ThrA mutant for improving serine tolerance and application of ThrA mutant in preparation of L-serine

By randomly mutating the homoserine dehydrogenase ThrA, its binding level with L-serine was reduced, solving the toxicity problem of L-serine accumulation to cell growth, increasing the yield and biomass of L-serine, and achieving more efficient L-serine production.

CN121653087APending Publication Date: 2026-03-13ANHUI HUAHENG BIOTECH CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411277821.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-09-12
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

The accumulation of L-serine hinders cell growth, resulting in low biomass and yield. Existing technologies are insufficient to effectively improve the production efficiency of L-serine through microbial fermentation.

Method used

By predicting the binding site of the homoserine dehydrogenase ThrA using bioinformatics and performing random mutations, ThrA mutants were constructed to reduce the binding level of L-serine to ThrA, improve the strain's tolerance to L-serine, and enhance the expression of key enzymes in the L-serine synthesis pathway.

Benefits of technology

This method increases the yield and biomass of L-serine in microbial fermentation, enhances cellular tolerance to L-serine, and achieves more efficient L-serine production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention relates to a ThrA mutant for improving serine tolerance and application of the ThrA mutant in preparation of L-serine. In one aspect, the present invention provides a homoserine dehydrogenase ThrA mutant having any one of amino acid substitutions of Y259T, S298R, A373C, or any combination thereof, relative to a wild-type homoserine dehydrogenase ThrA. In another aspect, the present invention provides a method of producing L-serine or L-serine derivatives comprising culturing a bacterium in a culture medium wherein the bacterium contains a coding sequence of the homoserine dehydrogenase ThrA mutant. According to the ThrA mutant provided by the invention, the tolerance of cells to the L-serine and the yield of the L-serine are improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a ThrA mutant and its application in the preparation of L-serine. Background Technology

[0002] L-Serine is a fundamental amino acid that makes up proteins and has important applications in medicine, food, and cosmetics. In food, L-serine primarily improves flavor and sensory qualities. In medicine, its derivatives, such as cycloserine and azoserine, can be used as drugs, and L-serine can also be used as a precursor to synthesize substances like choline and purines. In cosmetics, L-serine is an important natural moisturizing factor that helps retain moisture in the stratum corneum of the skin. Due to its potential applications as a fundamental biochemical material, L-serine is considered one of the top 30 most significant biochemicals. Currently, the market demand for L-serine is continuously increasing, but its production technology is relatively underdeveloped.

[0003] Industrially, L-serine is mainly produced through protein hydrolysis, chemical synthesis, and enzymatic conversion. Protein hydrolysis and chemical synthesis methods suffer from complex processes, difficulties in separation and purification, and heavy pollution. Enzymatic conversion offers advantages such as simple processes and high product purity, but its high cost of precursors and low conversion rate limit large-scale industrial production. Currently, microbial fermentation is more suitable for large-scale industrial application due to its environmentally friendly production process, significantly reduced costs, and easy reaction control. However, L-serine is toxic to cell growth, resulting in low biomass during microbial fermentation and actual yields far below theoretical yields. Therefore, improving the tolerance of bacterial strains to high-concentration serine environments and mitigating the toxic effects of L-serine on cell growth are key challenges to achieving high-yield L-serine production through microbial fermentation.

[0004] In microorganisms such as Escherichia coli and Corynebacterium glutamicum, glucose enters the L-serine branch pathway via glycolysis (EMP) through 3-phosphoglycerate (3-PG), where it is converted into serine in three steps: First, 3-PG is converted into 3-phosphon-ooxypyruvate (3-PHP) by phosphoglycerate dehydrogenase (expressed by the SerA gene); second, 3-PHP is converted into the intermediate product 3-phosphoserine (3PSer) by phosphoserine transaminase (expressed by the serC gene); and third, 3PSer is converted into L-serine by phosphoserine phosphatase (expressed by the serB gene).

[0005] The degradation pathway of L-serine in microorganisms mainly includes two directions: (1) L-serine forms pyruvate through dehydrogenation reaction. In the existing technology, this degradation pathway is blocked by knocking out the three genes encoding serine deaminase, sdaA, sdaB and tdcG; (2) L-serine forms glycine by transferring hydroxymethyl groups. Under the action of hydroxymethyltransferase SHMT, L-serine transfers hydroxymethyl groups to tetrahydrofolate to generate glycine and methylenetetrahydrofuran.

