Hypolamine 6 beta hydroxylase mutant and application thereof

By performing site-directed mutagenesis on hyoscyamine 6β-hydroxylase, its catalytic activity and substrate tolerance were improved, solving the problems of high synthesis cost and environmental pollution of hyoscyamine and realizing a highly efficient and environmentally friendly biotransformation process.

CN121653085APending Publication Date: 2026-03-13SUNSHINE LAKE PHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411275414.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-09-12
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Existing methods for synthesizing scopolamine are costly and environmentally polluting, while plant extraction methods require huge and unstable resources, making it difficult to meet market demand.

Method used

By site-directed mutagenesis of hyoscyamine 6β-hydroxylase, its hydroxylation activity is increased and its epoxidation capacity is reduced. The mutant is then used as a biocatalyst to catalyze the conversion of hyoscyamine to anisodamine, simplifying the process and reducing costs.

Benefits of technology

This method achieves efficient, environmentally friendly, and economical preparation of anisodamine, with a substrate conversion rate as high as 98.6%, significantly improving catalytic efficiency and reducing chemical reaction byproducts and environmental pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005040016280000011
    Figure BDA0005040016280000011
  • Figure BDA0005040016280000021
    Figure BDA0005040016280000021
  • Figure BDA0005040016280000031
    Figure BDA0005040016280000031
Patent Text Reader

Abstract

The invention provides a hyoscyamine 6 beta hydroxylase mutant as well as a preparation method and application thereof. The hyoscyamine 6 beta hydroxylase mutant at least has the following two sites or amino acid mutation in functional equivalent sites compared with wild hyoscyamine 6 beta hydroxylase: the 14th site and the 97th site; the wild type hyoscyamine 6 beta hydroxylase has an amino acid sequence as shown in SEQ ID NO: 1. The obtained hyoscyamine 6 beta hydroxylase mutant has higher hydroxylation activity, and meanwhile, the epoxidation capacity disappears or is reduced. In industrial application, the catalytic efficiency can be remarkably improved, reagent waste is reduced, the production cost is saved, generation of redundant by-products in chemical reaction is reduced, and environmental pollution is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, specifically to hyoscyamine 6β-hydroxylase mutants, their preparation methods, and applications. More specifically, it relates to hyoscyamine 6β-hydroxylase mutants and their preparation methods, nucleic acid molecules, expression vectors, recombinant cells, recombinant strains, uses, and methods for preparing hyoscyamine. Background Technology

[0002] Scopolamine, chemically named (1R,3S,5R,6S)-6-hydroxy-8-methyl-8-azabicyclo[3.2.1]octane-3-yl(S)-3-hydroxy-2-phenylpropionate, is an anticholinergic drug that blocks M-cholinergic receptors. It has significant peripheral anticholinergic effects, can significantly relax smooth muscle, relieve vasospasm, improve microcirculation, and also has a certain analgesic effect; its structural formula is shown in Formula 1 below:

[0003]

[0004] The all-chemical synthesis method of anisodamine has high production costs, high energy consumption, and significant environmental pollution.

[0005] Plant extraction is currently the main method for preparing commercially available anisodamine. The market demand for anisodamine medicinal plant resources is enormous, and relying solely on wild resources is insufficient to resolve the supply-demand imbalance. Over-harvesting of wild resources can lead to species endangerment and environmental damage. Artificial cultivation of anisodamine faces challenges such as low propagation coefficient, long growth period, complex and harsh environments, limited land use, and high labor costs. Furthermore, the plant source is affected by season and origin, resulting in unstable yield and quality, high costs, and a scarcity of medicinal resources. Additionally, plant extraction processes often involve the use of organic solvents, which are harmful to the environment.

[0006] Patent CN116676355A discloses a method for catalytic synthesis of anisodamine, but silver nitrate needs to be added to the system, which increases the cost and adds pressure to the subsequent separation and purification steps.

[0007] Therefore, there is a need to develop a safe, efficient, environmentally friendly, economical, and high-yield method for preparing anisodamine. Summary of the Invention

[0008] To address the shortcomings of existing technologies, the present invention aims to provide a hyoscyamine 6β-hydroxylase mutant and its application in the biotransformation preparation of hyoscyamine. The hyoscyamine 6β-hydroxylase mutant of the present invention is obtained through site-directed and random mutations based on the original sequence. Compared with the original hyoscyamine 6β-hydroxylase, it exhibits changes in protein structure and function, with enhanced hydroxylation activity (2.0-4.7 times that of the wild type), while its epoxidation capacity is lost or reduced.

[0009] Using a hyoscyamine 6β-hydroxylase mutant as a biocatalyst, 0.8 g / L hyoscyamine can be directly catalyzed to produce anisodamine, with a substrate conversion rate as high as 98.6% after 28 hours, compared to only 57.6% in the wild-type mediated system. Compared to currently reported processes, the process involved in this invention has milder reaction conditions, simpler operation steps, does not require the addition of chemical inhibitors, and is less expensive, providing a more promising biotransformation process for the synthesis of anisodamine.

[0010] In a first aspect, the present invention provides a hyoscyamine 6β-hydroxylase mutant, comprising: compared with wild-type hyoscyamine 6β-hydroxylase, having amino acid mutations at at least the following two sites or functionally equivalent sites: position 14 and position 97.

[0011] According to an embodiment of the present invention, the wild-type hyoscyamine 6β-hydroxylase is named DmH6H, derived from Daturametel.

