Monomolecular biosensing platform as well as construction method and application thereof

Abstract

According to the invention, an amplification-free, high-sensitivity and high-specificity monomolecular biosensing platform is constructed. According to the single-molecule biosensing platform, the clickchemistry-based multi-fluorophore nucleic acid probe is designed and synthesized by taking DNA (Deoxyribose Nucleic Acid) of orientia tsutsugamushi as a model target. 5-ethynyl-2 '-deoxyuridine triphosphate is introduced into the probe through a polymerase chain reaction, so that the probe carries a plurality of alkynyl modification sites and is further connected with a large number of Cy5 fluorophores, signals are greatly enhanced, and the photobleaching problem is effectively relieved. Meanwhile, random optical reconstruction microscopy is introduced to serve as a detection reading mode, the random flicker characteristic of fluorescent molecules is utilized, tens of thousands of single molecule events are positioned and counted, and signals are further amplified. The application successfully develops a simple, rapid, high-sensitivity and high-specificity single-molecule detection platform, provides an effective tool for the detection of low-abundance biomarkers, and has wide application prospects in the fields of early diagnosis of diseases and the like.

Description

Technical Field

[0001] This invention pertains to biosensing platforms in the field of disease screening and epidemic prevention, specifically relating to a single-molecule biosensing platform, its construction method, and its applications. Background Technology

[0002] Nucleic acids are natural biopolymers of nucleotides that store, encode, transport, and express genetic information, which plays a central role in various cellular events and diseases in organisms. Various pathogens, such as SARS-CoV-2, human immunodeficiency virus, and hepatitis B virus, as well as normal and malignant transformed cells in organisms, all possess unique nucleic acid sequence characteristics. Nucleic acid detection (NAT) is based on highly specific molecular recognition mechanisms, enabling precise identification of these marker sequences and thus qualitative or quantitative analysis of target nucleic acids. The specificity and sensitivity of nucleic acid detection are crucial for clinical diagnosis and biotechnology applications. Many technologies have been developed to detect specific nucleic acid sequences. PCR-based laboratory testing techniques are currently considered the gold standard for nucleic acid detection, possessing high specificity and sensitivity. However, this method has limitations such as long detection cycles, high dependence on expensive instruments, and susceptibility to amplification errors leading to false positives or false negatives. Therefore, there is an urgent need to construct a rapid, simple, and highly accurate amplification-free NAT platform.

[0003] Single-molecule detection technology, a significant breakthrough in analytical science, enables the direct observation of the behavior of individual molecules, exhibiting extremely high sensitivity and specificity. Since the mid-20th century, this technology has undergone continuous development from direct imaging to indirect detection, and from in vitro analysis to in vivo applications, gradually forming various mature methods including enzyme labeling, nanopore sensing, and single-molecule fluorescence. Among these, single-molecule fluorescence technology demonstrates enormous potential due to its ability to capture single photon events, providing single-molecule-level sensitivity and offering new avenues for early disease diagnosis and the analysis of low-abundance biomarkers. For example, Professor Zhang Chunyang's team at Southeast University successfully applied the quantification of target molecules through simple counting of single fluorescence signals to the sensitive detection of disease-related biomarkers such as DNA, miRNA, proteins, enzymes, and intact cells. Furthermore, Professor Nils Walters' team at the University of Michigan further demonstrated the potential of single-molecule fluorescence technology in achieving high specificity and single-molecule sensitivity for the detection of various biomarkers through a single-molecule method—Single-Molecular Recognition via Equilibrium Poisson Sampling (SiMREPS).

[0004] Despite significant progress in sensitivity, specificity and quantification, single-molecule detection technology still faces technical bottlenecks in practical applications: (1) phototoxicity problem, the activity of fluorescent molecules imaged after 5 minutes of continuous laser irradiation is less than 30%; (2) insufficient signal intensity, the single-molecule counting method has insufficient signal intensity due to the limited number of fluorescent molecules imaged, thus resulting in a limited detection range; although the SiMREPS method has high specificity and sensitivity, its detection data processing is too complicated and not suitable for rapid detection.

[0005] Therefore, there is an urgent need for a simple, rapid, amplification-free single-molecule biosensing platform that can effectively solve the phototoxicity problem, providing an effective tool for the high-sensitivity and high-specificity detection of low-abundance biomarkers, thereby promoting the development of early disease diagnosis technology. Summary of the Invention

[0006] The purpose of this invention is to provide a method for constructing a single-molecule biosensing platform and its application. The single-molecule biosensing platform provided by this invention is simple, rapid, highly sensitive and specific, providing an effective tool for the detection of low-abundance biomarkers, and has broad application prospects in the field of early disease diagnosis.

