Application of protein and its related biomaterials in promoting monoterpenes accumulation in grape fruits

Abstract

The application discloses application of proteins and related biological materials in the field of variation or genetic engineering in promoting monoterpenes accumulation in grape fruits. The technical problem to be solved by the application is how to improve monoterpenes content in grape fruits. One technical solution to be protected by the application is application of a protein with an amino acid sequence of sequence 2 in the sequence listing in improving monoterpenes content in grape fruits. Experiments prove that VvHYH derived from grape can promote monoterpenes accumulation in grape fruits and leaves, and the application can be applied to grape flavor improvement and breeding.

Description

Technical Field

[0001] This invention relates to the application of proteins and related biomaterials in the field of mutation or genetic engineering to promote the accumulation of monoterpenes in grape fruits. Background Technology

[0002] Grapes are an important fruit crop, widely cultivated globally. Aroma is a crucial factor influencing grape quality and consumer purchasing desire; different grape varieties exhibit distinct aromas due to variations in their aroma components. In recent decades, the aroma of terpenes in grapes has been a focus of attention. Terpenes are primarily found in Eurasian grape varieties, possessing a rich aroma and low sensory threshold, making them typical aroma components of Muscat grapes. Currently, over 70 types of terpenes have been identified in grape berries, which can be classified into monoterpenes, sesquiterpenes, and diterpenes based on the number of structural units. Recent research indicates that monoterpenes possess properties that counteract high-temperature stress and have antioxidant effects, attracting significant attention in the breeding and quality control of table grapes. Monoterpenes in grape berries exist in both free and glycoside-bound states. The former directly enhances flavor; while the latter represents a class of potential aromatic components that can be hydrolyzed into odor-active forms. Therefore, understanding the synthesis and regulation of monoterpenes in grapes is of great significance for grape cultivation and flavor research in grape products. Terpenes in grapes have been shown to be synthesized primarily through the MEP and MVA pathways. The biosynthesis of monoterpenes mainly occurs via the MEP pathway in grapes. Some key enzyme genes include... VvDXS , VvGPPS and VvHDR These enzymes play a crucial role in the MEP and MVA processes of monoterpene biosynthesis. Currently, these monoterpene synthase genes are being cloned, and the functions of the proteins they express have been validated. However, the regulatory mechanisms of grape monoterpene biosynthesis pathways remain unclear. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to increase the monoterpene content of grapes and / or how to promote the accumulation of monoterpenes in grapes and / or how to improve the flavor of grapes.

[0004] To address the aforementioned technical problems, the present invention first provides any of the following applications of proteins: P1. Application of the protein in increasing the monoterpene content of grape fruit; P2. Application of the protein in grape flavor improvement; P3. Application of the protein in promoting monoterpene expression and / or accumulation in grape fruit; P4. Application of the protein in promoting the expression of monoterpene backbone genes and / or monoterpene synthase genes in grape fruit; P5. Application of the protein in grape breeding; The protein in question is the following: A1) The amino acid sequence is that of the protein in sequence 2 of the sequence listing; A2) A protein derived from A1) or having more than 80% identity with and the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2 of the Sequence Listing. A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0005] In the above applications, the protein may be derived from grapes.

[0006] In the above applications, the monoterpenes may be limonene, β-trans-ocimene, γ-terpinene, β-cis-ocimene, isoterpinene, alloterpinene, cis-furan-type oxylinanol, trans-furan-type oxylinanol, nerol, linanol, dehydrolinanol, α-terpineol, nerol, or / and geraniol; the monoterpenoid skeletal genes are VvDXS1, VvDXS4, and / or VvDXR; and the monoterpenoid synthase genes are VvTPS31, VvTPS32, and / or VvTPS35.

[0007] To address the aforementioned technical problems, the present invention also provides any of the following applications of biomaterials related to the proteins described above: Q1. Application of the aforementioned biomaterial in increasing the monoterpene content of grape fruit; Q2. Application of the biomaterials in grape flavor improvement; Q3. Application of the biomaterial in promoting monoterpene expression and / or accumulation in grape fruit; Q4. Application of the biomaterial in promoting the expression of monoterpene backbone genes and / or monoterpene synthase genes in grape fruit; Q5. Application of the aforementioned biological materials in grape breeding; The biomaterial may be any of the following: B1) Nucleic acid molecules that encode the proteins described above; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2); B8) Nucleic acid molecules that promote or enhance the gene expression of the proteins described above; B9) Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules described in B8).

[0008] In the above applications, the nucleic acid molecule described in B1) can be the gene encoding the protein as shown below: b1) The coding sequence of the coding strand is the cDNA molecule or DNA molecule of sequence 1 in the sequence listing; b2) A cDNA or DNA molecule that hybridizes with the cDNA or DNA molecule defined in b1) and encodes a protein having the same function.

[0009] In the above applications, the monoterpenes may be limonene, β-trans-ocimene, γ-terpinene, β-cis-ocimene, isoterpinene, alloterpinene, cis-furan-type oxylinanol, trans-furan-type oxylinanol, nerol, linanol, dehydrolinanol, α-terpineol, nerol, or / and geraniol; the monoterpenoid skeletal genes may be VvDXS1, VvDXS4, and / or VvDXR; and the monoterpenoid synthase genes may be VvTPS31, VvTPS32, and / or VvTPS35.

[0010] To address the aforementioned technical problems, the present invention also provides a method for increasing the monoterpene content of grape berries and / or improving grape flavor, comprising enhancing or increasing the activity of the proteins described above in grapes and / or the expression level of the genes encoding the proteins described above, thereby increasing the monoterpene content of grape berries and / or improving grape flavor.

[0011] In the above method, enhancing or increasing the activity of the protein described above in grapes and / or the expression level of the gene encoding the protein described above is achieved by introducing the gene encoding the protein described above into grapes.

[0012] In the above method, the monoterpene may be limonene, β-trans-ocimene, γ-terpinene, β-cis-ocimene, isoterpinene, alloterpinene, cis-furan-type linalool, trans-furan-type linalool, nerol, linalool, dehydrolinalool, α-terpineol, nerol, or / and geraniol.

[0013] The proteins and / or biological materials described above are also within the scope of protection of this invention.

[0014] This invention utilizes genome-wide molecular markers to genotype 176 grape accessions resulting from the cross between 'Italia' and 'Tamina', conducts genome-wide marker-associated association analysis (MAA) of monoterpene phenotypes, and explores significant genetic loci and key candidate genes determining the monoterpene aroma of these grape accessions. Notably, the study identified a key transcription factor, VvHYH, belonging to the bZIP gene family on chromosome 5 of the grape population, and found that it may promote the accumulation of grape monoterpenes by regulating the expression of monoterpene synthesis-related genes (VvDXS4, VvTPS32, and VvTPS35). This invention will contribute to grape flavor improvement breeding. Attached Figure Description

[0015] Figure 1 The distribution of monoterpenoid compounds in the two-year hybrid offspring samples is shown. A represents total monoterpenes in 2017; B represents geraniol in 2017; C represents neraldehyde in 2017; D represents linalool in 2017; E represents geranilic acid in 2017; F represents cis-oxidized rose in 2017; G represents total monoterpenes in 2018; H represents geraniol in 2018; I represents neraldehyde in 2018; J represents linalool in 2018; K represents geranilic acid in 2018; and L represents cis-oxidized rose in 2018. The vertical axis represents the distribution frequency.