[0006] L-serine accumulation can inhibit cell division and peptidoglycan synthesis, and it can also be converted into acrylates and other reactive intermediates, thus affecting cell viability. L-serine binds to homoserine dehydrogenase (ThrA), inhibiting its activity in the biosynthesis of branched-chain amino acids such as threonine; therefore, threonine supplementation was necessary in previous serine production experiments. Simultaneously, reduced homoserine dehydrogenase (ThrA) activity increases the accumulation of byproducts such as oxaloacetic acid and citric acid. The toxicity of L-serine makes high-titer production difficult in *E. coli*. Improving the toxic effects of L-serine on cell growth is crucial for increasing biomass and L-serine yield in microbial fermentation. Summary of the Invention

[0007] The technical problem to be solved:

[0008] The accumulation of L-serine hinders cell growth and severely impedes L-serine production. For example, high concentrations of L-serine bind to homoserine dehydrogenase (ThrA), inhibiting ThrA's activity in branched-chain amino acid biosynthesis and increasing the accumulation of byproducts such as oxaloacetic acid and citric acid, thereby hindering cell growth and severely reducing biomass and L-serine yield during fermentation. To improve the toxicity of L-serine to bacterial growth and increase the biomass and L-serine yield of microbial fermentation, this invention modifies the structure of thrA (the gene encoding ThrA) using bioinformatics combined with random mutation methods. This reduces the binding level of L-serine to homoserine dehydrogenase (ThrA), thereby increasing the strain's tolerance to L-serine (i.e., increasing biomass in microbial fermentation) and improving L-serine yield. Summary of the Invention:

[0010] The accumulation of L-serine is toxic to cell growth and inhibits the activity of homoserine dehydrogenase (ThrA), which is involved in the biosynthesis of branched-chain amino acids. The purpose of this invention is to increase L-serine production. This is achieved by predicting the binding site of thrA (the gene encoding thrA) to L-serine using bioinformatics methods, then randomly mutating the predicted thrA site to obtain a thrA mutant whose binding to L-serine is blocked. An expression vector for the thrA mutant is constructed and introduced into recombinant *E. coli* for expression, thereby obtaining the ThrA mutant. This reduces the impact of L-serine on the homoserine dehydrogenase ThrA, improving cellular tolerance to L-serine and increasing L-serine production.

[0011] Technical solution:

[0012] Wild-type Escherichia coli 8739 was used as the chassis strain. In order to achieve the best effect in L-serine production, the inventors made a series of modifications to wild-type Escherichia coli 8739 according to the prior art. Those skilled in the art can understand that the modifications are all preferred solutions. The present invention is also applicable to wild-type Escherichia coli 8739 without any modifications. The modifications include the following: in order to reduce the catabolism of L-serine, the catabolism pathway from serine to pyruvate was knocked out, that is, the sdaA, sdaB and tdcG genes were knocked out; and in order to enhance the synthesis of L-serine, the serA, serC and serB genes involved in the L-serine synthesis pathway were integrated into the genome to construct a recombinant strain (the serA gene is from reference [1], and the serB and serC genes are from wild-type Escherichia coli).

[0013] In order to relieve the feedback inhibition of L-serine on the key enzyme serA and thus further increase the production of L-serine, based on the published information in the prior art (e.g., Al-Rabiee, R., Zhang, Y., and Grant, GA (1996) The Mechanism of Velocity Modulated Allosteric Regulation in D-3-Phosphoglycerate Dehydrogenase. J. Biol. Chem. 271, 23235-23238, which discloses that His344Ala, Asn346Ala and Asn364Ala mutations are beneficial to the accumulation of serine), the applicant also mutated the serA gene (i.e., His344Ala, Asn346Ala and Asn364Ala). Those skilled in the art will understand that His344Ala, Asn346Ala, and Asn364Ala are merely preferred embodiments. In strains without the aforementioned mutations, the ThrA mutant for which protection is sought can still achieve the effects of increasing cellular tolerance to L-serine and increasing L-serine production.

[0014] In this document, the term "integration" in "integration of serA, serC, and serB genes" refers to the introduction of genes such as serA, serC, and serB into the genome of a host cell. The purpose of "integration of serA, serC, and serB genes" in this document is to achieve overexpression of serA, serC, and serB genes. Those skilled in the art will appreciate that any means known in the prior art for gene overexpression are applicable.

[0015] Subsequently, the inventors used Calculate Mutation Energy (Stability) (wherein Calculate Mutation Energy is a commonly used software in the prior art that can perform virtual amino acid mutations) to perform a global scan of ThrA protein from E. coli and predicted that Y259, S298 and A373 are key steric sites that prevent serine binding;

[0016] The third step involves randomly mutating Y259, S298, and A373 to construct mutant expression vectors, expressing them in recombinant strains, and screening for L-serine-tolerant ThrA mutants with increased biomass and L-serine production.

[0017] In this embodiment of the invention, the Ls003 strain (i.e., a strain obtained by knocking out the sdaA, sdaB, and tdcG genes and integrating the serA, serB, and serC genes from wild-type Escherichia coli 8739) was used for research. The purpose of knocking out the sdaA, sdaB, and tdcG genes is to block the L-serine catabolism pathway. Those skilled in the art will anticipate that, in strains without knocking out these three genes, the thrA mutant claimed in this invention can still achieve the effects of this invention; knocking out these three genes is merely a preferred technical solution. Furthermore, the Ls003 strain also integrates the serA, serB, and serC genes. As described above regarding the L-serine synthesis pathway, overexpressing the serA, serB, and serC genes in the strain aims to further promote L-serine synthesis. Those skilled in the art will anticipate that, in strains without integrating these two genes, the thrA mutant claimed in this invention can still achieve the effect of increasing L-serine production; integrating these three genes is merely a preferred technical solution.