[0007] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a single-molecule biosensing platform, which includes the synthesis of multifluorophore nucleic acid probes, the connection of magnetic bead complexes, target strand displacement reaction, and single-molecule fluorescence localization imaging.

[0008] Preferably, the synthesis of the multifluorophore nucleic acid probe includes the following steps: S1. Preparation of double-stranded DNA: Add 10 μL of 10×PCR Buffer, 0.2 μL of dATP (100 mM), 0.2 μL of dGTP (100 mM), 0.2 μL of dCTP (100 mM), 0.2 μL of 5-EdUTP (100 mM), 1 μL of forward primer, 1 μL of reverse primer, 0.2 μL of template, and 1 μL of Taq DNA polymerase to an EP tube. Finally, add DEPC water to a final volume of 100 μL, mix well, and perform PCR amplification. Purify the amplified product using ethanol precipitation. S2. Lambda exonuclease was added to the amplification product and the DNA double strand was digested at 37℃ for 50 min and 75℃ for 10 min. The DNA was then purified by ethanol precipitation to obtain single-stranded DNA. S3. Add 0.2 μL of 10 mM Cy5-N3 and 10 μL of 10 mM Cu to 200 pmol of single-stranded DNA. +The catalyst solution, 10 μL of 100 mM phosphate buffer, and water were added to a final volume of 100 μL. The mixture was reacted in a metal bath at 37°C for 50 min, and purified by ethanol precipitation to obtain a multi-fluorescent nucleic acid probe.

[0009] Preferably, the nucleotide sequences of the forward primer, reverse primer, and template in step S1 are shown in SEQ ID NO. 1-3.

[0010] Preferably, the PCR reaction process in step S1 is performed in 40 cycles of 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 15 s, and finally amplification is completed by treatment at 72℃ for 5 min.

[0011] Preferably, the linking process of the magnetic bead complex includes: adding a capture probe with biotin linked to its 5' end, the above-mentioned multifluorophore nucleic acid probe, and 5 μL of Binding Buffer I (10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 2 M NaCl, 0.1% Tween-20) to a 10 μL reaction system, and reacting at room temperature in the dark for 1 h to form a reporter unit solution; After washing 20 μL of streptavidin magnetic bead suspension (10 mg / mL) three times with 1× TBS, the suspension was resuspended in 2 times the suspension volume of Binding Buffer I and reacted with 10 μL of reporter unit solution at room temperature in the dark for 30 min. Unlinked reporter units were washed away, and the suspension was resuspended in 40 μL of Binding Buffer I to obtain the magnetic bead complex solution.

[0012] Preferably, the target strand displacement reaction process is as follows: different concentrations of target DNA and DEPC water are added to 10 μL of magnetic bead complex to a final volume of 20 μL, and the mixture is reacted in a rotary mixer at room temperature in the dark for 40 min. The supernatant of the strand displacement reaction is obtained by magnetic separation for 1 min.

[0013] Preferably, the single-molecule fluorescence localization imaging process includes: capturing STORM images on a custom Olympus ix-73 total internal reflection fluorescence (TIRF) microscope with an excitation light of 640 nm and a ×60 1.45 NA oil immersion objective; performing STORM imaging in an imaging buffer; selecting five regions for each sample using a five-point sampling method; imaging 1000 frames for each region; and constructing STORM images using ImageJ software for localization and counting. The imaging buffer consists of: 50 mM tris(hydroxymethyl)aminomethane (pH 8.0), 50 mM NaCl, 5 mM MgCl, 1400 AU catalase, 168 AU glucose oxidase, 10% w / v glucose, and 1% v / v β-mercaptoethanol.

[0014] This invention also provides the application of the above-mentioned single-molecule biosensor platform in the detection of Orientia tsutsugamushi DNA.

[0015] Preferably, the scrub typhus DNA is a 50 bp conserved sequence from the 47 kDa gene of scrub typhus; the conserved sequence is shown in nucleotide sequence SEQ ID NO. 6.

[0016] The beneficial effects of this invention are: 1. High sensitivity: By using multi-fluorophore labeled probes (input amplification) and single-molecule localization counting (output amplification), ultra-high detection sensitivity at the aM (10^-18 M) level is achieved, with an absolute detection limit as low as approximately 274 yoctomoles.

[0017] 2. High specificity: Utilizing the principle of chain displacement reaction, it can effectively distinguish between target and non-target nucleic acids, maintaining 100% sensitivity and specificity even in complex samples.

[0018] 3. No amplification required: No PCR or isothermal amplification of the target DNA is required, avoiding the risks of contamination and false positives, and simplifying the operation process.