[0016] Figure 2 Subcellular localization and transcriptional activity analysis of VvHYH. A shows the subcellular localization analysis of VvHYH; B shows the transcriptional activity of VvHYH in yeast cells; C shows the transcriptional activation activity of VvHYH in tobacco detected by a dual-luciferase reporter system.

[0017] Figure 3 for VvHYH Functional analysis in grape berries. WT represents the wild-type control group; VvHYH represents overexpression. VvHYH The experimental group and the control group are shown on the left and right axes. The horizontal axis represents the number of monoterpenoid compounds that showed statistically significant differences between the experimental and control groups, and the vertical axis represents the compound concentration (μg / kg). Asterisks * and ** represent significance levels of p<0.1 and p<0.01, respectively.

[0018] Figure 4Functional analysis of VvHYH in grape leaves and tobacco. A shows transient overexpression in grape leaves. Images show uninfected and infected leaves. B shows qRT-PCR results of monoterpene synthesis-related genes in grape leaves before and after VvHYH overexpression. An asterisk ** indicates a significance level of p < 0.01, an asterisk *** indicates a significance level of p < 0.001, and an asterisk **** indicates a significance level of p < 0.0001. C shows the concentration of monoterpenes in grape leaves. WT represents the wild-type control; VvHYH represents overexpression in the VvHYH group in infected leaves. D shows the expression of VvHYH and monoterpene synthesis-related genes in plants before and after stable transfer of VvHYH to tobacco. E shows the abundance of monoterpenes in tobacco. WT represents wild-type control tobacco plants; VvHYH represents tobacco plants overexpressing VvHYH. VvHYH-1, VvHYH-2, and VvHYH-3 represent three technical replicates.

[0019] Figure 5 The interaction between VvHYH and the VvDXS4 promoter is shown. A is a schematic diagram of the VvDXS4 promoter. The G-box core sequence of the probe used for EMSA is shown in red, and the mutant nucleotides are shown in blue. B shows the yeast one-hybrid analysis of VvHYH binding to the VvDXS4 promoter. The positive control represents the positive control. pJG and VvDXS4-pLacZ represent the negative control. C shows EMSA demonstrating that the VvHYH-His fusion protein binds directly to the G-box in the VvDXS4 promoter in vitro. D shows transient LUC imaging analysis indicating that VvHYH promotes the promoter activity of VvDXS4. Representative image of LUC activity in tobacco leaves 72 hours after infiltration. E shows the effect of VvHYH on VvDXS4 promoter activity investigated by LUC / REN reporter analysis. Data are the mean ± standard deviation of three biological replicates. *** indicates the significance level of p < 0.001.

[0020] Figure 6The interaction between VvHYH and the promoters of VvTPS32 and VvTPS35 is shown. A is a schematic diagram of the VvTPS32 promoter. The G-box core sequence of the probe used for EMSA is shown in red, and the mutant nucleotides are shown in blue. B shows yeast one-hybrid analysis of VvHYH binding to the VvTPS32 promoter. The positive control represents the positive control. pJG and VvTPS32 pLacZ are negative controls. C shows EMSA showing that the VvHYH-His fusion protein binds directly to the G-box in the VvTPS32 promoter in vitro. D shows transient LUC imaging analysis showing that VvHYH promotes the binding of the VvTPS32 promoter. Representative images of LUC activity in tobacco leaves 72 hours after infiltration. E shows the effect of VvHYH on VvTPS32 promoter activity investigated by LUC / REN reporter analysis. Data are the mean ± standard deviation of three biological replicates. An asterisk **** indicates a significance level of p < 0.0001. F is a schematic diagram of the VvTPS35 promoter. G represents yeast one-hybrid analysis of VvHYH's binding to the VvTPS35 promoter. Positive controls are shown. VvTPS35pLacZ represents negative controls. H shows EMSA analysis demonstrating that the VvHYH-His fusion protein binds directly to the G-box in the VvTPS35 promoter in vitro. I shows transient LUC imaging analysis indicating that VvHYH promotes VvTPS35 promoter binding. Representative images of LUC activity in tobacco leaves 72 hours after infiltration. J shows the effect of VvHYH on VvTPS35 promoter activity investigated by LUC / REN reporter analysis. Data are the mean ± standard deviation of three biological replicates. **** indicates p < 0.0001 significance. Detailed Implementation

[0021] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0023] The study materials consisted of the Eurasian grape varieties 'Italia' and 'Tamina', along with 176 F1 vines from their hybridization, collected in 2017 and 2018. 'Italia' and 'Tamina' were planted in an experimental vineyard at the Beijing Academy of Agricultural and Forestry Sciences, Institute of Forestry and Pomology, China (39°58′N, 116°13′E). 'Italia' is a late-ripening table grape variety bred in Italy by breeder Pirovane through a cross between 'Bican' and 'Muscat'; 'Tamina' is a late-ripening grape variety bred in Romania, sharing the same parent varieties as 'Italia', both being hybrids of 'Bican' and 'Muscat'. Grape berries were collected at maturity, taking into account both shaded and sun-exposed areas. A total of 100 grape berries were randomly and dispersedly collected, with three independent replicates. 176 young grape leaf samples were collected from the field, labeled, and used for subsequent determination of the DXS genotype and DNA extraction of the F1 offspring using KASP technology. The harvested fruits and leaves were flash-frozen with liquid nitrogen and stored in an ultra-low temperature freezer at -80°C.

[0024] Qualitative and quantitative analysis of monoterpenes: The extraction and determination of free monoterpenes followed the method of Liu et al. (Related literature: Liu S, Shan B, Zhou X, Gao W, Liu Y, Zhu B, Sun L. Transcriptome and metabolomics integrated analysis reveals terpene synthesis genes controlling linalool synthesis in grape berries. Journal of Agricultural and Food Chemistry. 2022;70(29):9084-94). Retention indices (RIs) and mass spectrometry information were calculated using AMDIS software. The mass spectrometry results were matched with the NIST material retrieval library, and the substances were identified by the retention indices of the material standards. Quantitative analysis of grape terpenes was performed using standard curves. Based on the sugar and acid content of grape juice, 1 L of simulated grape aqueous solution containing 7 g / L tartaric acid and 200 g / L glucose was prepared, and the pH was adjusted to 3.4 using 1 mol / L NaOH solution. Each standard was dissolved in ethanol (chromatographic grade), and then all standard solutions were mixed. The mixture was then diluted with a mixed matrix to 15 consecutive concentration levels. The following examples use R language to plot the frequency distribution and box plots of the compounds. Correlation analysis was performed using SPSS 27.0 (SPSS, USA), and correlation heatmaps were plotted using ChiPlot. The constructed phylogenetic tree was refined and enhanced using the online tool Evolview (http: / / www.evolgenius.info / evolview / # / ). One-way ANOVA or t-tests were used to compare significant differences (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001). Bar charts were plotted using GraphPad Prism 9.5 (GraphPad software, USA). Compound peak plots were generated using Origin.

[0025] The grape variety Ruidu Xiangyu in this invention embodiment is derived from a variety bred in this laboratory. It is available to the public from the applicant and is only used to replicate this invention. It may not be used for other purposes (Related literature: Xu Haiying, Zhang Guojun, Yan Ailing. Early-maturing grape variety 'Ruidu Xiangyu'. Journal of Horticulture, 2009).