[0018] In summary, in one aspect of the present invention, a homoserine dehydrogenase ThrA mutant is provided, which, relative to wild-type homoserine dehydrogenase ThrA, has any one of the amino acid substitutions Y259T, S298R, A373C or any combination thereof.

[0019] In a specific embodiment of the present invention, the wild-type homoserine dehydrogenase ThrA is derived from Escherichia coli.

[0020] In a specific embodiment of the present invention, the amino acid sequence of the wild-type homoserine dehydrogenase ThrA is shown in SEQ ID NO:44.

[0021] In another aspect of the invention, a method for producing L-serine or L-serine derivatives is provided, the method comprising culturing bacteria in a culture medium, wherein the cells comprise the coding sequence of the above-described homoserine dehydrogenase ThrA mutant.

[0022] In a specific embodiment of the present invention, Escherichia coli is used as the substrate bacteria, but those skilled in the art will understand that any other strain known in the prior art that can synthesize L-serine is applicable, as long as it has the L-serine synthesis pathway, such as Corynebacterium glutamicum.

[0023] Specifically, the present invention provides the following technical solutions:

[0024] 1. A homoserine dehydrogenase ThrA mutant, which, relative to wild-type homoserine dehydrogenase ThrA, has any one of the following amino acid substitutions: Y259T, S298R, A373C, or any combination thereof.

[0025] 2. The homoserine dehydrogenase ThrA mutant according to Project 1, wherein the amino acid sequence of the wild-type homoserine dehydrogenase ThrA is shown in SEQ ID NO:44.

[0026] 3. The homoserine dehydrogenase ThrA mutant according to Project 2, wherein the coding sequence of the wild-type homoserine dehydrogenase ThrA is shown in SEQ ID NO:43.

[0027] 4. A nucleic acid molecule encoding a homoserine dehydrogenase ThrA mutant according to any one of items 1-3.

[0028] 5. An expression vector comprising the nucleic acid molecule described in item 4.

[0029] 6. A host cell comprising the nucleic acid molecule described in item 4 or the expression vector described in item 5.

[0030] 7. The use of the high serine dehydrogenase ThrA mutant as described in any one of Items 1-3, the nucleic acid molecule as described in Item 4, the expression vector as described in Item 5, or the host cell as described in Item 6 in the preparation of L-serine or L-serine derivatives.

[0031] 8. A method for producing L-serine or L-serine derivatives, the method comprising culturing bacteria in a culture medium, wherein the bacteria contain the nucleic acid molecule described in item 4 or the expression vector described in item 5;

[0032] Preferably, the bacteria include Escherichia coli or Corynebacterium glutamicum.

[0033] 9. The method according to Project 8, wherein the sdaA, sdaB and tdcG genes in the bacteria are knocked out or knocked down; and / or the serA, serB and serC genes in the bacteria are overexpressed.

[0034] 10. The method according to Project 8, wherein the L-serine derivative is selected from the group consisting of L-cysteine, L-methionine, L-glycine, O-acetylserine, L-tryptophan, thiamine, ethanolamine and ethylene glycol.

[0035] Beneficial effects:

[0036] This invention provides an L-serine-tolerant ThrA mutant, which improves cellular tolerance to L-serine and L-serine production. The ThrA mutant was obtained through bioinformatics-based combinatorial random mutagenesis and expressed in recombinant *E. coli*, resulting in increased L-serine production and increased OD (oxidative stress) of biomass during fermentation. 600 . Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments.

[0038] Unless otherwise specified, the methods used in the following examples are conventional methods, and the reagents used are commercially available reagents.

[0039] 1. The strains and plasmids constructed in this invention are detailed in Table 1, and the primers used are detailed in Table 2.

[0040] Table 1. Strains and plasmids used in this invention

[0041]

[0042]

[0043] Table 2 Primers used in this invention

[0044]

[0045]

[0046] In the primer sequence, "n" represents any one of A, T, C, and G.

[0047] 2. The following examples involve biological materials:

[0048] 2×Phanta Mix high-fidelity enzyme is a product of Novizan, catalog number: P525-01.

[0049] 2×rapid Taq enzyme is a product of Novizan, catalog number P222-01.

[0050] DH5α competent cells are a product of Novizan, catalog number C502-03.

[0051] DpnI digestive enzyme is a Thermo Fisher Scientific product, product code E101.

[0052] The ClonExpress II One Step Cloning Kit is from Novizan, catalog number C112-01.

