Using the EXOC4 gene as a molecular marker for superovulation in bovine animals and its application methods
By cloning the bovine EXOC4 gene and detecting its SNP polymorphism at position 176, the problem of superovulation effect being affected by individual genetic differences was solved, providing a molecular marker for bovine superovulation traits and improving the ability to predict and genetically improve superovulation effects.
Patent Information
- Application Number
- CN202610150216.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-03
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2046-02-03
Smart Images

Figure CN121653266B_ABST
Abstract
Description
Technical Field
[0001] This invention discloses a method for using the EXOC4 gene as a molecular marker for superovulation in cattle and its application, specifically involving the cloning of the bovine EXOC4 gene fragment and its application in marker-assisted selection in cattle, belonging to the field of animal genetic engineering technology. Background Technology
[0002] Superovulation combined with artificial insemination can generate a large number of high-quality embryos in a short period of time, enabling the rapid and efficient discovery and dissemination of superior genes in livestock breeds, thereby maximizing the utilization of outstanding individuals. Simultaneously, combining it with embryo transfer technology can effectively improve the breeding speed of single-birth livestock with long reproductive cycles and low fertility, which is of great significance. However, the effectiveness of superovulation is constrained by many factors, the most fundamental of which is the difference in individual genetic makeup.
[0003] The total number of embryos obtained from superovulation and the number of usable embryos can be used to directly evaluate the effectiveness of superovulation. Studies have found that an individual's genetic basis, namely gene polymorphisms, has a significant impact on the effectiveness of superovulation. Among gene polymorphisms, single nucleotide polymorphisms (SNPs) are widely used in livestock and poultry reproduction and related scientific research due to their important role (Yu et al., 2012; Ortega et al., 2016; Hardyta et al., 2020). Existing research has found that SNPs can affect various animal reproductive traits, including superovulation (Yang et al., 2012; Hirayama et al., 2019).
[0004] Studies have found a close association between the EXOC4 gene SNP and the number of live piglets born, litter weight at birth, and litter weight at weaning in pigs (He et al., 2021). Furthermore, other studies have found that EXOC4 is associated with lactation, meat quality, and growth traits in Duroc pigs (He et al., 2020), and that EXOC4 gene knockout mice die shortly after embryonic development (Tanaka et al., 2016). These studies indicate that the EXOC4 gene plays a crucial role in animal reproduction, but its specific impact on superovulation remains unclear. Summary of the Invention
[0005] This invention discloses a molecular marker for the superovulation trait in cattle using the EXOC4 gene and its application method. The purpose is to clone the EXOC4 gene fragment in cattle and identify its specific mutation sites as a method for detecting polymorphisms in genes related to superovulation performance in cattle, thus providing a meaningful molecular marker for marker-assisted breeding in cattle.
[0006] The present invention describes a 645bp sequence of EXOC4, a gene related to superovulation performance in cattle, obtained by specific primers and PCR, as shown in SEQ ID NO: 1.
[0007] The obtained EXOC4 gene fragment has a base mutation of ct at position 176 as described in SEQ ID NO: 1, resulting in a single nucleotide polymorphism (SNP).
[0008] The present invention describes a method for screening molecular markers suitable for bovine superovulation, prepared according to the following steps: A pair of specific primers is designed:
[0009] Forward primer EXOC4-fwd (SEQ ID NO: 2): gaagccaggaaagggtaggt;
[0010] Reverse primer EXOC4-rev (SEQ ID NO: 3): gagcagagctgtgcgtttgag.
[0011] Genomic DNA was extracted from bovine blood and amplified by PCR. A SNP polymorphism was generated due to a ct base mutation at position 176 of the PCR product DNA sequence, which was used to determine the specific genotype. Association analysis between the different genotypes revealed by the detection results and the bovine superovulation trait showed that individuals with specific genotypes achieved better superovulation.