[0026] The pSuper1300 vector was donated by Professor Sui Xiaolei's research group at the College of Horticulture, China Agricultural University, and is preserved in our laboratory. It is available to the public from the applicant and is only used to replicate this invention. It may not be used for any other purpose (Related literature: Nie J, Huang H, Wu S, Lin T, Zhang L, Lv L, Shi Y, Guo Y, Zhang Q, Li Y, Kong W, Li H, Yang Z, Li W, Xu L, Ma N, Zhang Z, Sun C, Sui X. Molecular regulation and domestication of parthenocarpy in cucumber. Nat Plants. 2025 Feb;11(2):176-190. doi: 10.1038 / s41477-024-01899-2).

[0027] The *Gnaphalium affine* was preserved in our laboratory and is available to the public from the applicant. It is used solely for replicating this invention and not for any other purpose (related literature: Liu S, Shan B, Zhou X, Gao W, Liu Y, Zhu B, Sun L. Transcriptome and Metabolomics Integrated Analysis Reveals Terpene Synthesis Genes Controlling Linalool Synthesis in Grape Berries. J Agric Food Chem. 2022 Jul 27;70(29):9084-9094. doi: 10.1021 / acs.jafc.2c00368). In this literature, the name of *Gnaphalium affine* is... Vitis quinquangularis .

[0028] The pJG vector was donated by Professor Ma Nan's research group at the College of Horticulture, China Agricultural University. It is preserved in our laboratory and is available to the public from the applicant. It is only used to replicate this invention and cannot be used for other purposes (Related literature: Cheng C, Yu Q, Wang Y, Wang H, Dong Y, Ji Y, Zhou X, Li Y, Jiang CZ, Gan SS, Zhao L, Fei Z, Gao J, Ma N. Ethylene-regulated asymmetric growth of the petal base promotes flower opening in rose (Rosa hybrida). Plant Cell. 2021 May 31;33(4):1229-1251. doi:10.1093 / plcell / koab031).

[0029] Example 1. Screening of candidate genes related to monoterpene accumulation.

[0030] 1. Determination of the aroma properties of monoterpenes.

[0031] Free monoterpenes were detected in the berries of 176 hybrid offspring of Eurasian grape varieties using headspace solid-phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS). A total of 26 monoterpenes for aroma were detected, and they were quantified using standard curves. The quantitative results for monoterpenes from both years are presented in concentration form. The analysis revealed continuous variation in these monoterpenes across offspring, exhibiting significant quantitative trait inheritance. Figure 1 (AL). The distribution frequency of most monoterpenes gradually decreases from the minimum to the maximum concentration region in the distribution map, indicating that most monoterpenes exhibit a Poisson distribution in the hybrid progeny, while a few exhibit a normal distribution. Geraniol and neraldehyde showed a normal distribution in the 2017 sample; however, in the 2018 sample, both monoterpenes showed a Poisson distribution. Figure 1 Chinese BC; Figure 1 (Middle HI). This invention found that the total monoterpenes content in hybrid progeny ranged more widely in 2018 than in 2017, showing 48.90 μg / kg to 36240.95 μg / kg ( Figure 1 China A; Figure 1 The presence of G indicates a significant annual variation in monoterpene accumulation. Among the 26 monoterpenes, linalool and geranilic acid were present in higher concentrations in the hybrid samples, both exhibiting a Poisson distribution. Linalool showed the widest concentration range in the progeny, with concentrations ranging from 19.93 μg / kg to 5808.61 μg / kg in 2017 and from 8.09 μg / kg to 20059.13 μg / kg in 2018. Figure 1 D; Figure 1 (J). Geraniol concentrations were also high, and its distribution showed quantitative trait inheritance (J). Figure 1 E; Figure 1 The content of this substance in 2017 (21.47 μg / kg to 15712.56 μg / kg) was significantly higher than that in 2018 (12.17 μg / kg to 4306.24 μg / kg). Some monoterpenes showed relatively low contents in their offspring, such as cis-oxidized rose; this monoterpene also exhibited quantitative trait inheritance characteristics ( Figure 1 Middle F; Figure 1 (L).

[0032] Furthermore, this invention used Pearson correlation analysis to assess the associations between different monoterpenes. Overall, most monoterpenes showed significant positive correlations, while a few showed negative correlations. The study found that β-myrcene, allocarboxene, (E,Z)-allocarboxene, β-cis-ocimene, and β-trans-ocimene showed strong correlations with other monoterpenes; a few monoterpenes (such as geranilic acid) showed weak correlations with most other monoterpenes. Specifically, significant positive correlations were found between α-terpineol, 4-terpineol, isoterpinene, γ-terpinene, and total monoterpenes, with correlation coefficients ranging from 0.702 to 0.985. These results suggest that a similar regulatory pattern may exist, involved in the regulation of these monoterpene biosynthesis.

[0033] 2. Whole genome resequencing and SNP analysis.

[0034] DNA was extracted from the young leaves of 176 true hybrid grapevines (F1 generation) of 'Italian' × 'Tamina' using a plant DNA extraction kit (Beijing Jinbaite Biotechnology Co., Ltd., DN115). Whole-genome sequencing was performed using the second-generation Illumina sequencing platform from Beijing BMI Biotech Co., Ltd., with a sequencing depth of 30× for parents and 10× for hybrid progeny. Reads with a base quality value less than 19 and an N content higher than 5% were removed to obtain high-quality sequences. The whole-genome sequence of PN 40024, downloaded from http: / / genomes.cribi.unipd.it / DATA / GENOME_12X / , was used as a reference genome. The filtered data were aligned to the reference genome using BWA v0.7.9a alignment software. The aligned sequences were sorted using Samtools v0.1.19 software, and PCR repetitive sequences were removed using Picard-tools v1.115 software.

[0035] SNPs and InDel sites were detected using GATK 4.0 software, and high-confidence SNP variants were obtained by filtering with Vcftools (FS>10.0, QD<10, DP<4, QUAL<30). SNPs were further screened based on the 5% rare marker criterion, 30% deletion criterion, and Hardy-Weinberg marker. Gene annotation was performed on the variant sites obtained in the previous screening using genome annotation files (gff / gtf) downloaded from http: / / genomes.cribi.unipd.it / DATA / V2 / V2.1 / and ANNOVAR software; functional annotation was performed on genes containing non-synonymous mutations using the Uniprot database. Finally, 207,951 SNP sites were obtained through resequencing data screening.

[0036] 3. Genome-wide single marker association analysis.

[0037] Genome-wide association analysis (GWAS) was performed on monoterpene traits and SNP markers from 176 grape samples over two consecutive years. For different monoterpene phenotypes, p-values ​​needed to be corrected, and bonferroni correction was used to ensure p < 0.01 / total markers reached a highly significant level.