[0053] Fermentation medium: glucose: 10 g / L, potassium dihydrogen phosphate: 2 g / L, magnesium sulfate heptahydrate: 2 g / L, yeast extract: 2 g / L, threonine: 0.24 g / L, monosodium glutamate: 2.9 g / L, alanine: 0.1 g / L, glycine: 0.6 g / L, ammonium sulfate: 3 g / L, 1X trace element stock solution: 1 mL / L, biotin: 0.001 g / L.

[0054] 1X Trace Element Mother Liquor Formula Table

[0055] reagents Final concentration (g / L) Mother liquor (1000×) (g / L) Zinc sulfate heptahydrate 0.005 5 Manganese sulfate monohydrate 0.002 2 Cobalt chloride hexahydrate 0.0005 0.5 Copper sulfate pentahydrate 0.0002 0.2 Vitamin B1 0.005 5

[0056] Example 1: Construction of recombinant strains Ls001, Ls002, and Ls003

[0057] 1. Construction of strain Ls001

[0058] In this embodiment, strain LS001 was constructed, which is a strain obtained by knocking out the sdaA gene and integrating the serA gene from wild-type Escherichia coli 8739. The specific construction method is as follows: using ΔsdaA::serA-UF / ΔsdaA::serA-UR primers (SEQ ID NO: 3 and 4), using the wild-type Escherichia coli 8739 genome as a template, the upstream homologous arm UP fragment (i.e., ΔsdaA::serA-UP) was obtained by PCR amplification; using ΔsdaA::serA-DF / ΔsdaA::serA-DR primers (SEQ ID NO: 7 and 8), using the wild-type Escherichia coli 8739 genome as a template, the downstream homologous arm DOWN fragment (i.e., ΔsdaA::serA-DOWN) was obtained by PCR amplification; using serA-F / serA-R primers (SEQ ID NO: 4), the downstream homologous arm DOWN fragment (i.e., ΔsdaA::serA-DOWN) was obtained by PCR amplification; using serA-F / serA-R primers (SEQ ID NO: 4), the upstream homologous arm UP fragment (i.e., ΔsdaA::serA-DOWN) was obtained by PCR amplification; using serA-F / serA-R primers (SEQ ID NO: 4), the downstream homologous arm DOWN ... NO:5 and 6) The serA fragment was obtained by PCR amplification; the UP, serA, and DOWN fragments were ligated by overlap PCR to obtain the homologous recombination fragment UP-serA-DOWN (i.e., ΔsdaA::serA-donor). Using ptarget plasmid (purchased from Fenghui Biotechnology, catalog number: YH095) as a template, the pTarget-ΔsdaA::serA-sgRNA fragment was amplified using ΔsdaA::serA-sgF / ΔsdaA::serA-sgR primers (SEQ ID NO:1 and 2), and transformed into DH5α competent cells to obtain the pTarget-ΔsdaA::serA-sgRNA targeting plasmid. The operation methods and systems used are as follows:

[0059] 1) The PCR reaction system (50 μL) consisted of: 20 μL ddH2O, 2 μL upstream primer (10 mM), 2 μL downstream primer (10 mM), 1 μL genomic DNA template, and 25 μL 2×Phanta Mix high-fidelity enzyme. The PCR reaction program was as follows: Step 1: 95℃, 3 min; Step 2: 95℃, 15 s, 60℃, 10 s; Step 3: 72℃, 1 min; This step was repeated 30 times, 72℃, 5 min each time. Step 4: Store at 4℃. PCR amplification yielded ΔsdaA::serA-UP, ΔsdaA::serA-DOWN, and pTarget-ΔsdaA::serA-sgRNA fragments.

[0060] 2) The overlap PCR reaction system (50 μL) consisted of: 25 μL of 2×Phanta Mix high-fidelity enzyme, 1 μL each of ΔsdaA::serA-UP and ΔsdaA::serA-DOWN fragments, 2 μL each of primers ΔsdaA::serA-UF (SEQ ID NO:3) (10 mM) and ΔsdaA::serA-DR (SEQ ID NO:8) (10 mM), and 19 μL of ddH2O. The overlap PCR reaction program was as follows: Step 1: 95℃, 3 min; Step 2: 95℃, 15 s, 60℃, 10 s; Step 3: 72℃, 2 min; This step was repeated 30 times at 72℃ for 5 min. Step 4: Store at 4℃. The ΔsdaA::serA-donor fragment was obtained.

