Dual-fluorescence reporter gene animal model for tracking transdifferentiation from airway cilia cells to mucous cells as well as construction and application of dual-fluorescence reporter gene animal model
By constructing a dual-fluorescent reporter gene animal model and utilizing the Cre-LoxP system and dual promoters, we achieved highly specific and high-resolution tracking of the transdifferentiation of airway ciliated cells into mucinous cells, solving the problem of lack of direct evidence in existing technologies and providing an important tool for the research and treatment of mucus hypersecretion diseases.
Patent Information
- Application Number
- CN202511623225.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-07
- Publication Date
- 2026-03-17
AI Technical Summary
Existing technologies make it difficult to directly and dynamically track the transdifferentiation process of airway ciliated cells into mucous cells, and there is a lack of clear evidence to support research on this cell origin.
A dual-fluorescent reporter gene animal model was constructed. Using the Cre-LoxP gene recombinase system and dual promoters, ciliated cells were specifically labeled and their transdifferentiation into mucin cells was tracked. Irreversible genetic evidence was provided by changes in the expression of green fluorescent protein and red fluorescent protein.
It enables highly specific and high-resolution tracking of the transdifferentiation of ciliated cells into mucinous cells, providing clear genetic evidence and is suitable for in vitro and in vivo studies and drug screening, becoming an important tool for the research and treatment of mucus hypersecretion diseases.
Smart Images

Figure CN121667167A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of medical biotechnology and relates to the construction of animal models, specifically to a method for constructing a dual-fluorescent reporter gene animal model for tracking the transdifferentiation of airway ciliated cells into mucous cells and its related applications. Background Technology
[0002] Hypersecretion of airway mucus is a core pathological feature of many chronic respiratory diseases. Traditionally, mucus cells were thought to originate from the metaplasia of basal cells. However, increasing evidence in recent years suggests that terminally differentiated ciliated cells can also undergo transdifferentiation, directly transforming into a subpopulation of mucus-secreting cells. Current technologies struggle to provide direct evidence of cell origin. Therefore, there is an urgent need in the field for an innovative tool that can clearly, intuitively, and dynamically track the fate of ciliated cells. Summary of the Invention
[0003] This invention addresses the aforementioned problems and, given the current lack of animal models for the transdifferentiation of airway ciliated cells into mucous cells, provides a method for constructing and applying a dual-fluorescent reporter gene animal model for tracking this transdifferentiation. Utilizing the Cre-LoxP gene recombinase system, combined with dual promoters and dual-fluorescent reporter genes, a transgenic animal model capable of specifically and permanently labeling and tracking the fate transition of airway ciliated cells was constructed.
[0004] The core technical principle of this invention is as follows:
[0005] Ciliated cell-specific labeling: The ciliated cell-specific promoter FoxJ1 is used to simultaneously drive the expression of green fluorescent protein (GFP) and Cre recombinase. This results in all mature ciliated cells being labeled green (GFP+) and carrying Cre recombinase.
[0006] Activation of transdifferentiation event: Construct a mucin cell-specific reporter gene cassette, which is to insert a stop codon (loxP-Stop-loxP) surrounded by two LoxP sites downstream of the mucin cell-specific promoter MUC5AC, and then connect it to a red fluorescent protein (such as tdTomato or RFP) gene.
[0007] Dual fluorescence tracing: The two transgenic mice were crossed. In the offspring mice, normal ciliated cells expressed only GFP (green). When these cells began to express MUC5AC under external stimuli (such as PM2.5 or allergens), the Cre recombinase already present in the cell nucleus recognized and cleaved the loxP-Stop-loxP sequence downstream of the MUC5AC gene, thereby initiating the expression of the RFP gene. Ultimately, mucociliated cells derived from ciliated cells will simultaneously express GFP and RFP (yellow), or, after completely losing the characteristics of ciliated cells, express only RFP (red). This irreversible color transformation provides conclusive evidence of the cell's "past and present life."
[0008] To achieve the above objectives, the technical solution of the present invention is as follows:
[0009] In a first aspect, the present invention provides a method for constructing a dual-fluorescent reporter gene animal model for tracking the transdifferentiation of airway ciliated cells into mucous cells, comprising the following steps:
[0010] A. Construction of animal models with specific markers for ciliated cells
[0011] By simultaneously inserting green fluorescent protein (EGFP) and iCre recombinase sequences after the start codon ATG of the ciliated cell-specific promoter Foxj1 gene, ciliated cells can stably co-express green fluorescent protein and iCre recombinase under the regulation of the endogenous Foxj1 promoter.