[0012] According to embodiments of the present invention, the inventors used site-directed mutagenesis to molecularly modify wild-type hyoscyamine 6β-hydroxylase DmH6H, thereby obtaining a hyoscyamine 6β-hydroxylase DmH6H mutant with enhanced catalytic activity. The modified hyoscyamine 6β-hydroxylase exhibits higher catalytic activity and substrate tolerance. In industrial applications, it can significantly improve catalytic efficiency (increase substrate concentration, shorten catalytic time, increase substrate conversion rate and product yield) and reduce reagent waste, save production costs, reduce the generation of excess byproducts in chemical reactions, and reduce environmental pollution.

[0013] It should be noted that the term "functionally equivalent site" refers to the amino acid site corresponding to the same functional domain in a hyoscyamine 6β-hydroxylase. For example, a certain hyoscyamine 6β-hydroxylase has two functional domains A and B with the same function, and the sites in domain B are functionally equivalent to the corresponding sites in domain A.

[0014] According to an embodiment of the present invention, the amino acid positions in the amino acid sequence of the hyoscyamine 6β-hydroxylase mutant of the present invention are located with reference to the amino acid positions in the amino acid sequence of the wild-type hyoscyamine 6β-hydroxylase DmH6H.

[0015] In some embodiments, the above-mentioned hyoscyamine 6β-hydroxylase mutant further includes at least one of the following technical features:

[0016] The wild-type hyoscyamine 6β-hydroxylase DmH6H has the amino acid sequence shown in SEQ ID NO:1:

[0017] 1MATLVSNWST NNVSESFIAP LEKRAEKDVA LGNDVPIIDL QQDHLLIVQQ ITKACQDFGL

[0018] 61FQVINHGVPE KLMVEAMEVY KEFFALPAEE KEKFQPKGEP AKFELPLEQK AKLYVEGERR

[0019] 121CNEEFLYWKD TLAHGCYPLH EELLNSWPEK PPTYRDVIAK YSVEVRKLTM RILDYICEGL

[0020] 181GLKLGYFDNE LTQIQMLLAN YYPSCPDPST TIGSGGHYDG NLITLLQQDL VGLQQLIVKD

[0021] 241DKWIAVEPIP TAFVVNLGLT LKVMSNEKFE GSIHRVVTHP IRNRISIGTL IGPDYSCTIE

[0022] 301PIKELISQEN PPLYKPYPYA EFAEIYLSDK SDYDAGVKPY KINQFPN;

[0023] The nucleic acid encoding wild-type hyoscyamine 6β-hydroxylase DmH6H has the nucleotide sequence shown in SEQ ID NO:2:

[0024]

[0025]

[0026] In some embodiments, the hyoscyamine 6β-hydroxylase mutant has at least 80% identity with the wild-type hyoscyamine 6β-hydroxylase.

[0027] In some embodiments, the hyoscyamine 6β-hydroxylase mutant has at least 90% identity with the wild-type hyoscyamine 6β-hydroxylase.

[0028] In some embodiments, the hyoscyamine 6β-hydroxylase mutant has at least 95% identity with the wild-type hyoscyamine 6β-hydroxylase.

[0029] In some embodiments, the hyoscyamine 6β-hydroxylase mutant shares at least 98% identity with the wild-type hyoscyamine 6β-hydroxylase. Generally, higher amino acid sequence identity indicates greater similarity in structure and function.

[0030] According to embodiments of the present invention, the mutant has at least the following mutations: amino acid S at position 14 is mutated to P, and amino acid K at position 97 is mutated to A; in some embodiments, the scopolamine 6β-hydroxylase mutant is named DmH6H / S14P / K97A, or DmH6Hmut (labeled as DmH6Hmut).

[0031] In some embodiments, the above-mentioned hyoscyamine 6β-hydroxylase mutant DmH6H / S14P / K97A further includes at least one of the following technical features:

[0032] The hyoscyamine 6β-hydroxylase mutant DmH6H / S14P / K97A has the amino acid sequence shown in SEQ ID NO:3:

[0033]

[0034]

[0035] The nucleic acid encoding the hyoscyamine 6β-hydroxylase mutant DmH6H / S14P / K97A has the nucleotide sequence shown in SEQ ID NO:4:

[0036]

[0037] According to embodiments of the present invention, the hyoscyamine 6β-hydroxylase mutant comprises: having amino acid mutations at at least three sites or functionally equivalent sites compared to wild-type hyoscyamine 6β-hydroxylase:

[0038] The 14th, 97th, and 326th positions.

[0039] According to embodiments of the present invention, compared with wild-type hyoscyamine 6β-hydroxylase, the mutant has at least the following mutations: amino acid S at position 14 is mutated to P, amino acid K at position 97 is mutated to A, and amino acid Y at position 326 is mutated to M; in some embodiments, the hyoscyamine 6β-hydroxylase mutant is named DmH6H / S14P / K97A / Y326M, or DmH6Hmut / Y326M.