[0061] 3) Transformation: The pTarget-ΔsdaA::serA-sgRNA fragment obtained by PCR amplification was transformed into DH5α competent cells (Novizan product, catalog number C502-03); the cells were placed on ice for 20 minutes, then transferred to a 42℃ water bath for 60 seconds of heat stimulation, followed by an ice bath for 2 minutes; 900 μL of LB liquid medium was added to the tube and mixed well, then incubated at 37℃ and 200 rpm for 1 hour; the culture was then spread on Spec-resistant LB plates and incubated at 37℃ for 8-12 hours. The strain was then sent to Qingke Biotechnology for sequencing. Plasmids were extracted from the correctly sequenced strains using the EZNAPlasmid Mini Kit I(200) kit (purchased from Omega Bio-Tek, catalog number: D6943-02) to obtain the pTarget-ΔsdaA::serA-sgRNA targeting plasmid.

[0062] 4) Obtaining the Ls001 recombinant strain: The pTarget-ΔsdaA::serA-sgRNA targeting plasmid and ΔsdaA::serA-donor fragment constructed above were transformed into wild-type Escherichia coli 8739 (purchased from Shanghai Culture Collection Center, strain number SMHCC(SHBCC)D80178) for gene editing. Single-colony PCR verification was performed using ΔsdaA::serA-UF / ΔsdaA::serA-DR verification primers (SEQ ID NO: 3 and 8). Strains with correct verification were sequenced. The correctly sequenced strain was the successfully gene-edited strain, named Ls001, which is a strain obtained by knocking out the sdaA gene and integrating the serA gene from wild-type Escherichia coli 8739.

[0063] 2. Construction of strains Ls002 and Ls003

[0064] The construction process for strains Ls002 and Ls003 is the same as that for Ls001.

[0065] The Ls002 strain is a strain obtained by knocking out the sdaB gene and integrating the serC gene from the Ls001 strain, specifically, a strain obtained by knocking out the sdaA and sdaB genes and integrating the serA and serC genes from wild-type *E. coli* 8739. Its construction method is similar to that of Ls001. First, using the same fragment construction method described above, the ΔsdaB::serC-donor fragment and the pTarget-ΔsdaB::serC-sgRNA plasmid were obtained. Then, the constructed ΔsdaB::serC-donor fragment and pTarget-ΔsdaB::serC-sgRNA plasmid were electroporated into LS001 for gene editing. Single-colony PCR verification was performed using the ΔsdaB::serC-UF (SEQ ID NO:11) / ΔsdaB::serC-DR (SEQ ID NO:16) verification primers. Strains that were correctly verified were sequenced. Strains with correct sequencing were considered successfully gene-edited and named LS002.

[0066] The Ls003 strain was obtained by knocking out the tdcG gene and integrating the serB gene from the Ls002 strain. Specifically, it was obtained by knocking out the sdaA, sdaB, and tdcG genes from wild-type *E. coli* 8739 and integrating the serA, serB, and serC genes. Its construction method was similar to that of Ls001. First, using the same fragment construction method described above, the ΔtdcG::serB-donor fragment and the pTarget-ΔtdcG::serB-sgRNA plasmid were obtained. Then, the constructed ΔtdcG::serB-donor fragment and pTarget-ΔtdcG::serB-sgRNA plasmid were electroporated into LS002 for gene editing. Single-colony PCR verification was performed using the ΔtdcG::serB-UF (SEQ ID NO:19) / ΔtdcG::serB-DR (SEQ ID NO:24) verification primers. Successfully verified strains were then sequenced. The strain that was correctly sequenced is the strain whose gene editing was successful, and it is named LS003.

[0067] Example 2 Construction of ThrA mutant

[0068] 1. Construct the wild-type expression plasmid ptrc99a-thrA(WT) for ThrA. The specific steps are as follows: Using primers ptrc99a-CF / ptrc99a-CR (SEQ ID NO: 25 and 26), the ptrc99a plasmid (purchased from Shanghai Zeye Biotechnology Co., Ltd., product number ZY1294) was used as a template to amplify the ptrc99a expression vector fragment by PCR. Using primers thrA(WT)-F / thrA(WT)-R (SEQ ID NO: 27 and 28), the thrA(WT) fragment was amplified by PCR using the genome of wild-type Escherichia coli 8739 (purchased from Shanghai Culture Collection Center, strain number SMHCC(SHBCC)D80178) as a template. The thrA(WT) fragment was ligated to the ptrc99a expression vector using a one-step cloning method to obtain the ptrc99a-thrA(WT) wild-type expression plasmid. The ptrc99a-thrA(WT) wild-type expression plasmid was then electroporated into Ls003 to obtain the Ls003 / 0 expression strain, which served as a control strain containing wild-type ThrA. The procedures and systems used are as follows:

[0069] The PCR reaction system (50 μL) consisted of: 20 μL ddH2O, 2 μL upstream primer (10 mM), 2 μL downstream primer (10 mM), 1 μL DNA template, and 25 μL 2×Phanta Mix high-fidelity enzyme. The PCR reaction program was as follows: Step 1: 95℃, 3 min; Step 2: 95℃, 15 s, 60℃, 10 s; Step 3: 72℃, 3 min; This step was repeated 30 times, 72℃, 5 min each time. Step 4: Store at 4℃. PCR amplification yielded the thrA(WT) fragment and the ptrc99a expression vector fragment. The ptrc99a expression vector fragment and the thrA(WT) fragment were ligated using a one-step cloning method to obtain the ligated mixture. 10 μL of the above mixture was liquefied and transformed into DH5α competent cells (Novizan, catalog number C502-03), cultured overnight, and colony PCR was performed for verification. Sequencing was then performed to obtain successfully mutated transformants. The wild-type expression plasmid ptrc99a-thrA(WT) was obtained.

