCCTGATGAGCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC;

[0086] 5’UTR + TRBV5-6 (see SEQ ID NO.7):

[0087] AATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGGGCCCCGGGCTCCTCTGCTGGGCACTGCTTTGTCTCCTGGGAGCAGGCTTAGTGGACGCTGGAGTCACCCAAAGTCCCACACACCTGATCAAAACGAGAGGACAGCAAGTGACTCTGAGATGCTCTCCTAAGTCTGGGCATGACACTGTGTCCTGGTACCAACAGGCCCTGGGTCAGGGGCCCCAGTTTATCTTTCAGTATTATGAGGAGGAAGAGAGACAGAGAGGCAACTTCCCTGATCGATTCTCAGGTCACCAGTTCCCTAACTATAGCTCTGAGCTGAATGTGAACGCCTTGTTGCTGGGGGACTCGGCCCTCTATCTC;

[0088] mTRBC1 + 3’ UTR (see SEQ ID NO.8):

[0089] .

[0090] The 5' end of the "5'UTR+V region" segment must contain the promoter sequence required for IVT, and the required promoter can be replaced with a promoter suitable for the IVT system as needed; the 5' end of the "C region+3'UTR" segment must contain the J region sequence.

[0091] Furthermore, to avoid TCR recombination mismatch, the human TCR synthesis involved in this application uses mouse TRBC to replace the human TRBC sequence.

[0092] 3. PCR (using a 50μL amplification system as an example)

[0093] The primers corresponding to the E7 TCRα / β strands, the "5'UTR+V region" and the "C region+3'UTR" fragments were used for PCR, and the specific steps are as follows:

[0094] (1) One round of amplification:

[0095] Use 2×Hieff Add 5 ng fragment mixture, 10 nM of the corresponding intermediate primer, and an appropriate amount of ddH2O to the AdvanceFast PCR Master Mix (With Dye) (Catalog No.: 10164ES, Yisheng Biotechnology (Shanghai) Co., Ltd.) ...), add 5 ng fragment mixture, 10 nM of the corresponding intermediate primer, and add an appropriate amount of ddH2O to make up a 50 μL amplification system.

[0096] In the above fragment mixture, the mass ratio of the (5'UTR+V region) fragment to the (C region+3'UTR) fragment is 2:3;

[0097] Specifically, the amplification system corresponding to the α chain in one round is shown in Table 1 below:

[0098] Table 1. One-round amplification system corresponding to the α chain.

[0099]

[0100] The amplification system corresponding to the β chain in one round is shown in Table 2 below:

[0101] Table 2 shows the single-round amplification system corresponding to the β chain.

[0102]

[0103] The amplification systems corresponding to the α chain and the β chain were subjected to one round of amplification according to the PCR procedures in Table 3 below:

[0104] Table 3. One-round amplification PCR procedure

[0105]

[0106] Amplification was completed, yielding one round of amplification products for the α chain and one round of amplification products for the β chain.

[0107] (2) Second round of expansion:

[0108] Add 200 nM T7-F primers (to introduce the T7 promoter) and 200 nM PolyT120-R primers (to introduce the polyA tail) to the first-round amplification products of the α chain and the β chain, respectively. That is, add 1 μL of T7-F primers (10 μM) and 1 μL of PolyT120-R primers (10 μM) to obtain the second-round amplification system corresponding to the α chain and the second-round amplification system corresponding to the β chain, respectively.

[0109] The specific sequence information is as follows:

[0110] T7-F (see SEQ ID NO.9):

[0111] CGAAATTAATACGACTCACTATAAGGAATAAACTAGTATTCTTCTGGTCCCCAC;

[0112] PolyT120-R (see SEQ ID NO.10):

[0113] TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCCGCCCACTCAGACTTTATTC.

[0114] The two-round amplification systems corresponding to the α chain and the β chain were subjected to two rounds of amplification according to the PCR procedures in Table 4 below:

[0115] Table 4. Second-round amplification PCR procedure

[0116]

[0117] After amplification, the α-chain second-round amplification products and the β-chain second-round amplification products were obtained. The main product fragment in the α-chain second-round amplification product was named E7α, and the main product fragment in the β-chain second-round amplification product was named E7β.