[0040] In some embodiments, the above-mentioned hyoscyamine 6β-hydroxylase mutant DmH6Hmut / Y326M further includes at least one of the following technical features:

[0041] The hyoscyamine 6β-hydroxylase mutant DmH6Hmut / Y326M has the amino acid sequence shown in SEQ ID NO:5:

[0042] 1MATLVSNWST NNVPESFIAP LEKRAEKDVA LGNDVPIIDL QQDHLLIVQQ ITKACQDFGL

[0043] 61FQVINHGVPE KLMVEAMEVY KEFFALPAEE KEKFQPAGEP AKFELPLEQK AKLYVEGERR

[0044] 121CNEEFLYWKD TLAHGCYPLH EELLNSWPEK PPTYRDVIAK YSVEVRKLTM RILDYICEGL

[0045] 181GLKLGYFDNE LTQIQMLLAN YYPSCPDPST TIGSGGHYDG NLITLLQQDL VGLQQLIVKD

[0046] 241DKWIAVEPIP TAFVVNLGLT LKVMSNEKFE GSIHRVVTHP IRNRISIGTL IGPDYSCTIE

[0047] 301PIKELISQEN PPLYKPYPYA EFAEIMLSDK SDYDAGVKPY KINQFPN;

[0048] The nucleic acid encoding the hyoscyamine 6β-hydroxylase mutant DmH6Hmut / Y326M has the nucleotide sequence shown in SEQ ID NO:6:

[0049] 1ATGGCCACCC TGGTGAGCAA TTGGAGCACC AATAATGTTC CGGAAAGTTT TATTGCCCG

[0050] 61CTGGAAAAAC GTGCCGAAAA AGATGTGGCA CTGGGTAATG ATGTTCCGAT TATTGATCTG

[0051] 121CAGCAGGATC ATCTGCTGAT TGTTCAGCAG ATTACCAAAG CATGTCAGGA TTTTGGTCTG

[0052] 181TTTCAGGTTA TTAATCATGG CGTGCCGGAA AAACTGATGG TTGAAGCAAT GGAAGTGTAT

[0053] 241AAAGAATTTT TCGCACTGCC GGCAGAAGAA AAGAAAAAAT TTCAGCCGGC AGGTGAACCG

[0054] 301GCCAAATTTG AACTGCCGCT GGAACAGAAA GCCAAACTGT ATGTGGAAGG CGAACGCCGT

[0055] 361TGCAATGAAG AATTTCTGTA TTGGAAAGAT ACCCTGGCAC ATGGCTGTTA TCCGCTGCAT

[0056] 421GAAGAACTGC TGAATAGCTG GCCGGAAAAA CCGCCGACCT ATCGTGATGT TATTGCCAAA

[0057] 481TATAGTGTGG AAGTGCGCAA ACTGACCATG CGCATTCTGG ATTATTTG TGAAGGCCTG

[0058] 541GGTCTGAAAC TGGGTTATTT TGATAATGAA CTGACCCAGA TTCAGATGCT GCTGGCAAAT

[0059] 601TATTACCCGA GCTGCCCGGA CCCTAGTACC ACCATTGGCA GCGGTGGTCA TTATGATGGT

[0060] 661AATCTGATTA CCCTGCTGCA GCAGGACCTG GTTGGCCTGC AGCAGCTGAT TGTGAAAGAT

[0061] 721GATAAATGGA TTGCCGTGGA ACCGATTCCG ACCGCATTTG TGGTTAATCT GGGCCTGACC

[0062] 781CTGAAAGTTA TGAGCAATGA AAAATTTGAG GGTAGTATTC ATCGCGTTGT TACCCATCCG

[0063] 841ATTCGTAATC GTATTAGTAT TGGCACCCTG ATTGGTCCGG ATTATAGTTG CACCATTGAA

[0064] 901CCGATTAAGG AACTGATTAG CCAGGAAAAT CCGCCGCTGT ATAAACCGTA TCCGTATGCA

[0065] 961GAATTTGCAG AAATCATGCT GAGTGATAAA AGCGATTATG ATGCAGGTGT TAAACCGTAT

[0066] 1021AAAATTAATC AGTTCCCGAA TTAA.

[0067] According to some specific embodiments of the present invention, when the amino acid sequence of the hyoscyamine 6β-hydroxylase mutant has the above-mentioned mutation, the catalytic activity is stronger. Furthermore, the above-mentioned mutation sites can be selectively combined to obtain hyoscyamine 6β-hydroxylase mutants suitable for the required catalytic activity.

[0068] It should be noted that the amino acid sequences of the above mutants were all obtained by mutation based on the sequence of SEQ ID NO:1.

[0069] In a second aspect, the present invention provides a gene encoding a hyoscyamine 6β-hydroxylase mutant as described in the first aspect of the present invention. The gene has a nucleotide sequence as shown in SEQ ID NO:4; or the gene has a nucleotide sequence as shown in SEQ ID NO:6.

[0070] In a third aspect, the present invention provides a nucleic acid molecule. According to embodiments of the present invention, the nucleic acid molecule encodes a hyoscyamine 6β-hydroxylase mutant as described in the first aspect of the present invention. The hyoscyamine 6β-hydroxylase mutant encoded by the nucleic acid molecule can be obtained in large quantities in vivo or in vitro.

[0071] In a fourth aspect of the invention, a recombinant expression vector is provided. According to an embodiment of the invention, the recombinant expression vector comprises the nucleic acid molecule described in the third aspect of the invention. According to an embodiment of the invention, the recombinant expression vector comprises the gene described in the second aspect of the invention. According to an embodiment of the invention, the recombinant expression vector can express a hyoscyamine 6β-hydroxylase mutant in vitro.

[0072] According to embodiments of the present invention, the recombinant expression vector may further include at least one of the following technical features:

[0073] According to an embodiment of the present invention, the recombinant expression vector is selected from at least one of pET series vectors, shuttle vectors, bacteriophages, and viral vectors.