[0070] 2. Construction of the ThrA hybrid mutant expression plasmid ptrc99a-thrA(NNN). Using the primers thrA(N259)-F (SEQ ID NO:29) / thrA(N259)-R (SEQ ID NO:30), and with the wild-type expression plasmid ptrc99a-thrA(WT) as a template, PCR was performed using the QuikChange Site-directed Mutagenesis kit (purchased from Stratagenene, catalog number: 600380) according to the manufacturer's instructions to randomly mutate the amino acid at position 259 of ThrA, resulting in a ThrA hybrid mutant expressed as ptrc99a, namely the ThrA hybrid mutant expression plasmid ptrc99a-thrA(NNN). The hybrid fragment was then electroporated into Ls003 and plated on LB+Kan resistant plates. The single colonies obtained on the plates were the hybrid ThrA expression mutants. Twenty single-clone strains were randomly selected and named Ls003 / 1 to Ls003 / 20. The operating methods and systems used are as follows:

[0071] The PCR reaction system (50 μL) consisted of: 20 μL ddH2O, 2 μL upstream primer (10 mM), 2 μL downstream primer (10 mM), 1 μL plasmid template, and 25 μL 2×Phanta Mix high-fidelity enzyme. The PCR reaction program was as follows: Step 1: 95℃, 3 min; Step 2: 95℃, 15 s, 60℃, 10 s; Step 3: 72℃, 3 min; This step was repeated 30 times, 72℃, 5 min each time. Step 4: Store at 4℃. PCR amplification yielded a mixed mutant fragment of ptrc99a-thrA(NNN).

[0072] 3. The method for randomly mutating amino acids at positions 298 and 373 of ThrA is similar to that for randomly mutating amino acids at position 259 of ThrA (the only difference is the primer sequence used; for example, the primer used for randomly mutating ThrA at position 298 is thrA(N298)-F / thrA(N298)-R, and the primer used for randomly mutating ThrA at position 373 is thrA(N373)-F / thrA(N373)-R). Finally, 20 single-clone strains were randomly selected from each and named Ls003 / 21-60 (i.e., Ls003 / 21 to Ls003 / 60, of which strains containing the mutation at position 298 of ThrA are Ls003 / 21 to Ls003 / 40, and strains containing the mutation at position 373 of ThrA are Ls003 / 41 to Ls003 / 60).

[0073] Example 3: Shake-flask fermentation of the mutant

[0074] The mutant strain Ls003 / 1-60 and the control strain Ls003 / 0 were inoculated into LB broth medium tubes supplemented with 50 μg / μL kanamycin and cultured overnight at 37°C and 200 rpm. The culture was then transferred at a 1 vt% inoculation rate to 50 mL and 250 mL (i.e., 250 mL fermentation flasks containing 50 mL of fermentation medium) and cultured at 37°C and 200 rpm until OD500 was reached. 600 =0.6-0.8, add 0.5mM IPTG, incubate at 37℃ and 200r / min for 24h, take 1mL of fermentation broth, record the biomass with a spectrophotometer, and detect L-serine using HPLC.

[0075] Fermentation results showed that strain Ls003 / 13, which had a high L-serine yield (3.45 g / L) from the 259th random mutation of ThrA, had a high biomass OD. 600 The yield reached 9.34, representing an increase of 61.97% and 64.73% in L-serine production and biomass compared to the control strain.

[0076] In the 298th random mutation of ThrA, strain Ls003 / 28 showed a high L-serine yield of 3.08 g / L, while the biomass OD... 600 The yield reached 9.08, representing an increase of 44.60% and 60.14% in L-serine production and biomass compared to the control strain.

[0077] In the random mutation at position 373 of ThrA, strain Ls003 / 54 exhibited a relatively high L-serine yield of 3.21 g / L, while its biomass OD... 600The yield reached 9.20, representing an increase of 50.70% and 62.26% in L-serine production and biomass compared to the control strain.

[0078] Ls003 / 13, Ls003 / 28, and Ls003 / 54 were sequenced, and the ThrA mutants were obtained as ThrA(Y259T), ThrA(S298R), and ThrA(A373C), respectively.