[0118] 4. Sequencing, electrophoresis and recovery

[0119] The 5'UTR+TRAV1-2, mTRAC1+3'UTR, 5'UTR+TRBV5-6, mTRBC1+3'UTR, the second-round amplification product of the α chain (E7α), and the second-round amplification product of the β chain (E7β) were subjected to agarose gel electrophoresis, and the gel images are shown below. Figure 2 As shown in A;

[0120] The main product bands E7α and E7β of the second-round amplification of the α chain were extracted and recovered via gel extraction, followed by Sanger sequencing. The results are as follows: Figure 2 As shown in B; the results indicate that the sequences of E7α and E7β are correct, and they were used as DNA templates for IVT synthesis of mRNA.

[0121] 5. In vitro transcription to synthesize TCR mRNA

[0122] Add 2 μL of thawed 10×Transcription Buffer, 2 μL each of ribonucleotides (CTP, GTP, ATP, N1-Me-pUTP), 2 μL of T7 RNA Polymerase Mix, 2 μL of GAG, 1 μg of DNA template (E7α or E7β), and RNasefree H2O to a volume of 20 μL, mix well, and incubate at 37°C for 2 h.

[0123] The 10×Transcription Buffer, ribonucleotides (CTP, GTP, ATP), and T7 RNAPolymeraseMix mentioned above are all from the T7 High Yield RNASynthesis Kit (Catalog No.: 10623ES, Yisheng Biotechnology (Shanghai) Co., Ltd.);

[0124] The aforementioned N1-Me-pUTP, catalog number: N202A04, is manufactured by Hunxin Biotechnology.

[0125] The above-mentioned GAG, catalog number: N301A04, is manufactured by Hunxin Biotechnology.

[0126] After the reaction was completed, 2 μL of DNase I (RNase free) (Catalog No.: 10325ES, Yisheng Biotechnology (Shanghai) Co., Ltd.) was added to each tube and incubated at 37℃ for 15 min to remove the corresponding DNA template, resulting in solutions containing E7αTCR mRNA and solutions containing E7βTCR mRNA, respectively.

[0127] E7αTCR mRNA and E7βTCR mRNA were purified and recovered separately using an RNA purification and concentration kit (catalog number: TR113, Jian Shi Biotechnology (Beijing) Co., Ltd.). The band sizes of E7αTCR mRNA and E7βTCR mRNA were then confirmed by 2% agarose gel electrophoresis. The E7αTCR mRNA band was approximately 1100 nt in size, and the E7βTCR mRNA band was approximately 1200 nt in size. The gel image is shown below. Figure 2 As shown in C, agarose gel electrophoresis shows a single band.

[0128] It should be noted that in this embodiment, the variable CDR3 and J regions are designed as two primers. In fact, designing them as a single long primer with complementary sequences to the V and C regions respectively can also achieve two-step bridging synthesis through the above steps. However, the cost of primer synthesis increases more rapidly with increasing length. Therefore, in order to reduce the cost of primer synthesis, a more suitable dual-primer design was chosen.

[0129] Example 2

[0130] E7α / βTCR mRNA expression verification

[0131] 1. The proportion of mTRBC positivity in Jurkat-CD8 cells transfected with E7α / βTCR mRNA:

[0132] (1) The synthesized E7αTCR mRNA and E7βTCR mRNA were processed through NeoLNP. TM Immunotransfection kit for immune cell lines (catalog number: SDR2006, Shengdi Biopharmaceutical (Suzhou) Co., Ltd.): Mix 250 ng of E7αTCR mRNA and 250 ng of E7βTCR mRNA, and dilute with buffer to a premix of 40 ng / μL; add an equal volume of NeoLNP to the premix. TM Transfection reagent, vortex for 2-3 seconds to mix, prepare mRNA-NeoLNP TM complex;

[0133] (2) Count Jurkat-CD8 cells and adjust the density to 1×10⁶ cells using culture medium (1640 medium + 10% FBS + 1% penicillin-dextrose antibody). 6 cells / mL;

[0134] The Jurkat-CD8 cells mentioned above were derived from stable strains constructed from Jurkat cells purchased from Baidi Technology.