[0038] Using equation (1), the regression model is used to establish the detection value y corresponding to the phenotypic trait of individual i. i : Equation (1); In equation (1), µ refers to the population mean; X i ξ refers to the subgroup corresponding to individual i; β refers to environmental factors; a and d refer to the additive and dominant effects of SNPs, respectively; ξ i and ζ i ε refers to the indicator vectors corresponding to the additive and dominant effects of SNPs in individual i, respectively; i Let ξ be the residual; where ξ is the residual. i and ζ i The definition formula is as follows:

[0039] The regression coefficients were estimated using the maximum likelihood method. The calculation for the label hypothesis test is as follows:

[0040] Where H0 corresponds to the simplified model and H1 corresponds to the complete model. The hypothesis test statistic is the log-likelihood ratio, χ². 2This can be considered as an asymptotic distribution of different df values. A permutation test is performed to calculate the significance level. The permutation test method is used, and the p-value thresholds for all traits are obtained through 1000 iterations to determine the significant sites.

[0041] To detect the correlation between quantitative phenotype and genotype, this study adopted the following two methods based on the characteristics of phenotypic distribution: (1) using a generalized linear model (GLM) to detect discrete variables that follow a Poisson distribution. (2) using a linear regression model to test the association between normally distributed continuous traits.

[0042] This study used 207,951 SNPs identified through whole-genome resequencing analysis for single-marker association analysis of monoterpene components. QTL mapping revealed that each monoterpene phenotype was associated with multiple SNPs, the vast majority of which were located on chromosomes 5, 11, 12, 15, 16, and 17. Specifically, 256 significant SNPs associated with linalool were detected in 2017, and 579 in 2018. These significant linalool-associated SNPs were predominantly located on chromosomes 8, 13, 17, and 19, with a few on chromosomes 7 and 14. In addition, significant SNPs for some monoterpenes were mainly located on chromosomes 5, 10, 11, 14, and 19. For example, significant SNPs associated with neraldehyde were mainly located on chromosomes 10, 11, and 14; and significant SNPs associated with α-terpineol were mainly located on chromosomes 5 and 19. Notably, many SNP sites associated with monoterpene phenotypes are identical, suggesting that a single SNP site may simultaneously influence multiple monoterpenes. These key SNP sites include 19 SNP sites on chromosome 5, 6 on chromosome 11, 11 on chromosome 12, 17 on chromosome 15, 19 on chromosome 16, and 29 on chromosome 17. The 19 SNP sites on chromosome 5 are significantly associated with monoterpene phenotypes such as α-terpineol, 4-terpineol, isoterpinene, and γ-terpinene, a result consistent with the significant positive correlations between some phenotypic traits mentioned earlier.

[0043] 4. Candidate gene screening.

[0044] Based on the physical location of SNP markers significantly associated with monoterpene traits in the grape reference genome, candidate genes within a 100kb region upstream and downstream of significant SNP sites were screened. Functional annotation and prediction of candidate genes were performed using the National Center for Biotechnology Information (https: / / www.ncbi.nlm.nih.gov / ).

[0045] Based on a 100 kb genomic region upstream and downstream of significant SNP sites, this study identified 41 key candidate genes across all chromosomes. Combining gene functional annotation and previous reports, the study found that 10 candidate genes may be involved in the synthesis of grape monoterpenes. These candidate genes include VIT_11s0052g01240 (encoding 1-deoxy-D-xylitol-5-phosphate synthase), VIT_12s0134g00020 (encoding isoprene synthase), VIT_12s0134g00030 (encoding E-β-ocimene synthase), VIT_12s0134g00040 (encoding isoprene synthase), and VIT_12s0134g00090 (encoding R-linalool synthesis). The enzymes include VIT_12s0134g00140 (encoding geraniol synthase), VIT_15s0024g00850 (encoding GPPS synthase), VIT_16s0115g00340 (encoding anthocyanin 5,3-O-glucosyltransferase), VIT_16s0115g00360 (encoding anthocyanin 3-O-glucosyltransferase), and VIT_05s0020g01090 (encoding HYH transcription factor).

[0046] Ultimately, VvHYH, a key transcription factor belonging to the bZIP gene family on chromosome 5, was selected as the main candidate gene for functional analysis.

[0047] Example 2. VvHYH Gene cloning and functional testing.

[0048] 1. VvHYH Gene cloning, bioinformatics analysis, and subcellular localization.

[0049] Total RNA extraction: Total RNA was extracted from 'Ruidu Xiangyu' grape berries using a Sigma-Aldrich plant total RNA extraction kit (Sigma-Aldrich, CA, USA). RNA quality and concentration were assessed using an Implen NanoPhotometer P330 (Munich, Germany). RNA was reverse transcribed into cDNA using M-MLV reverse transcriptase (Misi Biotechnology Co., Ltd., Shanghai, China). qRT-PCR analysis was performed according to established standard methods. VvUbiquitin As an internal control, the data were processed using LinRegPCR software.

[0050] RNA extracted from grape berries was reverse transcribed into cDNA, and then primers were designed using Oligo7 software to clone the cDNA. VvHYHThe full length of the gene was determined. The amino acid count, theoretical isoelectric point, molecular weight, and other physicochemical properties of grape VvHYH were analyzed using ProtParam software (https: / / web.expasy.org / protparam). DNAMAN software (Version 6.0) was used to analyze the grape... VvHYH The amino acid sequence encoded by the gene was compared with conserved domains of HYH and HY5 protein sequences from other plants. Multiple sequence alignment was performed using the MUSCLE tool in MEGA12 software to compare the protein encoded by VvbZIP, including grape VvHYH, which is related to light response, with bZIP protein sequences from other plants. A phylogenetic tree was then constructed using the neighbor-joining method, with the parameter Bootstrap=1000.

[0051] Gene sequence analysis revealed that, VvHYH The full-length cDNA of the gene is 561 bp (Sequence 1 in the sequence listing), encoding a protein VvHYH (Sequence 2 in the sequence listing) consisting of 186 amino acids. Its predicted molecular weight is 21.352 kDa, and its theoretical isoelectric point (pI) is 9.69, indicating that it may carry a positive charge under physiological conditions.

[0052] Sequence 1 (5'-3'): ATGTCTCTTCCCAATCCCACCCCCTCGGCTTCCAGGAGTTACGAGCAGGAGGGATCATCTTCTTCTTCGCCTTGGAGGAGGCACACTGCCGATTCCTTCCCTCCTCTCAATATTCATTCTGACAACAAGCACAAAGTAGAAGACAGCGATGAAGATTTGTTCAGAGTTCCCGACGTGGAAGCGCAGCCCCCTTCGGATTCAACGCGAACCACCACCACCACCACAACAACAAATACTAGTAATAATCCAGAGGTTCAACAACAAACTAGCAGCGGCAAGCGCCGGAGGGGACGCAATCCTGTGGATAGGGAGTATAGAAGACTCAAGAGACTGCTGAGAAACAGGGTTTCTGCCCAACAAGCTCGAGAAAGAAAGAAGGTGTATGTGAATGATCTGGAGTCAAGAGCCCAGGAGTTGCAGGACAGGAACTCAAAACTAGAAGAGAAAATCTCAACTCTTGTTAACGAAAACACCATGCTCCGGAAGGTCCTCATGAACACTAGGCCTAAGATGGATGACAGTAGTACTGAGTCAAAGCATGATCAGTTGGGCAAGAGCTGA。

[0053] Sequence 2: MSLPNPTPSASRSYEQEGSSSSSPWRRHTADSFPPLNIHSDNKHKVEDSDEDLFRVPDVEAQPPSDSTRTTTTTTTTNTSNNPEVQQQTSSGKRRRGRNPVDREYRRLKRLLRNRVSAQQARERKKVYVNDLESRAQELQDRNSKLEEKISTLVNENTMLRKVLMNTRPKMDDSSTESKHDQLGKS。

[0054] Multiple sequence alignment revealed that VvHYH shares high homology with HYH and HY5 transcription factors in other plants such as Arabidopsis thaliana, and is highly conserved at the bZIP domain location, suggesting a possible similar function in light signal transduction. To predict the function of VvHYH and other bZIP family members related to light response, the protein encoded by VvbZIP was compared with bZIP proteins from other plants. The results showed that VvHYH clustered with dicotyledons (such as Arabidopsis AtHYH and peach PpHYH), supporting its functional conservation; and was genetically distant from monocotyledons (such as maize ZmHYH and wheat TaHYH), consistent with evolutionary patterns. Furthermore, the HY5 and HYH subfamilies formed independent branches in different species, confirming their synergistic regulatory role in photomorphogenesis.