[0012] The present invention will now be described in detail:
[0013] I. Cloning of the bovine EXOC4 gene fragment
[0014] A pair of specific primers was designed using the biological software Oligo 6.0. The PCR reaction conditions were established as follows:
[0015] Forward primer EXOC4-fwd (SEQ ID NO: 2): gaagccaggaaagggtaggt;
[0016] Reverse primer EXOC4-rev (SEQ ID NO: 3): gagcagagctgtgcgtttgag;
[0017] To obtain good results quickly, this invention uses MonAmp™ ChemoHS qPCR premix from MonAmp Biotechnology Co., Ltd. for PCR amplification. The specific reaction system is as follows: 10.0 μl of 2×MonAmp™ ChemoHS qPCR Mix (provided in the product packaging), 0.5 μl each of forward and reverse primers (both at a concentration of 10 pmol / μl), 0.5 μl of genomic DNA (containing 10-50 ng DNA), and 8.5 μl of distilled water. The PCR reaction conditions are: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 10 minutes.
[0018] II. PCR Product Sequencing and Genotype Determination
[0019] A 645 bp specific amplified fragment was obtained by amplifying bovine genomic DNA using primers EXOC4-fwd and EXOC4-rev. Sequencing results revealed that a mutation in the ct genotype at position 176 of this 645 bp resulted in different genotypes: CC, CT, and TT. Specifically, CC-type individuals were homozygous for c at position 176; CT-type individuals were c / t heterozygous; and TT-type individuals were homozygous for t at position 176.
[0020] III. Marker-based trait association analysis
[0021] Using the experimental population as the experimental subjects, trait association analysis was conducted. The One-Way ANOVA procedure in SPSS 22.0 software was used to establish the following model for trait association analysis:
[0022] The statistical analysis model is: Y ij =μ+G i +e j;
[0023] Among them, Y ij G represents the phenotypic value of the observed individual's productive performance; μ represents the least squares mean of productive performance; G i e represents the effect of genotype on production performance. j This represents the random residuals corresponding to the observed values.
[0024] The positive effects of this invention are as follows:
[0025] By conducting an association analysis between EXOC4 gene polymorphism and bovine superovulation, the single nucleotide polymorphism at a specific site in the EXOC4 gene and its accurate identification method were clarified. The influence of this genetic polymorphism on bovine superovulation was also determined, providing an important theoretical basis and application prospect for its use as a molecular marker for auxiliary selection of bovine reproductive performance and its application in genetic improvement in actual production. Attached Figure Description
[0026] Figure 1 The results of 1.5% agarose gel electrophoresis of the EXOC4 gene amplification product in Example 1 (where lane M is the standard molecular weight marker, and lanes 1-6 are 6 randomly detected PCR products, with a clear and specific band at the 645bp position).
[0027] Figure 2 This is a sequencing peak diagram of the PCR products of the three genotypes in Example 1 (the position indicated by the arrow is the mutation site; for CC genotype individuals, this site is a c base; for CT genotype individuals, this site is a c / t base; for TT genotype individuals, this site is a t base).
[0028] Figure 3 The results of 1.5% agarose gel electrophoresis of the EXOC4 gene amplification products in Example 2 are shown (lane M is the standard molecular weight marker, lanes 1-7 are 7 randomly detected PCR products, with a clear and specific band at the 645bp position).
[0029] Figure 4 This is a sequencing peak diagram of the PCR products of the three genotype individuals in Example 2 (the position indicated by the arrow is the mutation site; for CC type individuals, this site is a c base; for CT type individuals, this site is a c / t base; for TT type individuals, this site is a t base). Detailed Implementation
[0030] The present invention is further illustrated by the following embodiments, which are not intended to limit the invention in any way. Any modifications or alterations made to the present invention that are easily implemented by those skilled in the art without departing from the technical solutions of the present invention shall fall within the scope of the claims of the present invention.