[0135] (3) Add 500 μL of Jurkat-CD8 cell suspension to a 24-well plate and add 25 μL of mRNA-NeoLNP. TM The complex was mixed thoroughly and incubated at 37°C in a 5% CO2 incubator for 24 hours. Flow cytometry analysis was then performed using an mTRBC antibody (catalog number: 11-5961-82, ThermoFisher). Figure 3 As shown in Figure A, the co-transduction efficiency of E7α / βTCR mRNA exceeded 80%.

[0136] 2. Protein expression of E7α / βTCR mRNA in HEK293T cells:

[0137] The synthesized E7αTCR mRNA and E7βTCR mRNA were processed via NeoLNP. TM The RNA transfection kit for immune cell lines was used to transfect HEK293T cells (from the Cell Bank of the Chinese Academy of Sciences). After being cultured at 37°C and 5% CO2 for 24 hours, Western Blot analysis was performed.

[0138] The primary antibody used in the Western Blot assay was HA antibody (catalog number: 51064-2-AP, Proteintech);

[0139] The results are as follows Figure 3 As shown in Figure B, the results indicate that double-stranded TCRs are significantly expressed in HEK293T cells. 3. The proportion of mTRBC-positive T cells transfected with E7α / βTCR mRNA:

[0140] NeoLNP TM The immune cell line RNA transfection kit transfected E7α / βTCR mRNA into T cells (XW0801324, Shanghai Saili Biotechnology Co., Ltd.), and after culturing in a 37℃, 5% CO2 incubator for 24 hours, flow cytometry was performed. The cells were stained with anti-human CD4 antibody (catalog number: APC-65603, Proteintech) and anti-human CD8 antibody (catalog number: APC-65144, Proteintech), and the transfection expression of E7 TCR in different types of T cells was confirmed by flow cytometry gating.

[0141] The results are as follows Figure 3 As shown in C and 3D; the results indicate that E7 TCR in primary human CD4 + T cells and CD8 + It can be successfully expressed in T cells.

[0142] Comparative Example 1

[0143] The E7 TCR DNA template was synthesized using a method derived from full-length PCR products. Specifically, a plasmid containing the TCR was first constructed, and the plasmid was used as a template to obtain the IVT template of the TCR via PCR. Then, the TCR mRNA-1 was transcribed to obtain the T7TCR mRNA-1.

[0144] E7 TCR mRNA-1 and TCR mRNA obtained by the method in Example 1 of this application were transfected into Jurkat-CD8 cells at different gradient concentrations (mRNA content of 4ng, 20ng, 100ng or 500ng) using the method in Example 2, and then detected by flow cytometry.

[0145] The results are as follows Figure 4 A and Figure 4 As shown in Figure B, Control represents the result obtained using the method derived from full-length PCR products, while Synthesis represents the result obtained using the rapid synthesis method described in this application. A comparison revealed that the two methods have the same expression efficiency. Figure 4 A), and the efficiency of specific binding to E7 Tetramer is close to 100%. Figure 4 B).

[0146] Example 3

[0147] Validation of E7α / βTCR mRNA's antigen recognition and presentation function

[0148] 1. The E7αTCR mRNA and E7βTCR mRNA synthesized in Example 1 were processed via NeoLNP. TM Transfect the immune cell line RNA transfection kit. Mix 100 ng of E7αTCR mRNA and 100 ng of E7βTCR mRNA, and dilute with buffer to a premix of 40 ng / μL. Add an equal volume of NeoLNP to the premix. TM Transfection reagent, vortex for 2-3 seconds to mix, prepare mRNA-NeoLNP TM complex;

[0149] 2. Count Jurkat-CD8 cells and adjust the density to 1×10⁶ cells using culture medium (1640 medium + 10% FBS + 1% penicillin-dextrose antibody). 6 cells / mL;

[0150] K562 cells with antigen-matched HLA typing were counted. This application used K562-HLA-A*02:01 cells, and the cell density was adjusted to 5 × 10⁶ cells / year using culture medium (1640 medium + 10% FBS + 1% penicillin antibody). 5 cells / mL;

[0151] The aforementioned K562-HLA-A*02:01 cells were derived from a stable line constructed from K562 cells purchased from Baidi Technology.