[0074] According to embodiments of the present invention, the pET series carriers include, but are not limited to, pET-3a, pET-11a, pET-15a, pET-28a, pET-30a, pET-32a, and pET-22b.

[0075] According to an embodiment of the present invention, the pET series vector is preferably pET-28a. In a specific embodiment of the present invention, using pET-28a as the recombinant expression vector results in higher relative activity and volumetric enzyme activity of the hyoscyamine 6β-hydroxylase mutant.

[0076] In a fifth aspect of the invention, a recombinant cell is provided. According to embodiments of the invention, the recombinant cell carries the nucleic acid molecule described in the third aspect of the invention or the expression vector described in the fourth aspect of the invention. According to embodiments of the invention, the recombinant cell carries the gene described in the second aspect of the invention. The recombinant cell is used to express or secrete the hyoscyamine 6β-hydroxylase mutant described in the first aspect of the invention.

[0077] According to embodiments of the present invention, the recombinant cells may further include at least one of the following technical features:

[0078] According to an embodiment of the present invention, the recombinant cells are selected from prokaryotic cells, yeast, or eukaryotic cells.

[0079] In a sixth aspect of the invention, a recombinant bacterial strain is provided. According to embodiments of the invention, the recombinant strain expresses the hyoscyamine 6β-hydroxylase mutant described in the first aspect of the invention. The hyoscyamine 6β-hydroxylase mutant can be rapidly and extensively obtained by culturing the recombinant strain.

[0080] In some embodiments, the recombinant strain includes *Escherichia coli*, *Pichia pastoris*, or *Bacillus subtilis*. Preferably, the recombinant strain is *Escherichia coli* BL21(DE3).

[0081] In a seventh aspect of the invention, the use of the scopolamine 6β-hydroxylase mutant described in the first aspect in the preparation of scopolamine is proposed.

[0082] In some embodiments, the use includes: fermenting and culturing Escherichia coli carrying a hyoscyamine 6β-hydroxylase mutant, and using hyoscyamine as a substrate, performing microbial catalytic transformation on recombinant Escherichia coli genetically engineered cells containing the hyoscyamine 6β-hydroxylase mutant to prepare hyoscyamine.

[0083] In an eighth aspect of the present invention, a method for preparing anisodamine is provided. According to an embodiment of the present invention, the method includes: using anisodamine as a substrate, fermenting and culturing the recombinant cells described in the fifth aspect of the present invention, the recombinant bacterial strain described in the sixth aspect of the present invention, or Escherichia coli expressing the anisodamine 6β-hydroxylase mutant described in the first aspect of the present invention to obtain anisodamine.

[0084] According to embodiments of the present invention, the method for preparing anisodamine has higher catalytic efficiency and lower environmental pollution.

[0085] In this invention, wild-type hyoscyamine 6β-hydroxylase DmH6H catalyzes the reaction of hyoscyamine substrate to obtain scopolamine and anisodamine, as shown in the following reaction formula:

[0086]

[0087] In this invention, the wild-type hyoscyamine 6β-hydroxylase DmH6H mutant catalyzes the hyoscyamine substrate to obtain anisodamine, as shown in the following reaction formula:

[0088] The fact that scopolamine does not further transform into hyoscyamine proves that the DmH6H mutant described in this invention has enhanced hydroxylation activity while its epoxidation ability disappears or decreases.

[0089] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0090] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood in conjunction with the following description of the embodiments in conjunction with the accompanying drawings, wherein:

[0091] Figure 1 It represents the relative viability of wild-type DmH6H and its mutants.

[0092] Figure 2 This is a comparison of the hydroxylation activities of DmH6Hmut and its mutants. Detailed Implementation

[0093] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, and should not be construed as limiting the present invention.

[0094] definition

[0095] The terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of that feature. In the description of this invention, "a plurality of" means at least two, such as two, three, etc., unless otherwise explicitly specified.

[0096] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0097] In this application, unless otherwise stated, the term "amino acid" is represented by a single-letter or three-letter code with the following meanings: A: Ala (alanine); R: Arg (arginine); N: Asn (asparagine); D: Aspartic acid (aspartic acid); C: Cys (cysteine); Q: Gln (glutamine); E: Glu (glutamic acid); G: Gly (glycine); H: Histidine; I: Ile (isoleucine); L: Leu (leucine); K: Lysine (lysine); M: Met (methionine); F: Phe (phenylalanine); P: Proline (proline); S: Serine (serine); T: Threonine (threonine); W: Tryptophan (tryptophan); Y: Tyrosine (tyrosine); V: Valine (valine).

[0098] In this application, unless otherwise stated, the term "hyoscyamine 6β-hydroxylase" is abbreviated as H6H, and the enzyme number is EC1.14.11.11; it refers to a dioxygenase that depends on α-ketoglutarate and ferrous ions. It is also a bifunctional enzyme that catalyzes the hydroxylation of hyoscyamine to 6β-hydroxyhyoscyamine (also known as scopolamine).

[0099] In this application, "homology" has the conventional meaning in the art, referring to the "identity" between two nucleic acid or amino acid sequences. The percentage represents the statistically significant percentage of identical nucleotide or amino acid residues between the two sequences to be compared after best alignment, where differences between the two sequences are randomly distributed throughout their length. In this application, the mutants are described based on mutations at specific residues, the positions of which are determined by alignment with the wild-type enzyme sequence SEQ ID NO:1 or by referencing the enzyme sequence SEQ ID NO:1.