[0055] Predictions were made using the WoLF PSORT online tool. VvHYH Subcellular localization of genes. To determine the true location of a gene, subcellular localization is performed. VvHYH The coding sequence (Sequence 1) was fused with the N-terminus of GFP in the pSuper1300 vector to construct the VvHYH-GFP recombinant plasmid. To verify nuclear localization, the recombinant VvHYH-GFP plasmid was transformed with a nuclear marker plasmid (expressing mCherry, NLS-mCherry, which expresses the nuclear localization signal) using Agrobacterium-mediated transformation. The NLS-mCherry marker plasmid was donated by Professor Xu Yan of Northwest A&F University and is stored in our laboratory. It is available to the public from the applicant and is only used to replicate this invention and not for other purposes (related literature: Chen TT, Peng J, Yin X, Li MJ, Xiang GQ, Wang YJ, Lei Y, Xu Y. Importin-αs are required for the nuclear localization and function of the Plasmopara viticola effector PvAVH53. Horticulture research. 2021 8: 46). The plasmid was co-infiltrated with leaves of *Nicotiana benthamiana*. Co-infiltration with empty pSuper1300 and NLS-mCherry served as a control. After overnight dark culture, the cells were then cultured under light for 12 hours. Samples were taken after 3 days of immersion, and leaf epidermal sections were observed using an FV10-ASW confocal microscope. GFP (green) and mCherry (red) fluorescence signals were simultaneously detected, and superimposed images showed co-localization. Results showed that VvHYH was mainly localized in the cell nucleus. Confocal microscopy revealed that the green fluorescence of VvHYH-GFP and the red fluorescence of NLS-mCherry completely overlapped within the cell nucleus. Figure 2 These experimental results confirm that VvHYH is a nuclear localized protein.

[0056] 2. Yeast self-activation assay and dual-luciferase assay.

[0057] Will VvHYH The gene was ligated into the pGBKT7 vector (a gift from Professor Wang Yuejin of Northwest A&F University, preserved in our laboratory, and available to the public from the applicant; it is for the purpose of replicating this invention only and may not be used for other purposes. Related reference: Analysis of the interaction between transcription factors VqWRKY6 and VqbZIP1 in wild Chinese grape to regulate powdery mildew resistance. Chinese Agricultural Science. 202255(23): 4626-4639), and the correctly constructed plasmid was named VvHYH-pGBKT7. VvHYH-pGBKT7 was transformed into yeast competent cells Y2HGold and evenly spread on SD / -Trp solid medium. After culturing at 30°C for 3 days, single colonies were selected for PCR identification. The single colonies successfully transformed into yeast competent cells were diluted 10-fold and 100-fold, respectively, and spotted onto SD / -Trp and SD / -Trp-His-Ade solid medium, and cultured at 30°C for 3 days. Y2HGold was transformed with the empty vector pGBKT7 as a negative control; Y2HGold was transformed with the known self-activating plasmid pGBKT7-53 as a positive control. The growth of Y2HGold and the color of the strain were observed, recorded, and statistically analyzed.

[0058] The transient assay of dual-luciferase reporter assay was performed according to the method described by Ying et al. The CDS of VvHYH was fused with the GAL4 binding domain (GAL4-DBD) as the effector. An empty vector (pBD) was used as a negative control, while the pBD construct fused with the VP16 activation domain (pBD-VP16, donated by Professor Chen Jianye of South China Agricultural University, preserved in our laboratory, and available to the public from the applicant, is used only for replicating this invention and not for other purposes. Related reference: Isolation and characteristics of banana trihelix transcription factor MaGTL1a. Journal of Fruit Science. 2017 34(08): 935-945) was used as a positive control. LUC and REN were detected using a dual-luciferase reporter assay system (Promega, Madison, WI, USA) (Related method reference: Ying S, Su M, Wu Y, Zhou L, Fu R, Li Y, et al. Trichome regulator SlMIXTA‐like directly manipulates primary metabolism in tomato fruit. PlantBiotechnology Journal. 2020;18(2):354-63).

[0059] The results showed that yeast cells transformed with either VvHYH-pGBKT7 or the positive control (p53 plasmid) could grow normally on SD (-TH) medium lacking tryptophan and histidine synthesis definition. Figure 2 (B). However, yeast cells transformed with pGBKT7 (negative control) could grow in SD-tryptophan medium, but could not grow in SD-tryptophan-histidine medium. Figure 2 These results indicate that VvHYH possesses transcriptional activation activity. Further investigation using a dual-luciferase reporter gene assay system determined the transcriptional activation activity of VvHYH in tobacco. The results showed that the LUC / REN values ​​of the pBD-VvHYH effector vector and the positive control pBD-VP16 were significantly higher than those of the negative control pBD ( ). Figure 2 The presence of C indicates that VvHYH is a transcriptional activator. In conclusion, VvHYH plays a role in transcriptional activation in plant cells.

[0060] 3. Transient overexpression in grapes and stable overexpression in tobacco.

[0061] 3.1 Transient overexpression in grapes and verification by qRT-PCR.

[0062] 3.1.1 Construction of recombinant overexpression vector.

[0063] Having confirmed the transcriptional activity of VvHYH, this invention further clarifies its biological function. Due to the relatively long growth cycle of grapes, this invention validated the function of the VvHYH gene through transient transformation of grape leaves.

[0064] cDNA was generated by reverse transcription of total RNA from grape fruits and then cloned. VvHYH Gene. A fragment of this gene was cloned into the pSuper1300 vector to obtain the recombinant vector p1300- VvHYH The recombinant vector was used for transient overexpression analysis.

[0065] The gene cloning system (20µL) is: 2× 10.0 µL of adductor; 0.5 µL of forward primer; 0.5 µL of reverse primer; 1.0 µL of cDNA; 8.0 µL of ddH2O. The PCR primer sequences were 5'-ATGTCTCTTCCCAATCCCACCCCC-3' and 5'-TCAGCTCTTGCCCAACTGATCATG-3'. The PCR amplification program was as follows: 98 ℃ for 30 s; 98 ℃ for 10 s, 60 ℃ for 30 s, 72 ℃ for 30 s, for 35 cycles; 72 ℃ for 5 min; and stored at 4 ℃. Electrophoresis was performed to detect the PCR product, and the PCR product was then purified by gel extraction.