[0152] 3. Take 100 μL of Jurkat-CD8 cell suspension and 100 μL of K562-HLA-A*02:01 cell suspension respectively, mix them and add them to a 96-well round-bottom plate. Add 10 μL of mRNA-NeoLNPTM complex and mix well. Then add the target peptide (E7 peptide) to the suspension to a final concentration of 1 μM, mix well, and incubate at 37℃ in a 5% CO2 incubator. The control group was not transfected with TCR mRNA.

[0153] The sequence of the target peptide (E7 polypeptide) is (see SEQ ID NO.11): YMLDLQPET;

[0154] 4. After incubating in an incubator for 36 hours, collect the supernatant and use Anafit. TM The Human IL-2 ELISA Kit (Catalog No.: RE260004, Shanghai Tuoran Biotechnology Co., Ltd.) is used to detect IL-2 concentration.

[0155] The results are as follows Figure 5As shown in Figure A, compared with the control group, TCR-Jurkat cells secreted more IL-2, indicating that the rapidly synthesized TCR can successfully function in Jurkat-CD8 cells and sensitively recognize the E7 peptide.

[0156] Furthermore, when E7 mRNA transfection was used instead of incubation for the target peptide, the results were as follows: Figure 5 As shown in Figure B, the level of IL-2 secreted by TCR-Jurkat cells was still higher than that of the control group, indicating that TCR-Jurkat cells were significantly activated.

[0157] Furthermore, human T cells HLA-A*02:01 T cells (from Shanghai Saili Biotechnology Co., Ltd.) were used for screening. The procedure was the same as above, but the LNP kit needed to be replaced with NeoLNP. TM Primary immune cell RNA transfection kit (Catalog No.: SDR2008, Shengdi Biopharmaceutical (Suzhou) Co., Ltd.).

[0158] The results of incubation with E7 peptides are as follows Figure 6 As shown in Figure A, the results of transfection with E7 mRNA are as follows: Figure 6 As shown in B, HLA-A*02:01T cells were found to be specifically activated by K562-HLA-A*02:01 cells loaded with E7 peptide or transfected with E7 mRNA.

[0159] Example 4

[0160] TCR-T specificity detection

[0161] A schematic diagram of B cell-specific activation of TCR-T cells is shown below. Figure 7 As shown, B cells transfected with E7 mRNA were used as antigen-presenting cells to stimulate E7 TCR-T cell responses to verify the specific recognition ability of E7α / βTCR mRNA synthesized by rapid synthesis.

[0162] The specific steps are as follows:

[0163] 1. E7αTCR mRNA and E7βTCR mRNA were synthesized using the method in Example 1. Using the NeoLNP™ primary immune cell RNA transfection kit, 100 ng of E7αTCR mRNA and 100 ng of E7βTCR mRNA were mixed and diluted with buffer to a premix of 40 ng / μL. Then, an equal volume of NeoLNP™ transfection reagent was added, and the mixture was vortexed for 2-3 seconds to prepare the TCR mRNA-NeoLNP™ complex.

[0164] The antigen E7 mRNA was prepared in the same way to obtain the E7 mRNA-NeoLNPTM complex;

[0165] 2. Mix T cells and B cells at a ratio of 2:1 to form a mixture of 1×10⁻⁶ cells. 6 A suspension of 100 cells / mL was added to a 48-well plate;

[0166] The T cells and B cells mentioned above were derived from HLA-A*02:01 PBMCs (cells were obtained from Shanghai Saili Biotechnology Co., Ltd.; sorting kits were sourced from: 17751, 17754, Stemcell).