[0012] B. Construction of animal models for reporting transdifferentiation events
[0013] A reporter gene cassette for mucin cell-specific expression was constructed by inserting a stop codon surrounded by two LoxP sites downstream of the mucin cell-specific promoter Muc5ac, followed by linking it to the red fluorescent protein tdTomato gene; then the reporter gene cassette was inserted before the stop codon of the Muc5ac gene.
[0014] C. Construction of a double transgenic animal model
[0015] The homozygous animals obtained in steps A and B were hybridized to obtain FoxJ1-EGFP-iCre+ Muc5ac-loxP-Stop-loxP-tdTomato double transgenic mice. In these mice, once EGFP-tagged ciliated cells initiate the expression of the Muc5ac gene, the iCre enzyme cleaves the Stop sequence, thereby irreversibly enabling the expression of tdTomato.
[0016] Preferably, in step A, the simultaneously inserted green fluorescent protein EGFP and iCre recombinase sequences are Kozak-EGFP-P2A-iCre sequences. The gene sequence of Kozak-EGFP is shown in SEQ ID NO.1, the gene sequence of P2A is shown in SEQ ID NO.2, and the gene sequence of iCre is shown in SEQ ID NO.3.
[0017] Preferably, in step B, the stop codon is the strong stop sequence 6xSV40 pA; the gene sequence of tdTomato is shown in SEQ ID NO.4.
[0018] In a second aspect, this invention provides a dual-fluorescent reporter gene animal model for tracking the transdifferentiation of airway ciliated cells into mucinous cells, constructed using the method described above. In this animal model, normal ciliated cells express only GFP (green). When these cells begin to express Muc5ac under external stimuli (such as PM2.5 or allergens), the Cre recombinase already present in their nuclei recognizes and cleaves the loxP-Stop-loxP sequence downstream of the Muc5ac gene, thereby initiating the expression of the RFP gene. Ultimately, mucinous-ciliated cells derived from ciliated cells will simultaneously express GFP and tdTomato (yellow), or, after completely losing ciliated cell characteristics, express only tdTomato (red).
[0019] The effectiveness of this model has been validated through asthma models and cell lineage tracing analysis, directly demonstrating the existence of mucus-secreting cells derived from ciliated cells under asthma pathological conditions; further, through cluster analysis of RNA sequencing results of different cell subpopulations, transcription factors related to mucus secretion function were discovered.
[0020] In a third aspect, the invention provides applications of the dual-fluorescent reporter gene animal model: a first application is its use as a platform for studying cell plasticity. Preferably, this cell plasticity research platform is a research platform for in vivo histological observation, in vitro dynamic live-cell imaging, or high-purity sorting of target cell populations.
[0021] The second application is in constructing animal models of induced airway epithelial remodeling and mucus hypersecretion. These models are created by introducing environmental pollutants, allergens, or viruses into the animal body. This can be applied to research on the pathogenesis of diseases such as bronchial asthma, chronic obstructive pulmonary disease (COPD), cystic fibrosis, and bronchiectasis, and can also be used to assess the effects of environmental pollutants such as particulate matter (PM2.5), smoking, and ozone on the structure and function of airway epithelial cells.
[0022] The third application is in screening drugs that inhibit or reverse pathological transdifferentiation of ciliated cells, providing an important preclinical validation tool for developing new drugs to treat mucus hypersecretion. For example, it can be used as a preclinical animal model to study the normal differentiation, damage repair, and regulatory mechanisms of cellular plasticity of airway epithelial cells, or to screen and validate targeted inhibition of airway mucus.
[0023] Compared with the prior art, the present invention has the following significant advantages:
[0024] (1) Extremely conclusive lineage tracing: For the first time, direct and clear genetic evidence was provided for the transdifferentiation of ciliated cells into mucous cells through irreversible gene recombination events, resolving the long-standing controversy over cell origin in the field.
[0025] (2) High specificity and high resolution: The highly specific FoxJ1 and MUC5AC promoters ensure the accuracy of labeling. The dual-color fluorescence system provides extremely high resolution for distinguishing between primitive cells, intermediate cells and terminal cells.
[0026] (3) The present invention provides a method for constructing a dual-fluorescent reporter gene animal model for tracking the transdifferentiation of airway ciliated cells into mucinous cells. The mouse model constructed using this method can be stably passaged, providing a convenient, reliable, and economical means for studying RCAN1 gene mutations and their pathogenic mechanisms. Given the difficulty in obtaining human patient research materials and the constraints of medical ethics, the mouse model provided by the present invention will become an important tool in the study of diseases involving the transdifferentiation of airway ciliated cells into mucinous cells.