[0031] Example 1
[0032] Using extracted bovine genomic DNA (collected by ourselves in Changchun, Jilin Province, China) as a template, a pair of specific primers were designed to clone a partial DNA sequence of the bovine EXOC4 gene. Sequencing and genotyping were performed, and the association between different genotypes and superovulation traits was analyzed to provide molecular markers for marker-assisted selection in cattle.
[0033] I. Cloning of a partial DNA fragment of the bovine EXOC4 gene
[0034] To ensure good primer quality, the primers in this invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the primer sequences are shown in the description:
[0035] Forward primer EXOC4-fwd (SEQ ID NO: 2): gaagccaggaaagggtaggt;
[0036] Reverse primer EXOC4-rev (SEQ ID NO: 3): gagcagagctgtgcgtttgag;
[0037] The Taq enzyme, buffer, magnesium ions, dNTPs, etc. required in the PCR reaction can be selected by the user. To obtain good results quickly, this invention uses the 2× chemical dye quantitative PCR premix from MonAmp™ ChemoHS qPCR Mix for PCR amplification. The specific reaction system is as follows: 10.0 μl of 2×MonAmp™ ChemoHS qPCR Mix (provided in the product packaging), 0.5 μl each of forward and reverse primers (concentration of 10 pmol / μl), 0.5 μl of genomic DNA (containing 10-50 ng DNA), and 8.5 μl of distilled water. The PCR reaction conditions are: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 10 minutes.
[0038] II. PCR Product Sequencing and Genotype Determination
[0039] A 645 bp specific amplified fragment was obtained by amplifying bovine genomic DNA using primers EXOC4-fwd (SEQ ID NO: 2) and EXOC4-rev (SEQ ID NO: 3). Figure 1 And SEQ ID NO: 1). Sequencing results revealed that in this 645bp fragment, a mutation in ct at position 176 resulted in different genotypes: CC, CT, and TT. Specifically, CC individuals were homozygous for c at position 176; CT individuals were c / t heterozygous at position 176; and TT individuals were homozygous for t at position 176. Figure 2 );
[0040] III. Marker-based trait association analysis
[0041] Using the experimental population as the experimental subjects, trait association analysis was conducted. The One-Way ANOVA procedure in SPSS 22.0 software was used to establish the following model for trait association analysis:
[0042] The statistical analysis model is: Y ij =μ+G i +e j;
[0043] Among them, Y ijG represents the phenotypic value of the observed individual's productive performance; μ represents the least squares mean of productive performance; G i e represents the effect of genotype on production performance. j These are the random residuals corresponding to the observed values;
[0044] IV. Cloning of partial DNA sequence of bovine EXOC4 gene and determination of different genotypes
[0045] The PCR amplification products were detected by 1.5% agarose gel electrophoresis and were shown to be specific PCR products, such as... Figure 1 As shown in the image. The PCR product was recovered and sequenced, revealing a product length of 645 bp. Sequencing results showed a ct base mutation at 176 bp in this fragment, with some sequencing peaks as shown in the image. Figure 2 As shown;
[0046] V. Conduct association analysis on marker traits
[0047] Association analysis of the 176th polymorphic site of the amplified EXOC4 gene in bovine individuals with the superovulation trait showed that, among 149 randomly selected individuals, 88 were CC genotype, 33 were CT genotype, and 28 were TT genotype. The results of the significant differences (mean ± standard error) between the average number of usable embryos per head and the average number of total embryos per head among individuals with different genotypes are shown in Table 1.
[0048] Table 1. Results of analysis of significant differences in superovulation traits among individuals with different genotypes
[0049]
[0050] Note: Data from different groups are indicated by different letters (a, b, c) to show significant differences (P<0.05). Average number of usable embryos per head = total number of usable embryos obtained from multiple superovulation treatments / number of superovulation treatments; Average total number of embryos per head = total number of embryos obtained from multiple superovulation treatments / number of superovulation treatments.