[0100] In this application, unless otherwise stated, the terms "mutant" and "variant" are used interchangeably, as are "substitution" and "mutation," referring to changes, substitutions, insertions, and / or deletions at one or more positions relative to the amino acids of a wild-type protein, such as the wild-type sequence SEQ ID NO. 1 of hyoscyamine 6β-hydroxylase DmH6H, or derived from hyoscyamine 6β-hydroxylase DmH6H, while retaining its activity. Variants can be obtained by various techniques known in the art, such as chemically synthesized products or generated from prokaryotic or eukaryotic hosts using recombinant techniques. In particular, exemplary techniques for modifying the DNA sequence encoding the wild-type protein using recombinant techniques include, but are not limited to, directed mutagenesis, random mutagenesis, and the construction of synthetic oligonucleotides.

[0101] In this invention, the terms “parent” and “maternal” are used interchangeably, and these expressions refer to the mutants constructed. In this document, the terms “parent” and “maternal” refer to the wild-type hyoscyamine 6β-hydroxylase DmH6H of sequence SEQ ID NO.1.

[0102] In this article, the term "transformation" refers to the introduction of DNA into a host cell so that the DNA can be replicated as an extrachromosomal element or through chromosomal integration. That is, transformation refers to the alteration of gene synthesis caused by the introduction of exogenous DNA into a cell. The term "culture of a transformant" refers to the product obtained by culturing a transformant according to known methods for culturing microorganisms.

[0103] In this application, unless otherwise stated, the term "substitution" in relation to amino acid position or residue means that an amino acid at a particular position has been replaced by another amino acid. Substitution can be conserved or non-conserved.

[0104] The following is a detailed description of the embodiments. The examples listed below are merely specific embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Details of some molecular cloning methods vary depending on the supplier of reagents, enzymes, or kits; these should be followed according to the product instructions and will not be described in detail in the embodiments.

[0105] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0106] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0107] Example 1: Establishment of a genetically engineered strain of wild-type hyoscyamine 6β-hydroxylase

[0108] Using the wild-type amino acid sequence of hyoscyamine 6β-hydroxylase (GenBank: AAQ04302.1) indexed in NCBI as the research object, the full-length gene was synthesized into a pET28a(+) expression plasmid (with Nco I and Xho I restriction sites) after codon optimization and by a service provider (General Biotechnology (Anhui) Co., Ltd.). The plasmid was then transformed into Escherichia coli (E. coli) BL21(DE3) competent cells and plated on LB agar plates containing 50 mg / L kanamycin. After overnight incubation at 37°C, recombinant E. coli expressing wild-type hyoscyamine 6β-hydroxylase was obtained. Several single colonies were selected and cultured on LB medium (containing 50 mg / L kanamycin) at 37°C overnight. The recombinant plasmid was then extracted using a plasmid miniprep kit and sequenced for verification, yielding the recombinant plasmid of the hyoscyamine 6β-hydroxylase (DmH6H) parent strain.

[0109] The results showed that the nucleotide sequence of the synthesized DmH6H is shown in SEQ ID NO:2, and the corresponding amino acid sequence is shown in SEQ ID NO:1. This indicates that the recombinant expression plasmid pet28a-DmH6H and the E. coli engineered strain E. coli BL21(DE3) / pet28a-DmH6H carrying the recombinant plasmid were successfully constructed.

[0110] Example 2: Site-directed saturation mutagenesis of the wild-type DmH6H maternal gene

[0111] According to literature reports, the hyoscyamine 6β-hydroxylase (AaH6H) derived from *Anisodusacutangulus* underwent molecular modification to obtain the mutant strain S14P / K97A, which exhibits enhanced hydroxylation activity, 3.4 times that of the wild type. Comparison analysis of the amino acid sequence of DmH6H with the hyoscyamine 6β-hydroxylase gene sequences reported in the NCBI database revealed a high degree of amino acid identity (>80%) and conservation. Comparison analysis of the wild-type DmH6H amino acid sequence with the reported AaH6H amino acid sequence showed a sequence identity of 86.6%. Based on structure-function relationships, it is speculated that the S14P and K97A mutants may also promote the hydroxylation activity of wild-type DmH6H. Therefore, this mutant strain was constructed through site-directed mutagenesis (primer list is shown in Table 1). Using the wild-type DmH6H recombinant plasmid as a template, the mutants DmH6H / S14P and DmH6H / K97A were amplified using primer pair S14P-F / R and primer pair K97A-F / R, respectively. The amplification system (40 μL) consisted of 20 μL Primestar (2×premix), 1 μL of each primer pair, 0.5 μL of the corresponding plasmid template, and water to a final volume of 40 μL. The amplification program was as follows: pre-denaturation at 98℃ for 10 min; (denaturation at 98℃ for 10 s; annealing at 55℃ for 5 s; extension at 72℃ for 180 s) × 30 cycles, followed by a second extension at 72℃ for 10 min. After amplification, gel electrophoresis was performed. PCR products with band sizes meeting expectations were digested with Dpn I and incubated at 37℃ for 60 min. The processed amplified samples were then transformed into E. coli BL21(DE3) competent cells, subjected to heat shock and recovery (a known and commonly used method), and then plated on kanamycin-resistant plates and incubated overnight at 37°C. The next day, single colonies were randomly selected from the plates for sequencing verification.