[0167] 3. Add 10 μL of TCR mRNA-NeoLNPTM complex and 10 μL of E7 mRNA-NeoLNPTM complex to the suspension, mix well, and spread onto the activated ELISpot plate (product number: 2110005, Shenzhen Dakewei Biotechnology Co., Ltd.), and incubate at 37℃ in a 5% CO2 incubator.

[0168] 4. After 48 hours of culture, ELISpot assays were performed to confirm IFN-γ secretion. The results are as follows: Figure 8 As shown in Figure A, the results showed that when E7-specific TCR and E7 antigen were present simultaneously, T cells were effectively activated and secreted IFN-γ.

[0169] 5. Cells were stained with TNF-α antibody (catalog number: 502929, BioLegend) and CD137 antibody (catalog number: 309803, BioLegend), and TCR-T activation was detected by flow cytometry. The results are as follows: Figure 8 As shown in B-8E; the results indicate that, compared with the control group, the expression of both TNF-α and CD137 was significantly increased, indicating that CD4+ transfected with E7α / βTCR mRNA... + T and CD8 + T cells can be specifically activated by E7.

[0170] In summary, the E7α / βTCR mRNA synthesized using a rapid synthesis method can play a specific recognition role in both CD4+ and CD8+ human primary T cells.

[0171] Example 5

[0172] Rapid Synthesis and Validation of NeoBC and mNA2 Target-Specific TCR mRNAs

[0173] Using the method described in Example 1, α / β strand DNA associated with 8 pairs of candidate TCRs targeting neoBC and 2 pairs of candidate TCRs targeting NA2 were synthesized. The agarose gel electrophoresis results are shown in the figure below. Figure 9 As shown in Figure A, Sanger sequencing was performed, and the results are as follows. Figure 9As shown in B; after confirming the sequence was correct, it was used as a template to synthesize mRNA via IVT. Agarose gel electrophoresis showed a single band, as shown in Figure B. Figure 9 As shown in C;

[0174] Specifically, the correspondence between the potential specific TCR duplexes of neoBC and mNA2 targets is shown in Table 5 below:

[0175] Table 5. Correspondence between potential specific TCR double strands targeting neoBC and mNA2.

[0176] TCR alpha chain β chain BC_CT245 BC_CT245α BC_CT245β BC_CT2824-1 BC_CT2824α BC_CT2824-1β BC_CT2824-2 BC_CT2824α BC_CT2824-2β BC_CT2832 BC_CT2832α BC_CT2832β BC_CT2861-1 BC_CT2861-1α BC_CT2861β BC_CT2861-2 BC_CT2861-2α BC_CT2861β BC_CT2893-1 BC_CT2893-1α BC_CT2893β BC_CT2893-2 BC_CT2893-2α BC_CT2893β mNA2_CT450 mNA2_CT450α mNA2_CT132β mNA2_CT439 mNA2_CT439α mNA2_CT132β

[0177] The neoBC target candidate TCR mRNA pair was transfected into Jurkat-CD8 cells using the method described in Example 2, and the results are as follows: Figure 9 As shown in D, it was found that all 8 pairs of TCRα / β mRNAs were expressed to varying degrees, with 5 pairs having an expression efficiency of over 20% and 1 pair having an expression efficiency of over 80%.

[0178] In summary, this application can rapidly and accurately synthesize multiple pairs of specific TCRα / β mRNAs targeting different targets, and these TCRα / β mRNAs can be normally expressed in T cells and recognize the corresponding antigen peptide-MHC complex.

[0179] In summary, this application utilizes complementary primers and a fixed fragment to rapidly synthesize TCR double-stranded DNA templates through two rounds of PCR amplification, followed by IVT synthesis of TCR mRNA. The modular synthesis process allows for the synthesis of TCR DNA templates and TCR mRNA within 24 hours as needed, avoiding vector construction, saving time and costs, and increasing the flexibility of TCR synthesis. Furthermore, the α / β double strands are co-expressed in the Jurkat cell line as a single linear, in vitro transcribed mRNA, eliminating the need to construct stable cell lines and simplifying the testing process.