[0027] (4) Powerful and versatile: It is not only suitable for in vivo histological observation, but also for in vitro dynamic live cell imaging. Furthermore, it can be combined with flow cytometry for high-purity sorting of target cell populations, making it a powerful platform for studying cell plasticity.
[0028] (5) An ideal tool for disease model research: It provides an ideal animal model for studying how environmental pollutants such as PM2.5, allergens, and viral infections induce airway epithelial remodeling and mucus hypersecretion, which greatly facilitates the study of related pathogenesis mechanisms.
[0029] (6) Drug screening and target validation: It can serve as an efficient drug screening platform to evaluate whether candidate drugs can inhibit or reverse the pathological transdifferentiation of ciliated cells, providing an important preclinical validation tool for developing new drugs to treat mucus hypersecretion. Attached Figure Description
[0030] Figure 1 A schematic diagram illustrating the construction principle of the FoxJ1-EGFP-iCre tool mouse is shown;
[0031] Figure 2 This shows a schematic diagram illustrating the construction principle of the Muc5ac-tdTomato report mouse;
[0032] Figure 3 The results show the transdifferentiation of ciliated cells into mucous cells confirmed by flow cytometry. A represents the flow cytometry results, and B represents the statistical proportion of RFP+ cells.
[0033] Figure 4 The results of slide fluorescence imaging are shown;
[0034] Figure 5 A heatmap showing gene expression clustering in different cell subpopulations was displayed.
[0035] Figure 6 A heatmap showing the clustering of transcription factor expression in different cell subpopulations is displayed. Detailed Implementation
[0036] The following embodiments further illustrate the present invention and should not be construed as limiting the invention. The embodiments do not include a detailed description of conventional methods, which are well known to those skilled in the art and described in numerous publications.
[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to this invention, and the preferred embodiments and materials described in the specific implementation are for illustrative purposes only.
[0038] I. Construction Strategy
[0039] By constructing two independent transgenic mouse strains and then hybridizing them, a dual-fluorescent reporter gene model was finally obtained.
[0040] Strain A (FoxJ1-EGFP-iCre tool mouse): See design diagram. Figure 1 Using gene editing technology, the Kozak-EGFP-P2A-iCre sequence was inserted after the start codon (ATG) of the Foxj1 gene. This enabled ciliated cells to stably co-express the EGFP and iCre recombinases under the regulation of the endogenous Foxj1 promoter. EGFP was used to label ciliated cells, while iCre served as a tool enzyme for excising the sequence between loxP sites in downstream genes.
[0041] Strain B (Muc5ac-tdTomato Reporter Mouse): See design schematic. Figure 2Using gene editing technology, a loxP-6xSV40 pA(Stop)-loxP-P2A-tdTomato reporter cassette was inserted before the stop codon of the Muc5ac gene. Under normal circumstances, the tdTomato gene cannot be expressed due to the presence of the strong termination sequence (6xSV40 pA) between loxP sites.
[0042] Final model: Homozygous mice from strains A and B were crossed to obtain FoxJ1-EGFP-iCre;Muc5ac-loxP-Stop-loxP-tdTomato double transgenic mice. In these mice, once EGFP-tagged ciliated cells initiate the expression of the Muc5ac gene, the iCre enzyme cleaves the Stop sequence, thereby irreversibly activating the expression of tdTomato (red fluorescence).
[0043] The key modified gene sequences used in the construction process are as follows:
[0044] Kozak-EGFP sequence (726 bp):
[0045] GCCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG (SEQ ID NO.1).
[0046] P2A sequence (66 bp)
[0047] GGAAGCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCT (SEQ ID NO.2).