[0112] After sequencing verification, a single colony of the successfully constructed mutant strain DmH6H / S14P was transferred to LB medium (containing 50 mg / L kanamycin) and incubated overnight at 37°C. The recombinant plasmid was then extracted using a plasmid miniprep kit, yielding the recombinant plasmid of the DmH6H / S14P mutant strain. Subsequently, using the DmH6H / S14P recombinant plasmid as a template, the mutant DmH6H / S14P / K97A was constructed using primer pair K97A-F / R. The amplification system (40 μL) consisted of: 20 μL Primestar (2×premix), 1 μL of each primer pair, 0.5 μL of the corresponding plasmid template, and water to a final volume of 40 μL. The amplification program was as follows: pre-denaturation at 98°C for 10 min; (denaturation at 98°C for 10 s; annealing at 55°C for 5 s; extension at 72°C for 180 s) × 30 cycles, followed by a second extension at 72°C for 10 min. After amplification, gel electrophoresis was performed. PCR products with confirmed band sizes meeting expectations were digested with Dpn I and incubated at 37°C for 60 min. The processed amplified samples were then transformed into E. coli BL21(DE3) competent cells, heat-shocked, and thawed (using known and widely accepted methods). The cells were then plated on kanamycin-resistant plates and incubated overnight at 37°C. The next day, single colonies were randomly selected from the plates for sequencing verification, yielding the mutant DmH6H / S14P / K97A.

[0113] Table 1 Primer sequences designed for site-directed saturation mutagenesis

[0114] Primer Name 5' Sequence 3' S14P-F CAATAATGTTCCCGAAAGTTTTATTGCCCCGCTG S14P-R CTTTCGGGAACATTATTGGTGCTCCAATTGCTCAC K97A-F CAGCCGGCAGGTGAACCGGCCAAATTTGAACTG K97A-R GTTCACCTGCCGGCTGAAATTTTTCTTTTTCTTC

[0115] The results showed that two single-point mutants of DmH6H, DmH6H / S14P and DmH6H / K97A, and their combined mutant DmH6H / S14P / K97A were obtained through site-directed mutagenesis. The nucleotide sequence of the mutant DmH6H / S14P / K97A is shown in SEQ ID NO:4, and the corresponding amino acid sequence is shown in SEQ ID NO:3. A recombinant Escherichia coli engineered strain carrying the DmH6H / S14P / K97A mutant gene was also obtained.

[0116] Example 3: Comparison of enzyme activities of hyoscyamine 6β-hydroxylase parent strain and its mutant strain

[0117] The single-site mutants (DmH6H / S14P and DmH6H / K97A), the double-site mutants (DmH6H / S14P / K97A), and the wild-type DmH6H obtained in Example 2 were streaked onto plates. The next day, transformants of similar size were picked and inoculated into LB medium containing kanamycin resistance (kanamycin concentration of 50 mg / L) and cultured overnight at 37°C with shaking. Subsequently, 2% (v / v) of the inoculum was added to 50 mL of fermentation medium (15 g / L yeast extract, 10 g / L peptone, 5 g / L NaCl, 2.4 g / L K2HPO4, and 1.5 g / L glucose) and cultured at 37°C and 220 rpm for 2 h. Then, IPTG was added to a final concentration of 0.2 mM to induce protein expression, and hyoscyamine was added to a final concentration of 0.3 g / L to catalyze the reaction. The mixture was cultured at 18°C ​​and 220 rpm. 1000 μl samples were taken at 0 h and 2 h and centrifuged (13000 rpm, 3 min). The supernatant was filtered through a membrane and sent for HPLC analysis. The results showed that the catalytic activity of the single-site mutants (DmH6H / S14P and DmH6H / K97A) and the double-site mutants (DmH6H / S14P / K97A) was increased, being 2.0 times, 2.5 times, and 3.1 times that of the wild-type DmH6H, respectively (the relative activities of the mutants are shown in the figure). Figure 1 (As shown). Subsequently, the dual-site mutant strain DmH6H / S14P / K97A (labeled as DmH6Hmut) was selected as the research object for further semi-rational design.

[0118] The results showed that the catalytic performance of both single and double mutants constructed based on wild-type DmH6H was improved, and the double mutant DmH6H / S14P / K97A (labeled as DmH6Hmut) had the best catalytic performance (3.1 times better). Therefore, it was selected as the research object for further catalytic performance modification.

[0119] Example 4: Site-directed saturation mutagenesis of the DmH6Hmut mutant

[0120] The three-dimensional structure of wild-type DmH6H has been resolved. A semi-rational analysis was performed on the dual-site mutant strain DmH6H / S14P / K97A (labeled DmH6Hmut) using the structural model, and site-directed saturation mutagenesis was performed at sites G220 and Y326. Using the recombinant plasmid of the dual-site mutant strain DmH6H / S14P / K97A (labeled DmH6Hmut) obtained in Example 2 as a template, PCR amplification was performed using the primers designed in Table 2. The amplification system (40 μL) consisted of: 20 μL Primestar (2×premix), 1 μL of each primer pair, 0.5 μL of the corresponding plasmid template, and water to a final volume of 40 μL. The amplification program was: pre-denaturation at 98℃ for 10 min; (denaturation at 98℃ for 10 s; annealing at 55℃ for 5 s; extension at 72℃ for 180 s) × 30 cycles, followed by a second extension at 72℃ for 10 min. After amplification, gel electrophoresis was performed. PCR products with confirmed band sizes meeting expectations were digested with Dpn I and incubated at 37°C for 60 min. The processed amplified samples were then transformed into E. coli Trans 1-T1 competent cells, heat-shocked, and thawed (using known and widely accepted methods). The cells were then plated on kanamycin-resistant plates and incubated overnight at 37°C. The next day, single colonies were randomly selected from the plates for sequencing verification.