[0079] Table 3. L-Serine yield and biomass

[0080]

[0081]

[0082]

[0083] In this embodiment, the operation of detecting L-serine content using HPLC is as follows: Pre-column derivatization of the HPLC is performed as follows: the fermentation broth is diluted 10 times, centrifuged at 12000 rpm for 10 min, and the supernatant is filtered and analyzed by HPLC. Before entering the chromatographic column, the supernatant is mixed with OPA derivatizing agent to generate a fluorescent product, which is detected using a UV detector. The chromatographic column is EC C18. The preparation of mobile phase A is as follows: 31.2 g of sodium dihydrogen phosphate dihydrate is weighed, added to ultrapure water to approximately 5 L, the pH of the solution is adjusted to 7.80 with sodium hydroxide, and then brought to a final volume of 5 L. The solution is then filtered through a 0.22 μm aqueous membrane. The preparation of mobile phase B is as follows: 900 mL of methanol, 900 mL of acetonitrile, and 200 mL of ultrapure water are measured, mixed, and then filtered through a 0.22 μm aqueous membrane. The column temperature is 40 °C, and the detection wavelength is 338 nm.

[0084] Preparation of OPA derivative: Weigh 1.372 g of o-phthalaldehyde (OPA) and 0.5888 g of N-acetyl-L-cysteine ​​into a 100 mL volumetric flask, add 20 mL of anhydrous ethanol, sonicate to dissolve, and then dilute to 100 mL with 0.05 M sodium borate buffer (0.05 M, pH adjusted to 9.5 with sodium hydroxide), and store in the dark.

[0085] The elution conditions are:

[0086] Table 4

[0087]

[0088]

[0089] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0090] References:

[0091] [1] Al-Rabiee, R., Zhang, Y., and Grant, GA (1996) The Mechanism of Velocity Modulated Allosteric Regulation in D-3-PhosphoglycerateDehydrogenase. J. Biol. Chem. 271, 23235-23238.

[0092] sequence list

[0093] 1. SerA gene sequence encoding wild-type Escherichia coli (SEQ ID NO:35):

[0094]

[0095] The amino acid sequence of the SerA gene encoding SerA in wild-type Escherichia coli (SEQ ID NO:36):

[0096]

[0097] The serA gene sequence (SEQ ID NO:37) from reference [1] is as follows:

[0098]

[0099]

[0100] The serA amino acid sequence (SEQ ID NO:38) from reference [1] is as follows:

[0101]

[0102] 2. The SerB gene sequence encoding the SerB gene in *Escherichia coli* (SEQ ID NO:39):

[0103]

[0104] The SerB gene sequence encoding the SerB gene in Escherichia coli (SEQ ID NO:40):

[0105]

[0106] 3. The SerC gene sequence encoding the *E. coli* SerC gene (SEQ ID NO:41):

[0107]

[0108] The SerC gene sequence encoding the SerC gene in Escherichia coli (SEQ ID NO:42):

[0109]

[0110] 4. The thrA gene sequence encoding ThrA in wild-type Escherichia coli (SEQ ID NO:43):

[0111]

[0112]

[0113] The amino acid sequence of the thrA gene encoding ThrA in wild-type Escherichia coli (SEQ ID NO:44):

[0114]

[0115] 5. Y259T, S298R, and A373C: Mutate tyrosine at position 259 of thrA to threonine, serine at position 298 of thrA to arginine, and alanine at position 359 of thrA to cysteine.

[0116] Y259T gene sequence (SEQ ID NO:45):

[0117]

[0118] Y259T amino acid sequence (SEQ ID NO:46)

[0119] MRVLKFGGTSVANAERFLRVADILESNARQGQVATVLSAPAKITNHLVAMIEKTISGQDALPNISDAERIFAELLTGLAAAQPGFPLAQLKTFVDQEFAQIKHVLHGISLLGQCPDSINAALICRGEKMSIAIMAGVLEARGHNVTVIDPVEKLLAVGHYLESTVDIAESTRRIAASRIPADHMVLMAGFTAGNEKGELVVLGRNGSDYSAAVLAACLRADCCEIWTDVDGVYTCDPRQVPDARLLKSMSYQEAMELSTFGAKVLHPRTITPIAQFQIPCLIKNTGNPQAPGTLIGATRDEDELPVKGISNLNNMAMFSVSGPGMKGMVGMAARVFAAMSRARISVVLITQSSSEYSISFCVPQSDCVRAERAMQEEFYLELKEGLLEPLAVTERLAIISVVGDGMRTLRGISAKFFAALARANINIVAIAQGSSERSISVVVNNDDATTGVRVTHQMLFNTDQVIEVFVIGVGGVGGALLEQLKRQQSWLKNKHIDLRVCGVANSKALLTNVHGLNLENWQEELAQAKEPFNLGRLIRLVKEYHLLNPVIVDCTSSQAVADQYADFLREGFHVVTPNKKANTSSMDYYHLLRHAAEKSRRKFLYDTNVGAGLPVIENLQNLLNAGDELMKFSGILSGSLSYIFGKLDEGMSFSEATTLAREMGYTEPDPRDDLSGMDVARKLLILARETGRELELADIEIEPVLPAEFNAEGDVAAFMANLSQLDDLFAARVAKARDEGKVLRYVGNIDEDGACRVKIAEVDGNDPLFKVKNGENALAFYSHYYQPLPLVLRGYGAGNDVTAAGVFADLLRTLSWKLGV