[0048] iCre sequence (1053 bp)
[0049] ATGGTGCCCAAGAAGAAGAGGAAGGTGTCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTACCGGTCGATGCAACGAGTGATGAGGTTCGCAAGAACCTGATGGACATGTTCAGGGATCGCCAGGCGTTTTCTGAGCATACCTGGAAAATGCTTCTGTCCGTTTGCCGGTCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGCAGAACCTGAAAGATGTTCGCGATTATCTTCTATATCTTCAGGCGCGCGGTCTGGCAGTAAAAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCATCGTCGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTATGCGGCGGATCCGAAAAGAAAACGTTGATGCCGGTGAACGTGCAAAACAGGCTCTAGCGTTCGAACGCACTGATTTCGACCAGGTTCGTTCACTCATGGAAAATAGCGATCGCTGC
[0050] CAGCAGATACGCCTACCCGTTGCTCGGAAGATTGCCAGGATTGCGGCTGAGTGAAAGACACCTACGCCCATCCGATGGTTGGAGAATGTTAATCCAGACGGACAGATGCATGGAGCAGATCAACGCCTGGCTTTGCTGGGGATTCGGGCAATTCGCAATGCGCCGCTGTTTAAATCAGAGTGAGGACATTTTACCCGCCGATGGTGGGAGAATGCTGATTCACATTGGACGGACCAAGACCCTGGTGTCCACAGCTGGTGTGGAGAAGGCCCTGTCCTTGGGCGTTACCAAGCTGGTAGAGAGATGGATCTCTGTGTCTGGAGTGGCTGATGACCCCAACAACTACCTGTTCTGCCGGGTGAGAAGAAATGGAGGTGGCGGCCCCTTCTGCCACCTCCCAACTGTCCACCCGGGCCTGGAAGGGATCTTTGAGGCCACCCAGCGCCTGATCTATGGTGCCAGGATGACTTCTGGGGAGAGATACCTGGCCTGGTCTGGCCACTCTGCCAGAGTGGGGTGCTGCCAAGGGACATGGCCAGGCTGGTGTGTCCATCCCTGAAATCATGCAGGCTGGTGGCTGGACCAATGTGAAACATAGTGATGAACTACATCAAGAACCTGGACTCTGAGACTGGGGCCATGGTGAGGGCTGCCCGAGGATGGGGAC (SEQ ID NO.3).
[0051] tdTomato sequence (1431 bp)
[0052]
[0053] II. Model Validation
[0054] 1. Brief description of the verification process
[0055] To verify the effectiveness of this model, we conducted experimental validation on FoxJ1-EGFP-iCre; Muc5ac-loxP-Stop-loxP-tdTomato double transgenic mice using two methods:
[0056] (1) Induction of asthma model: An allergic asthma model was induced in mice by intraperitoneal injection and airway titration of house dust mite (HDM) extract to simulate a chronic airway inflammatory environment. Mice treated with PBS served as the control group.
[0057] (2) Cell lineage tracing analysis:
[0058] Flow cytometry: Mouse airway epithelial cells were isolated (CD45-CD31-EpCAM+ cells were screened), and the proportion of EGFP and tdTomato positive cells was detected by flow cytometry.
[0059] Frozen section fluorescence imaging: Frozen sections of mouse lung tissue were prepared, and the expression and localization of EGFP and tdTomato fluorescence in the airway epithelium were observed under a confocal microscope.
[0060] Transcriptomics analysis: Different cell subpopulations (EGFP+tdTomato-, EGFP+tdTomato+, etc.) in the control group and HDM group were sorted by flow cytometry, and RNA sequencing was performed to analyze the differences in their gene expression profiles.
[0061] 2. Experimental Results and Analysis
[0062] 2.1 Flow cytometry confirmed the transdifferentiation of ciliated cells into mucinous cells.
[0063] like Figure 3 As shown, compared with the control group, the proportion of FoxJ1-EGFP positive cells, representing ciliated cells, was significantly decreased in the airway epithelial cells of asthmatic mice treated with HDM. Figure 3 A). At the same time, a new group of Muc5ac-tdTomato-positive cells (RFP+ cells) emerged ( Figure 3 (B) This directly demonstrates the existence of mucus-secreting cells derived from ciliated cells under asthmatic pathological conditions. This result provides strong quantitative evidence for ciliated cell transdifferentiation, proving that this model can sensitively capture this cell fate transition event.
[0064] 2.2 Fluorescence imaging visually demonstrates the spatial localization of transdifferentiated cells.
[0065] The results of fluorescence imaging of frozen sections are as follows: Figure 4 The results showed that in the control group, airway epithelial cells significantly expressed green fluorescence (FoxJ1-EGFP) but no red fluorescence (MUC5AC-tdTomato); in the HDM-treated group, the intensity of green fluorescence in airway epithelial cells decreased, while obvious red fluorescent cells appeared. In the merged images, yellow cells expressing both green and red fluorescence could be observed, namely mucociliary cells that are undergoing or have already completed transdifferentiation.
[0066] The results visually demonstrate the presence and spatial distribution of transdifferentiated cells at the tissue level, which is completely consistent with the results of flow cytometry, further validating the reliability of the model.
[0067] 3. Transcriptomics reveals unique gene expression characteristics of transdifferentiated cells.