[0121] Table 2 Primer sequences designed for site-directed saturation mutagenesis

[0122] Primer Name 5' Sequence 3' G220-F TTATGATNNKAATCTGATTACCCTGCTGCA G220-R CAGATTMNNATCATAATGACCACCGCTGCC Y326-F GAAATCNNKCTGAGTGATAAAAGCGATTATGATG Y326-R CTCAGMNNGATTTCTGCAAATTCTGCATACG

[0123] The results showed that, based on protein structure-guided semi-rational design, two potential functional amino acid sites, G220 and Y326, were selected for further study. Saturation mutant libraries of G220 and Y326 were constructed using site-directed saturation mutagenesis.

[0124] Example 5: Construction of DmH6Hmut mutant expression strain

[0125] The clonal strains of the G220 and Y326 mutants (40 in total) successfully constructed in Example 4, verified by sequencing, were streaked onto plates containing kanamycin resistance. The next day, single colonies were picked and transferred to LB medium containing kanamycin resistance (kanamycin concentration 50 mg / L), and cultured overnight at 37°C with shaking. The bacterial cells were collected, and plasmids were extracted. Subsequently, the recombinant plasmid of the DmH6H mutant was transformed into E. coli BL21(DE3) competent cells, and after heat shock and recovery (a known and commonly used method), the cells were plated onto plates containing kanamycin resistance and incubated overnight at 37°C. This yielded expression strains of different mutants at the G220 and Y326 sites of the DmH6Hmut mutant.

[0126] The results showed that 40 mutant strains were successfully constructed by screening through sequencing results and transformed into expression hosts, and their expression strains were successfully obtained, which can be used for subsequent biotransformation culture and enzyme activity comparison analysis.

[0127] Example 6: Fermentation culture and enzyme activity comparison analysis of G220 and Y326 site mutants of DmH6Hmut

[0128] Single colonies of similar size were picked from plates containing the G220 and Y326 mutant expression strains of DmH6Hmut, as well as from plates containing the DmH6Hmut mutant, and inoculated into LB medium containing kanamycin resistance (kanamycin concentration 50 mg / L), and cultured overnight at 37°C with shaking. Then, 2% (v / v) inoculum was added to 50 mL of fermentation medium (15 g / L yeast extract, 10 g / L peptone, 5 g / L NaCl, 2.4 g / L K₂HPO₄, 1.5 g / L glucose), and cultured at 37°C, 220 rpm for 2 h. Subsequently, IPTG was added to a final concentration of 0.2 mM for protein expression induction, and hyoscyamine was added to a final concentration of 0.4 g / L for transformation, and cultured at 20°C, 220 rpm. Samples were taken at 3h and 18h ​​(processing method as described in Example 3), and HPLC was used to detect changes in hyoscyamine, anisodamine, and scopolamine in the reaction system. HPLC results at 18h showed that when the tyrosine Y at position 326 was mutated to methionine M, serine S, valine V, cysteine ​​C, glutamine Q, tryptophan W, alanine A, threonine T, or leucine L, only hyoscyamine and anisodamine were detected in the reaction system, while scopolamine was not detected. Similarly, when the tyrosine at position 220 was mutated to proline, only hyoscyamine and anisodamine were detected in the reaction system, while scopolamine was not detected. These results indicate that these mutant strains retained only hydroxylation ability while completely losing epoxidation ability.

[0129] A comparative analysis of the activity of 11 mutant strains possessing only hydroxylation ability was performed, and the results are as follows: Figure 2 As shown in the data, among the 11 mutant strains, only the mutant Y326M showed an increased hydroxylation activity, which was 1.9 times that of the DmH6Hmut mutant and 4.7 times that of the wild-type DmH6H. The hydroxylation activities of the other mutant strains (Y326S, Y326V, Y326C, Y326Q, Y326W, Y326A, Y326T, Y326L, and G220P) were all decreased compared to the DmH6Hmut mutant.

[0130] Detection method: Chromatographic column: Waters The detection conditions for C18 (4.6×100mm, 3.5μm) analyte, scopolamine, and hyoscyamine were as follows: mobile phase: 0.1% ammonia: acetonitrile = 80:20; flow rate: 1.0 mL / min; detection wavelength: 210 nm; column temperature: 25℃.

[0131] The results showed that comparative analysis of the hydroxylation and epoxidation activities of these 40 strains revealed that when tyrosine Y at position 326 was mutated to methionine M, serine S, valine V, cysteine ​​C, glutamine Q, tryptophan W, alanine A, threonine T, and leucine L, and when tyrosine at position 220 was mutated to proline, only hyoscyamine and anisodamine were detected in the reaction system, while scopolamine was not detected. Ten mutant strains were screened that retained only hydroxylation ability but completely lost epoxidation ability. Comparative analysis of the hydroxylation abilities of these mutant strains showed that only mutant Y326M exhibited increased hydroxylation activity, which was 1.9 times that of the DmH6Hmut mutant and 4.7 times that of the wild-type DmH6H.