[0066] The purified PCR product and the pSuper1300 empty vector were digested with the restriction endonuclease SmaI, respectively. The digestion system (50 µL) consisted of: purified PCR product (or pSuper1300 empty vector), 44.0 µL; 10×NE Buffer, 5.0 µL; and Restriction Enzyme (SmaI), 1.0 µL. Digestion conditions: After centrifugation, all components were mixed and incubated at 37 °C for 2 hours. The digestion efficiency was assessed by electrophoresis, and the desired large fragment was recovered.

[0067] Target gene ligation with vector: The linearized pSuper1300 vector obtained after enzyme digestion and purification was added to a centrifuge tube at a 1:1 molar ratio with the target fragment (the large fragment after enzyme digestion of the purified PCR product) to carry out the recombination reaction, obtaining the recombinant vector p1300- VvHYH Recombinant vector p1300- VvHYH Containing the coding sequence of the gene shown in Sequence 2 of the sequence listing, it can express the VvHYH protein shown in Sequence 1 of the sequence listing. Homologous recombination reaction system (20 µL): linearized vector, 10.0 µL; target fragment, 5.0 µL; 5× reaction buffer, 4.0 µL; NovoRec® Plus recombinase, 1.0 µL. Reaction time: 50 °C for 10 min.

[0068] Take 5µL of the recombinant vector p1300- VvHYH Add 100 µL of EHA105 competent cells and quickly mix by tapping the bottom of the tube; incubate on ice for 5 min, in liquid nitrogen for 5 min, in a 37 ℃ water bath for 5 min, and on ice for 5 min; add 700 µL of YEP liquid medium and incubate at 28 ℃ with shaking for 2 h; centrifuge at 6000 rpm for 1 min and discard the supernatant (leaving approximately 100 µL); resuspend the bacterial cells and spread them on YEP solid plates containing rifampicin (RIF), and incubate upside down at 28 ℃ for 2–3 days; pick single colonies for colony PCR detection using primer F: 5'-ATGTCTCTTCCCAATCCCACC-3'; primer R: 5'-TCAGCTCTTGCCCAACTGATC-3', yielding positive recombinant Agrobacterium EHA105 / p1300- VvHYH Bacterial suspension; simultaneously, the empty vector pSuper1300 was transformed into EHA105 competent cells using the same method to obtain recombinant Agrobacterium EHA105 / pSuper1300 bacterial suspension.

[0069] 3.1.2 Detection of transient overexpression in grape fruits.

[0070] EHA105 / pSuper1300 was set as the control group, and recombinant Agrobacterium EHA105 / p1300- VvHYH The bacterial suspension served as the experimental group. Agrobacterium suspensions from both the experimental and control groups were instantaneously transferred into the grape berries. The Agrobacterium suspensions were incubated for 6–7 hours until OD (Octopic Surface Energy) was reached. 600nm The OD value was set at 1.0–1.2. After centrifugation, the bacterial cell OD was adjusted using infection buffer (preparation method: MES 2.132 g / L, MgCl2 6H2O 2.033 g / L, sucrose 5 g / L, acetylsylgenone final concentration 200 mg / L, the remainder being water, pH 5.9). 600nm The bacterial culture was collected at 0.4 and allowed to stand for 3 hours to obtain the infecting solution. Three biological replicates were set up for each group, using approximately 10 pre-ripe "Ruidu Xiangyu" grapes without mechanical damage and with intact stems. Before use, the grape surface was washed with clean water, 75% alcohol, sterile water, and 20% sodium hypochlorite, and finally washed 5 times with sterile water. Using a 1 mL syringe, 10-15 holes were evenly punched on the grape surface to promote the inoculation of recombinant Agrobacterium EHA105 / p1300 in the experimental group. VvHYH Infiltration of either bacterial suspension or the control group EHA105 / pSuper1300 bacterial suspension. After inoculation, the grapes were removed, and any residual bacterial suspension was wiped off. The inoculated grapes were placed on damp gauze, covered with plastic wrap to keep them moist, and several holes were poked in the plastic wrap for ventilation. The samples were placed in a 20℃ oven and removed after three days. They were then flash-frozen in liquid nitrogen and placed in a -80℃ freezer for aroma determination.

[0071] The results showed that, compared with the control group ( Figure 3 Compared to (the WT representative), the transfer to VvHYH Gene overexpression vectors ( Figure 3 (Represented by VvHYH) promotes the growth of various compounds in grapes, including limonene, trans-β-ocimene, γ-terpinene (CAS No.: 99-85-4), cis-β-ocimene, terpinolene (CAS No.: 586-62-9), allocimene (CAS No.: 3016-19-1), and cis-furan-type linalool oxide. The content of monoterpenes, including trans-furan-type linalool (CAS No.: 34995-77-2), nerol (CAS No.: 1786-08-9), linalool (CAS No.: 78-70-6), dehydrolinalool (CAS No.: 20053-88-7), α-terpineol (CAS No.: 10482-56-1), nerol (CAS No.: cis-3,7-Dimethyl-2,6-octadieno (CAS No.: 106-25-2), and geraniol (CAS No.: 106-24-1), was significantly increased.

[0072] 3.1.3 Transient overexpression detection in grape leaves.

[0073] Fresh grape leaves with uniform development were selected and treated with recombinant Agrobacterium EHA105 / p1300- VvHYH The bacterial suspension was used for infection, with each sample infecting 6 leaves to form 6 technical replicates. The same number of leaves were infected with the control EHA105 / pSuper1300 bacterial suspension as a blank control. The specific infection steps were as follows: Culture the bacterial solution for 6–7 hours until OD 600nm The OD value was 1.0–1.2. The bacterial OD was adjusted using an infection buffer (MES 2.132 g / L, MgCl2·6H2O 2.033 g / L, sucrose 5 g / L, acetylsylcholine final concentration 200 mg / L, the remainder being sterile water, pH 5.9). 600nm The solution was adjusted to 0.4 and allowed to stand for 3 hours. Grape leaves were then infiltrated with bacterial solution in a vacuum desiccator. After infection, the leaves were cultured in the dark for 3 days. The leaves were then flash-frozen with liquid nitrogen and stored at -80°C.

[0074] The experimental results showed that, compared with the color of uninfected leaves, the color of infected leaves was significantly darker. Figure 4 (A). qRT-PCR analysis showed that, compared with the control group transformed with EHA105 / pSuper1300 bacterial culture ( Figure 4 Compared to WT (represented by B), VvHYH showed better performance in transforming recombinant Agrobacterium EHA105 / p1300- VvHYH The expression level in the overexpression group of bacterial culture leaves was significantly upregulated. Figure 4 (B). This invention also determined the expression levels of genes related to monoterpene biosynthesis. The results showed that, compared with the control group, the expression levels of genes transformed with recombinant Agrobacterium EHA105 / p1300- VvHYH VvHYH overexpression group of bacterial culture ( Figure 4 The VvHYH gene (represented by B) promotes the expression of monoterpene skeletal genes VvDXS1, VvDXS4, and VvDXR, as well as monoterpene synthase genes VvTPS31, VvTPS32, and VvTPS35 in grape leaves. Figure 4 (B). The primers and gene IDs used (referencing the 2017 grape genome V2 version) are shown in Table 1 below: Table 1. Detection gene IDs and related qRT-PCR detection primers.

[0075]

[0076] 3.2 Stable overexpression in tobacco.