[0068] Cluster analysis was performed on RNA sequencing results from different cell subpopulations to create gene expression heatmaps. Compared with the ciliated cells (GFP+RFP-) of the control group, the newly emerging mucinous cells (GFP-RFP+) and intermediate cells (GFP+RFP+) in the HDM group exhibited significantly different gene expression profiles, indicating that they are cell types with completely different functions and molecular characteristics. Figure 5 Further analysis of transcription factors revealed that transcription factors associated with mucus secretion, such as Bpifb1 and Creb3l1, were significantly elevated in transdifferentiated mucus cells (GFP-RFP+). Figure 6 ).
[0069] The transcriptomics results not only reaffirmed the change in cell identity, but also revealed key transcription factors regulating this process at the molecular level, providing important clues for subsequent mechanism research and drug target development.
[0070] The dual-fluorescent reporter gene animal model constructed in this invention is mainly applied in the fields of life sciences and medical research, specifically including:
[0071] Research on respiratory diseases: Pathogenesis studies of diseases such as bronchial asthma, chronic obstructive pulmonary disease (COPD), cystic fibrosis, and bronchiectasis.
[0072] Environmental and toxicological studies: assessing the effects of environmental pollutants such as particulate matter (PM2.5), smoking, and ozone on the structure and function of airway epithelial cells.
[0073] Developmental Biology and Regenerative Medicine: Researching the regulatory mechanisms of normal differentiation, damage repair, and cell plasticity of airway epithelial cells.
[0074] Drug development: As a preclinical animal model, it is used to screen and validate targeted inhibition of airway mucus.
[0075] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.
Claims
1. A method for constructing a dual-fluorescent reporter gene animal model for tracking the transdifferentiation of airway ciliated cells into mucous cells, characterized in that, Comprising the following steps: A. Construction of an animal model with ciliated cell-specific marker A green fluorescent protein and iCre recombinase sequence are simultaneously inserted after the start codon of the ciliated cell-specific promoter Foxj1 gene, so that the ciliated cell can stably co-express green fluorescent protein and iCre recombinase under the regulation of the endogenous Foxj1 promoter; B. Construction of a transdifferentiation event reporter animal model A reporter gene cassette specifically expressed in mucous cells is constructed, that is, a stop codon surrounded by two LoxP sites is inserted downstream of the mucous cell-specific promoter Muc5ac, and then a red fluorescent protein gene is connected; then the reporter gene cassette is inserted before the stop codon of the Muc5ac gene; C. Construction of a double transgenic animal model The homozygous animals obtained in steps A and B are crossed to obtain FoxJ1-EGFP-iCre+ Muc5ac-loxP-Stop-loxP-tdTomato double transgenic animals; In this animal, once the EGFP-labeled ciliated cell initiates the expression of the Muc5ac gene, the iCre enzyme will excise the Stop sequence, thereby irreversibly turning on the expression of the red fluorescent protein.
2. The construction method according to claim 1, characterized in that: wherein In step A, the start codon of the Foxj1 gene is ATG; the green fluorescent protein EGFP and iCre recombinase sequence inserted simultaneously is Kozak-EGFP-P2A-iCre sequence.
3. The construction method of claim 2, wherein, The gene sequence of Kozak-EGFP is shown in SEQ ID NO. 1, the gene sequence of P2A is shown in SEQ ID NO. 2, and the gene sequence of iCre is shown in SEQ ID NO.
3.
4. The construction method of claim 1, wherein, In step B, the stop codon is a strong termination sequence 6xSV40 pA; the red fluorescent protein gene is tdTomato, and the gene sequence is shown in SEQ ID NO. 4; In step C, the double transgenic animal constructed is FoxJ1-EGFP-iCre+ Muc5ac-loxP-Stop-loxP-tdTomato double transgenic animal.
5. A dual fluorescent reporter animal model for tracking ciliocyte to mucocilocyte transdifferentiation, comprising, Prepared by the method of any one of claims 1-4.
6. The use of the animal model of claim 5 as a cell plasticity research platform.
7. Use according to claim 6, characterized in that, The cell plasticity research platform is a research platform for in vivo histological observation, in vitro dynamic live cell imaging, or high-purity sorting of target cell populations.
8. The use of the animal model of claim 5 in constructing an animal model for inducing airway epithelial remodeling and high mucus secretion.
9. A method for constructing an animal model for inducing airway epithelial remodeling and mucus hypersecretion, characterized by, The environmental pollutants, allergens or viruses are applied to the animal model of claim 5 to construct.
10. The use of the animal model of claim 5 in screening drugs for inhibiting or reversing pathological transdifferentiation of ciliated cells.