[0132] Example 7: Application of the mutant DmH6Hmut / Y326M in the biotransformation synthesis of anisodamine

[0133] Single colonies of wild-type DmH6H, mutant DmH6Hmut, and mutant DmH6Hmut / Y326M were inoculated into LB medium containing kanamycin resistance (kanamycin concentration 50 mg / L) and cultured overnight at 37°C with shaking. Subsequently, 4% (v / v) inoculum was added to 50 mL of fermentation medium (15 g / L yeast extract, 10 g / L peptone, 5 g / L NaCl, 2.4 g / L K₂HPO₄, 1.5 g / L glucose) and cultured at 37°C, 220 rpm for 2 h. Protein expression was then induced by adding IPTG to a final concentration of 0.4 mM, and transformation was performed by adding hyoscyamine substrate to a final concentration of 0.8 g / L, and cultured at 20°C, 220 rpm. Samples were taken at 28 h for analysis, and sample processing was performed as described in Example 3. HPLC results showed that in the wild-type DmH6H-mediated reaction system, the substrate was converted to both scopolamine and anisodamine, while in the mutant DmH6Hmut / Y326M-mediated reaction system, the substrate was directly converted to scopolamine, and no scopolamine was observed. Furthermore, the conversion rates of scopolamine in the wild-type DmH6H, mutant DmH6Hmut, and mutant DmH6Hmut / Y326M-mediated reaction systems were 57.6%, 88.3%, and 98.6%, respectively.

[0134] The results showed that the mutant DmH6Hmut / Y326M only converted the substrate hyoscyamine to anisodamine, while the wild-type DmH6H-mediated reaction system contained both anisodamine and scopolamine. Furthermore, because the hydroxylation activity of the mutant DmH6Hmut / Y326M was significantly superior to that of the wild-type DmH6H and the mutant DmH6Hmut, the conversion rate of the substrate hyoscyamine in the DmH6Hmut / Y326M-mediated system reached 98.6% within the same time frame, compared to 57.6% for the wild-type DmH6H and 88.3% for the mutant DmH6Hmut / Y326M.

[0135] In the description of this specification, the references to terms such as "some embodiments," "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0136] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A hyoscyamine 6β-hydroxylase mutant, comprising: Compared with wild-type hyoscyamine 6β-hydroxylase, it has amino acid mutations at at least two of the following sites or functionally equivalent sites: position 14 and position 97.

2. The hyoscyamine 6β-hydroxylase mutant according to claim 1, wherein the wild-type hyoscyamine 6β-hydroxylase has the amino acid sequence shown in SEQ ID NO:1; Optionally, the hyoscyamine 6β-hydroxylase mutant has at least 80% identity with the wild-type hyoscyamine 6β-hydroxylase; preferably more than 90% identity; more preferably more than 95% identity; and most preferably more than 98% identity.

3. The hyoscyamine 6β-hydroxylase mutant according to claim 1, compared with wild-type hyoscyamine 6β-hydroxylase, the mutant has at least the following mutations: The 14th amino acid S is mutated to P, and the 97th amino acid K is mutated to A; Optionally, the hyoscyamine 6β-hydroxylase mutant has the amino acid sequence shown in SEQ ID NO:

3.

4. The hyoscyamine 6β-hydroxylase mutant according to claim 1, comprising: Compared to wild-type hyoscyamine 6β-hydroxylase, it has amino acid mutations at at least three of the following sites or functionally equivalent sites: The 14th, 97th, and 326th positions.

5. The hyoscyamine 6β-hydroxylase mutant according to claim 4, compared with wild-type hyoscyamine 6β-hydroxylase, the mutant has at least the following mutations: The 14th amino acid S is mutated to P, the 97th amino acid K is mutated to A, and the 326th amino acid Y is mutated to M; Optionally, the scopolamine 6β-hydroxylase mutant has the amino acid sequence shown in SEQ ID NO:

5.

6. A gene encoding a hyoscyamine 6β-hydroxylase mutant according to claim 3, said gene having a nucleotide sequence as shown in SEQ ID NO:4; or The gene encodes the hyoscyamine 6β-hydroxylase mutant of claim 5, and the gene has the nucleotide sequence shown in SEQ ID NO:

6.

7. A nucleic acid molecule, said nucleic acid molecule encoding the scopolamine 6β-hydroxylase mutant according to any one of claims 1 to 5.

8. A recombinant expression vector comprising the nucleic acid molecule of claim 7 or the gene of claim 6.

9. The recombinant expression vector according to claim 8, wherein the recombinant expression vector is selected from at least one of pET series vectors, shuttle vectors, bacteriophages, and viral vectors; Optionally, the pET series carriers include pET-3a, pET-11a, pET-15a, pET-28a, pET-30a, pET-32a or pET-22b; Preferably, the pET series carrier is pET-28a.

10. A recombinant cell carrying the gene of claim 6, the nucleic acid molecule of claim 7, or the recombinant expression vector of any one of claims 8-9; Optionally, the recombinant cells are selected from prokaryotic cells, yeast, or eukaryotic cells.

11. A recombinant strain expressing the hyoscyamine 6β-hydroxylase mutant according to any one of claims 1 to 5; Optionally, the recombinant strain includes Escherichia coli, Pichia pastoris, or Bacillus subtilis; preferably, the recombinant strain is Escherichia coli BL21(DE3).

12. Use of the scopolamine 6β-hydroxylase mutant according to any one of claims 1 to 5 in the preparation of scopolamine.

13. A method for preparing anisodamine, comprising: Using hyoscyamine as a substrate, the recombinant cells of claim 10, the recombinant strain of claim 11, or Escherichia coli expressing the hyoscyamine 6β-hydroxylase mutant of any one of claims 1-5 are fermented to obtain hyoscyamine.