[0180] The specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Those skilled in the art can make modifications to these embodiments without contributing any inventive step after reading this specification, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. A method for rapid synthesis of TCR mRNA, comprising the following steps: S1, designing a CDR3+J region long primer designing one or more primers according to the sequence of TCR α / β CDR3+J region, wherein: if one primer is designed, the 5' end of the primer comprises a sequence complementary to the C-terminal of the V region of TCR, and the 3' end of the primer comprises a sequence complementary to the N-terminal of the C region of TCR; if multiple primers are designed, they are respectively designated as F primers and R primers, the 5' end of the F primer comprises a sequence complementary to the C-terminal of the V region of TCR, the 5' end of the R primer comprises a sequence complementary to the N-terminal of the C region of TCR, and a complementary sequence is contained between the F primer and the R primer; S2, fixing fragments of V region and C region providing "5'UTR+V region" and "C region+3'UTR" fragments, the 5' end of the "5'UTR+V region" fragment needs to comprise a promoter sequence required for IVT, and the 5' end of the "C region+3'UTR" fragment needs to comprise a J region sequence; S3, PCR (1) one round of amplification: using the mixture of fragments of (5'UTR+V region) and (C region+3'UTR) as a template, and using the primer designed in step S1 to perform one round of PCR amplification to obtain a one-round amplification product; (2) two rounds of amplification: adding an upstream primer comprising a promoter sequence and a downstream primer comprising a polyT tail sequence to the one-round amplification product to perform two rounds of PCR amplification to obtain a two-round amplification product; S4, in vitro transcription to synthesize TCR mRNA using the two-round amplification product as a DNA template to synthesize TCR mRNA by IVT.

2. A method for rapid synthesis of TCR mRNA according to claim 1, characterized in that, In step S1, the length of the complementary sequence in the primer is 15-24 nt; preferably, the length of the complementary sequence in the primer is 21 nt.

3. A method for rapid synthesis of TCR mRNA according to claim 1, wherein, In step S3, in the mixture, the mass ratio of (5'UTR+V region) fragment to (C region+3'UTR) fragment is 2:

3.

4. A method for rapid synthesis of TCR mRNA according to claim 1, wherein, In step S3, the program of the one-round amplification is: ① 98℃, 30s; ② 98℃, 10s; 42℃, 10s; 72℃, 15s; cycle 5-10 times; ③ 72℃, 30s; 4℃, ∞.

5. A method for rapid synthesis of TCR mRNA as claimed in claim 1 wherein, In step S3, the program of the two-round amplification is: ① 98℃, 30s; ② 98℃, 10s; 63℃, 10s; 72℃, 15s; cycle 23-30 times; ③ 72℃, 30s; 4℃, ∞.

6. A method for rapid synthesis of TCR mRNA as claimed in claim 1 wherein, In step S3, the sequence of the upstream primer comprising a promoter sequence is shown in SEQ ID NO. 9, and the sequence of the downstream primer comprising a polyT tail sequence is shown in SEQ ID NO.

10.

7. A method for rapid synthesis of TCR mRNA as claimed in claim 1 wherein, Further comprising a step of verifying the expression of the TCR mRNA, wherein the verification step comprises: respectively taking T cell suspension and counting K562 cell suspension of antigen-matched HLA typing, mixing, transfecting TCR mRNA, and adding target peptide segments or target mRNA, mixing, and then collecting supernatant after culture to detect IL-2 concentration.

8. A method for rapid synthesis of TCR mRNA according to claim 1, wherein, Further comprising a step of verifying the function of the TCR mRNA, wherein the verification step comprises: The T cells and B cells are mixed into a suspension at a ratio of 2:1, the TCR mRNA and antigen mRNA are used to transfect the culture, and then the cells are collected, stained with TNF-α antibody and CD137 antibody, and subjected to flow cytometry to detect the TCR-T activation.

9. A TCR mRNA, characterized in that The TCR mRNA is synthesized by using the rapid synthesis method according to any one of claims 1-8.

10. Use of the rapid synthesis method of TCR mRNA according to any one of claims 1-8 in TCR screening.