[0077] To perform stable overexpression detection, this invention separately introduced recombinant Agrobacterium EHA105 / p1300- VvHYH Transformation of bacterial culture and control EHA105 / pSuper1300 bacterial culture into tobacco ( Nicotiana tabacum Transformation was performed on the plant using the leaf disc transformation method. Specifically, sterile leaf pieces were co-cultured with Agrobacterium tumefaciens solution for 24 hours, followed by transfer to MS medium containing kanamycin (100 mg / L) for growth. On this medium, untransformed cells were killed by antibiotics, while transformed cells grew into complete plants, ultimately yielding transgenic lines stably overexpressing VvHYH (VvHYH-1, VvHYH-2, and VvHYH-3).

[0078] The expression of the monoterpene backbone gene VvDXS4 and the monoterpene synthase genes VvTPS32 and VvTPS35 was detected using the same qRT-PCR primers as in step 3.2. qRT-PCR verification results showed that, compared with tobacco plants transformed with the control EHA105 / pSuper1300 bacterial culture ( Figure 4 Compared to the WT representative, the VvHYH overexpression line ( Figure 4Stable overexpression of VvHYH-1, VvHYH-2, and VvHYH-3 (represented by D) in tobacco plants promoted the expression of NtDXS4, NtTPS32, and NtTPS35 in tobacco. Figure 4 (D).

[0079] 3.3 Detection of monoterpenoid content.

[0080] In the above-mentioned grape leaves undergoing transient transformation and tobacco plants undergoing stable transformation, the expression levels of genes related to monoterpene synthesis were obtained by qRT-PCR, and the content of monoterpenes was detected by HS-SPME-GC-MS.

[0081] Quantitative results of transient transformation experiments on grape leaves showed that overexpression of VvHYH promoted an increase in the content of monoterpenes, including nerol, linalool, and nerol. Figure 4 (C). This result indicates that the expression of VvHYH and monoterpene synthesis-related genes is associated with monoterpene accumulation, suggesting that VvHYH positively regulates the accumulation of monoterpenes in grapes.

[0082] The peak diagram of volatile monoterpenes in stably transformed tobacco plants shows that the tobacco overexpression lines stably overexpressing VvHYH ( Figure 4 The content of limonene and linalool monoterpenes in plants representing VvHYH-1, VvHYH-2, and VvHYH-3 of the Chinese tobacco variety E was significantly higher than that in tobacco plants that did not overexpress VvHYH. Figure 4 (E). This result indicates that VvHYH can promote the increase of monoterpenoid content in tobacco by upregulating the expression of genes in the monoterpene synthesis pathway (NtDXS4, NtTPS32, and NtTPS35). These results are consistent with the aroma assays of 'Ruidu Xiangyu' grape berries and 'Mao grape' leaves obtained by VvHYH transient transfection.

[0083] In summary, VvHYH may promote the accumulation of monoterpenes in grapes by regulating the expression of genes related to monoterpene synthesis.

[0084] 4. Firefly luciferase complementation imaging assay.

[0085] To investigate whether VvHYH can activate the expression of the VvDXS4 promoter, transient expression was measured in tobacco using a firefly luciferase system.

[0086] Detection using a firefly luciferase complementation imaging system VvHYH Interaction with the promoter of monoterpene synthesis genes. The promoter located at [specific location] was amplified from the genomic DNA of the 'Muscat' grape using specific primers. VvDXS4 , VvTPS32 and VvTPS35Approximately 2000 bp of promoter fragment upstream of the translation start site (ATG). VvHYH The coding sequence (Sequence 1) was cloned into the pGreenII 62-SK vector (effecton). VvDXS4 Promoter segment (sequence 3 in the sequence list) VvTPS32 Promoter segment (sequence 4 in the sequence list) VvTPS35 The promoter fragment (sequence 5 in the sequence listing) was constructed into the pGreenII 0800-LUC vector (reporter), and transient expression analysis was performed by co-infiltration of tobacco leaves with Agrobacterium GV3101. The specific method is as follows: Gallois P, Marinho P. Leaf disk transformation using Agrobacterium tumefaciens-expression of heterologous genes in tobacco. Methods Mol Biol. 1995;49:39-48. doi: 10.1385 / 0-89603-321-X:39.

[0087] The results showed that, compared with the negative control, the co-expression of 62SK-VvHYH and proVvDXS4:LUC exhibited stronger luminescence intensity and a higher LUC / REN ratio. Figure 5 (D and E). In summary, VvHYH may promote the accumulation of monoterpenes by regulating the expression of the monoterpene backbone gene VvDXS4.

[0088] 5. Yeast one-hybrid experiment.

[0089] Based on the previously mentioned finding that the transcriptional level of the monoterpene backbone gene VvDXS4 was significantly increased in grapes and tobacco overexpressing VvHYH, it was hypothesized that VvHYH directly regulates the transcription of VvDXS4. Subsequently, this invention conducted a yeast one-hybrid assay to determine whether VvHYH binds to the promoter of the VvDXS4 gene.

[0090] Using 'Muscat' grape genomic DNA as a template, specific primers were designed using Bioxm software to amplify the amplified samples. VvDXS4 , VvTPS32 and VvTPS35 Promoter fragments of genes.

[0091] pJG-VvHYH: Forward sequence (5'-3'): 5'-gattatgcctctcccgaattcATGTCTCTTCCCAATCCCACC-3'; Reverse sequence (5'-3'): 5'-agaagtccaaagcttctcgagTCAGCTCTTGCCCAACTGATC-3'; pLACZ-VvTPS32: Forward sequence (5'-3'): 5'-gaattcgagctcggtaccATTCAAACCCCTCCCCTCAT-3'; Reverse sequence (5'-3'): 5'-atacagagcacatgcctcgagATCCGACATCCGACTACGCG-3'; pLACZ-VvTPS35: Forward sequence (5'-3'): 5'-gaattcgagctcggtaccGTAACCCAGTAGGTAAGGAC-3'; Reverse sequence (5'-3'): 5'-atacagagcacatgcctcgagCAAGGATTTTGGCTCGTTGG-3'; pLACZ-VvDXS4: Forward sequence (5'-3'): 5'-gaattcgagctcggtaccTCAATCGGCCTAACCAAAGG-3'; Reverse sequence (5'-3'): 5'-atacagagcacatgcctcgagAGCTGTCAACTCCTCAACGT-3'; Will VvHYH The CDS was cloned into the pJG vector (this vector was donated by Professor Ma Nan of China Agricultural University, is preserved in our laboratory, and is available to the public from the applicant; it is only for replicating this invention and cannot be used for other purposes. Related literature: Cheng C, YuQ, Wang Y, Wang H, Dong Y, Ji Y, Zhou X, Li Y, Jiang CZ, Gan SS, Zhao L, FeiZ, Gao J, Ma N. Ethylene-regulated asymmetric growth of the petal basepromotes flower opening in rose (Rosa hybrida). Plant Cell. 2021 May 31;33(4):1229-1251. doi: 10.1093 / plcell / koab031). VvDXS4 , VvTPS32 and VvTPS35The promoter fragment was cloned into the pLacZ vector (this vector was donated by Professor Ma Nan of China Agricultural University, is preserved in our laboratory, and is available to the public from the applicant; it is only for replicating this invention and cannot be used for other purposes. Related literature: Cheng C, Yu Q, Wang Y, Wang H, Dong Y, Ji Y, Zhou X, Li Y, Jiang CZ, Gan SS, Zhao L, Fei Z, Gao J, Ma N. Ethylene-regulated asymmetric growth of the petal base promotes flower opening in rose (Rosa hybrida). Plant Cell. 2021 May 31;33(4):1229-1251. doi: 10.1093 / plcell / koab031), and the pLacZ-promoter vector constructed above was linearized and integrated into the Y1H-Gold yeast genome using chemical transformation. pJG-VvHYH or empty pJG vector (negative control) was transformed into bait strains. Single colonies were picked and spread on SD / -Trp-Ura and SD / -Trp-Ura X-gal solid media, and colony growth and strain color were observed. If blue colonies appeared in the pJG-VvHYH + pLacZi- promoter group, while the empty pJG + pLacZi- promoter group was colorless, it indicates that VvHYH specifically binds to this promoter.