[0051] The analysis results show that there are significant differences in superovulation traits among individuals corresponding to different genotypes at this SNP locus. Overall, CC-type individuals have better superovulation outcomes than CT or TT-type individuals. When selecting superovulation donors, CC-type individuals should be given priority, while TT-type individuals should be avoided as much as possible.
[0052] This invention provides an important theoretical basis for using this locus as a molecular marker for auxiliary selection of bovine reproductive and production performance and for application in genetic improvement, and has good application prospects.
[0053] Example 2
[0054] Ninety individuals were randomly selected from the superovulation herd of cows at Hebei Tianhe Beef Cattle Breeding Co., Ltd. Blood samples were collected for genomic DNA extraction, and PCR amplification was performed using primers, a PCR reaction system, and conditions designed in this invention. PCR amplification was performed using 2× ChemoHS qPCR premix from MonAmp Biotechnology Co., Ltd. The specific reaction system consisted of: 10.0 μl of 2×MonAmp™ ChemoHS qPCR Mix (provided in the product packaging), 0.5 μl each of primers EXOC4-fwd (SEQ ID NO: 2) and EXOC4-rev (SEQ ID NO: 3) (both at a concentration of 10 pmol / μl), 0.5 μl of genomic DNA (containing 10-50 ng DNA), and 8.5 μl of distilled water. The PCR reaction conditions were: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 10 minutes.
[0055] The amplification products were detected by 1.5% agarose gel electrophoresis, and the results showed that they were specific PCR products. Figure 3 As shown, lane M represents the standard molecular weight marker, and lanes 1-7 contain the PCR products being tested. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. In this 645bp fragment, a mutation in ct at position 176 resulted in different genotypes: CC, CT, and TT. Specifically, CC individuals were homozygous for c at position 176; CT individuals were c / t heterozygous for position 176; and TT individuals were homozygous for t at position 176. Figure 4 Of all the individuals examined, 52 were of the CC type; 15 were of the CT type; and 23 were of the TT type.
[0056] Based on the superovulation records of these 90 individuals, correlation analysis was performed using SPSS 22.0 software and a One-Way ANOVA procedure. ij =μ+G i +e j;
[0057] Among them, Y ij G represents the phenotypic value of the observed individual's productive performance; μ represents the least squares mean of productive performance; G i e represents the effect of genotype on production performance. j This represents the random residuals corresponding to the observed values.
[0058] The association analysis results (mean ± standard error) between different genotypes and the superovulation trait of these 90 individuals and the number of usable embryos per head and the total number of embryos per head are shown in Table 2:
[0059] Table 2. Results of analysis on significant differences in superovulation traits among individuals with different genotypes
[0060]
[0061] Note: Data from different groups with different letters (a, b, c) on the shoulder indicate significant differences (P<0.05).
[0062] The analysis results show that individuals with different genotypes at this locus have significant differences in superovulation traits, with CC genotype individuals exhibiting better superovulation traits than CT and TT genotypes.
Claims
1. The use of primers for detecting molecular markers associated with bovine superovulation traits in the preparation of formulations for detecting bovine superovulation traits, characterized in that: The sequence of the molecular marker is shown in SEQ ID NO: 1, which has a ct base mutation at position 176, resulting in differences in superovulation traits.
2. The use according to claim 1, characterized in that the primer sequence is: The forward primer is shown in SEQ ID NO: 2; The reverse primer is shown in SEQ ID NO:
3.
3. The application of the molecular marker as described in claim 1 in the selection-assisted selection of superovulation traits in bovine animals, characterized in that... Includes the following steps: Genomic DNA was extracted from bovine blood using the forward and reverse primers described in claim 2 and amplified by PCR. A single nucleotide polymorphism (SNP) was generated at position 176 of the DNA sequence of the PCR product fragment due to a ct base mutation. The specific genotype could be identified by sequencing. The association analysis between the different genotypes shown in the test results and the superovulation trait in cattle showed that the superovulation effect of CC-type individuals was better than that of CT-type or TT-type individuals.