[0120] S298R gene sequence (SEQ ID NO:47):

[0121]

[0122] S298R amino acid sequence (SEQ ID NO:48):

[0123] MRVLKFGGTSVANAERFLRVADILESNARQGQVATVLSAPAKITNHLVAMIEKTISGQDALPNISDAERIFAELLTGLAAAQPGFPLAQLKTFVDQEFAQIKHVLHGISLLGQCPDSINAALICRGEKMSIAIMAGVLEARGHNVTVIDPVEKLLAVGHYLESTVDIAESTRRIAASRIPADHMVLMAGFTAGNEKGELVVLGRNGSDYSAAVLAACLRADCCEIWTDVDGVYTCDPRQVPDARLLKSMSYQEAMELSYFGAKVLHPRTITPIAQFQIPCLIKNTGNPQAPGTLIGARRDEDELPVKGISNLNNMAMFSVSGPGMKGMVGMAARVFAAMSRARISVVLITQSSSEYSISFCVPQSDCVRAERAMQEEFYLELKEGLLEPLAVTERLAIISVVGDGMRTLRGISAKFFAALARANINIVAIAQGSSERSISVVVNNDDATTGVRVTHQMLFNTDQVIEVFVIGVGGVGGALLEQLKRQQSWLKNKHIDLRVCGVANSKALLTNVHGLNLENWQEELAQAKEPFNLGRLIRLVKEYHLLNPVIVDCTSSQAVADQYADFLREGFHVVTPNKKANTSSMDYYHLLRHAAEKSRRKFLYDTNVGAGLPVIENLQNLLNAGDELMKFSGILSGSLSYIFGKLDEGMSFSEATTLAREMGYTEPDPRDDLSGMDVARKLLILARETGRELELADIEIEPVLPAEFNAEGDVAAFMANLSQLDDLFAARVAKARDEGKVLRYVGNIDEDGACRVKIAEVDGNDPLFKVKNGENALAFYSHYYQPLPLVLRGYGAGNDVTAAGVFADLLRTLSWKLGV

[0124] A373C gene sequence (SEQ ID NO:49):

[0125] atgcgagtgttgaagttcggcggtacatcagtggcaaatgcagaacgttttctgcgggttgccgatattctggaaagcaatgccaggcaggggcaggtggccaccgtcctctctgcccccgccaaaatcaccaaccacctggtggcgatgattgaaaaaaccattagcggccaggatgctttacccaatatcagcgatgccgaacgtatttttgccgaacttttgacgggactcgccgccgcccagccgggattcccgctggcgcaattgaaaactttcgtcgatcaggaatttgc

[0126]

[0127] A373C amino acid sequence (SEQ ID NO:50):

[0128]

Claims

1. A homoserine dehydrogenase ThrA mutant, which, relative to wild-type homoserine dehydrogenase ThrA, has any one of the following amino acid substitutions: Y259T, S298R, A373C, or any combination thereof.

2. The homoserine dehydrogenase ThrA mutant according to claim 1, wherein, The amino acid sequence of the wild-type homoserine dehydrogenase ThrA is shown in SEQ ID NO:

44.

3. The homoserine dehydrogenase ThrA mutant according to claim 2, wherein, The coding sequence of the wild-type homoserine dehydrogenase ThrA is shown in SEQ ID NO:

43.

4. A nucleic acid molecule encoding a homoserine dehydrogenase ThrA mutant according to any one of claims 1-3.

5. An expression vector comprising the nucleic acid molecule of claim 4.

6. A host cell comprising the nucleic acid molecule of claim 4 or the expression vector of claim 5.

7. The use of the high-serine dehydrogenase ThrA mutant as described in any one of claims 1-3, the nucleic acid molecule as described in claim 4, the expression vector as described in claim 5, or the host cell as described in claim 6 in the preparation of L-serine or L-serine derivatives.

8. A method for producing L-serine or an L-serine derivative, the method comprising culturing bacteria in a culture medium, wherein the bacteria contain the nucleic acid molecule of claim 4 or the expression vector of claim 5; Preferably, the bacteria include Escherichia coli or Corynebacterium glutamicum.

9. The method according to claim 8, wherein, The sdaA, sdaB, and tdcG genes in the bacteria are knocked out or knocked down; and / or the serA, serB, and serC genes in the bacteria are overexpressed.

10. The method according to claim 8, wherein, The L-serine derivative is selected from the group consisting of L-cysteine, L-methionine, L-glycine, O-acetylserine, L-tryptophan, thiamine, ethanolamine, and ethylene glycol.