[0092] The Y1H results show that VvHYH can indeed bind to the promoter of VvDXS4. Figure 5 (B)

[0093] 6. Electrophoretic migration assay.

[0094] Subsequently, an electrophoretic mobility assay (EMSA) was performed using a 30 bp fragment (nucleotides 1869-1898 of sequence 3) of the VvDXS4 promoter (sequence 3) containing the G-box core binding element as a probe. Figure 5 (A)

[0095] Following the manufacturer's instructions, a fusion protein of VvHYH-His and a biotin-labeled structural gene probe was prepared using a chemiluminescent EMSA kit (Thermo Scientific, Waltham, MA, USA) (Sangon Biotech, Shanghai, China) for electrophoretic migration assay (EMSA). An unlabeled probe was used as a competitor. Free and bound probes were separated using a 6% non-denaturing polyacrylamide gel (Sangon Biotech, Shanghai, China) and transferred to a nylon membrane (GE Healthcare, Danderyd, Sweden).

[0096] Figure 5 The results from the study showed a strong binding band between the recombinant VvHYH protein and the VvDXS4-DNA complex, indicating the formation of a DNA-protein complex. Adding an excess of unlabeled competing probes with the same sequence inhibited the formation of these complexes. Notably, no DNA-protein complex was observed between VvHYH and the mutant-labeled probe. Figure 5 (C) confirmed that VvHYH specifically binds to the G-box motif of the VvDXS4 promoter in vitro.

[0097] 7. VvHYH binds directly to the promoters of VvTPS32 and VvTPS35, promoting their expression.

[0098] This invention discovered that overexpression of VvHYH also activates the transcription of the monoterpene synthase genes VvTPS32 and VvTPS35. Yeast one-hybrid (Y1H) experiments further verified that VvHYH can bind to the promoters of the VvTPS32 and VvTPS35 genes, respectively. Figure 6 (B and G). To further verify whether VvHYH can bind to the G-box motif in the VvTPS32 and VvTPS35 promoters, an EMSA experiment was conducted. Figure 6 (A and F). As expected, VvHYH exhibited the ability to bind to VvTPS32 and VvTPS35 promoter segments containing G-box motifs (A and F). Figure 6 (C and H). Adding excessive amounts of unlabeled competing probes significantly reduced the binding affinity of VvHYH to biotin-labeled probes, while this binding was completely eliminated when the G-box element was mutated. Figure 6 (C and H). To further verify the effect of VvHYH on its target genes, a firefly luciferase complementation imaging experiment was conducted, which revealed that VvHYH promoted the promoter activity of VvTPS32 and VvTPS35 (C and H). Figure 6(D, E, I, and J). The above results collectively indicate that VvHYH activates the transcription of VvTPS32 and VvTPS35 by binding to the G-box in the promoter, thereby leading to an increase in monoterpene content.

[0099] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Any of the following applications of proteins: P1. Application of overexpression of the gene encoding the protein in increasing the monoterpene content of grape fruit; P2. Application of overexpression of the gene encoding the protein in promoting the expression of monoterpene backbone genes and / or monoterpene synthase genes in grape fruit; P3. Application of the gene encoding the protein overexpression in grape breeding, wherein the purpose of the breeding is to increase the monoterpene content of grape fruit; The protein in question has an amino acid sequence that is sequence 2 in the sequence listing. The monoterpenes are limonene, β-trans-ocimene, γ-terpinene, β-cis-ocimene, isoterpinene, alloterpinene, cis-furan-type linalool, trans-furan-type linalool, nerol, linalool, dehydrolinalool, α-terpineol, nerol, or / and geraniol. The monoterpene backbone genes are VvDXS1, VvDXS4, or / and VvDXR; The monoterpene synthase gene is VvTPS31, VvTPS32, or / and VvTPS35.

2. Any of the following applications of biomaterials related to the protein of claim 1: Q1. Application of the aforementioned biomaterial in increasing the monoterpene content of grape fruit; Q2. Application of the biomaterial in promoting the expression of monoterpene backbone genes and / or monoterpene synthase genes in grape fruit; Q3. The application of the biological material in grape breeding, wherein the purpose of the breeding is to increase the monoterpene content of grape fruit; The monoterpenes are limonene, β-trans-ocimene, γ-terpinene, β-cis-ocimene, isoterpinene, alloterpinene, cis-furan-type linalool, trans-furan-type linalool, nerol, linalool, dehydrolinalool, α-terpineol, nerol, or / and geraniol. The monoterpene backbone genes are VvDXS1, VvDXS4 and / or VvDXR; The monoterpene synthase genes are VvTPS31, VvTPS32 and / or VvTPS35; The biomaterial is any one of the following: B1) An expression cassette containing a nucleic acid molecule encoding the protein of claim 1; B2) A recombinant vector containing a nucleic acid molecule encoding the protein of claim 1, or a recombinant vector containing the expression cassette of B1); B3) A recombinant microorganism containing a nucleic acid molecule encoding the protein of claim 1, or a recombinant microorganism containing the expression cassette of B1), or a recombinant microorganism containing the recombinant vector of B2); B4) A transgenic plant cell line containing a nucleic acid molecule encoding the protein of claim 1, or a transgenic plant cell line containing the expression cassette of B1); B5) Transgenic plant tissue containing a nucleic acid molecule encoding the protein of claim 1, or transgenic plant tissue containing the expression cassette of B1); B6) A transgenic plant organ containing a nucleic acid molecule encoding the protein of claim 1, or a transgenic plant organ containing the expression cassette of B1).

3. The application according to claim 2, characterized in that: The nucleic acid molecule is a DNA molecule whose coding sequence is sequence 1 in the sequence listing.

4. A method for increasing the monoterpene content of grape berries, comprising enhancing or increasing the activity of the protein of claim 1 in grapes and / or the expression level of the gene encoding the protein of claim 1, thereby increasing the monoterpene content of grape berries; The monoterpenes are limonene, β-trans-ocimene, γ-terpinene, β-cis-ocimene, isoterpinene, alloterpinene, cis-furan-type linalool, trans-furan-type linalool, nerol, linalool, dehydrolinalool, α-terpineol, nerol, or / and geraniol.

5. The method according to claim 4, characterized in that: The enhancement or increase of the activity of the protein of claim 1 in grapes and / or the expression level of the gene encoding the protein of claim 1 is achieved by introducing the gene encoding the protein of claim 1 into grapes.

Images