[0019] 4. Wide range of applications: The single-molecule biosensing platform described in this invention can be applied to the detection of a variety of low-abundance biomarkers (such as viral DNA, cancer biomarkers, etc.) by changing the probe sequence. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 A flowchart illustrating the construction process of a biosensing platform combining multi-fluorescent nucleic acid probes with single-molecule localization microscopy imaging technology; Figure 2 Figure 1 shows the synthesis and characterization of the multi-fluorescent nucleic acid probe; A: Schematic diagram of multi-fluorescent nucleic acid probe synthesis; B: Polyacrylamide gel electrophoresis (PAGE) image of DNA synthesis and digestion products, where lane 1 is the PCR purification product of dNTPs, lane 2 is the PCR purification product of 5-ethynyl-2'-deoxyuridine triphosphate (5-EdUTP), and lane 3 is the digestion and purification product of 5-EdUTP; C: UV-Vis absorption spectrum of the multi-fluorescent nucleic acid probe; D: Fluorescence spectrum of the multi-fluorescent nucleic acid probe. Figure 3 Figure 1 shows the feasibility study results of detecting scrub typhus targets using a single-molecule sensing platform; A: Fluorescence spectra of magnetic separation supernatants in the experimental and control groups (red line: target present; black line: target absent); B: Single-molecule localization (STORM) images of magnetic separation supernatants in the control and experimental groups; C: Quantitative analysis of single-molecule fluorescence localization imaging in the experimental and control groups (p < 0.0001, Student's t-test, error bars represent the standard deviation of the three experiments). Figure 4 A is a PAGE plot showing the effect of digestion time on single-stranded DNA yield. Lanes 1, 2, 3, 4, 5, and 6 represent digestion reaction times of 0 min, 10 min, 20 min, 30 min, 40 min, and 50 min, respectively. The band at 60 bp represents dsDNA, and the band at 40 bp represents ssDNA. B is a semi-quantitative PAGE plot showing the effect of digestion time on single-stranded DNA yield. The horizontal axis represents digestion time, and the vertical axis represents the original integrated optical density of dsDNA and ssDNA in the corresponding PAGE plot. C shows the optimization of capture probe concentration. The vertical axis represents the ligation rate. Different concentrations of reporter units and magnetic beads were added to the experimental group, while no magnetic beads were added to the blank group. All other conditions were the same. The reaction was carried out in the dark for 30 minutes. After min, the fluorescence values ​​of the supernatant of the experimental group and the blank group were detected respectively. (Blank group - Experimental group) / Blank group = Connectivity rate; D is the optimized chain displacement reaction time; E is the fluorescence spectrum of the optimized magnetic bead dosage, the color depth represents the fluorescence intensity, the darker the color, the stronger the fluorescence intensity; F is the fluorescence quantitative spectrum of the optimized magnetic bead dosage, and the error bars represent the standard deviation of the three experiments. Figure 5 A represents the Gibbs free energy of the binding of the signal probe and the capture probe at different temperatures; B represents the Gibbs free energy of the binding of the target and the capture probe at different temperatures; C represents the difference in Gibbs free energy of the binding of the capture probe with the signal probe and the target at different temperatures. Figure 6 A represents the results of real sample testing; A represents the STORM imaging results of inactivated serum from 5 positive patients (P1-P5) and 6 negative patients (N1-N6); B represents the fluorescence localization point count of single molecular imaging in serum from positive and negative patients. Error bars represent the standard deviation of the three experiments (p<0.0001, Student's t-test). Figure 7Figure A shows the results of specific detection; fluorescence emission spectra of the supernatant extracted by magnetic separation after reacting with different DNAs (hepatitis B virus, herpes simplex virus, Pseudomonas aeruginosa, Plasmodium, and monkeypox virus and their mixtures). The blank group is a negative control without a target, and the mixed group is a mixture of five DNAs (hepatitis B virus, herpes simplex virus, Pseudomonas aeruginosa, Plasmodium, and monkeypox virus and their mixtures); A shows the fluorescence spectrum results; B shows the quantitative results of the fluorescence spectrum (****p<0.0001, Student's t-test). Figure 8 For specific detection, different target DNAs (Oriental scrub typhus, hepatitis B virus, herpes simplex virus, Pseudomonas aeruginosa, Plasmodium, and monkeypox virus, and mixtures thereof) were added, reacted, and the supernatant was extracted by magnetic separation for detection. The blank group was a negative control without targets, and the mixed group was a mixture of six DNAs (Oriental scrub typhus, hepatitis B virus, herpes simplex virus, Pseudomonas aeruginosa, Plasmodium, and monkeypox virus). A shows the single-molecule fluorescence imaging results of the supernatant of different target DNAs; B shows the count of fluorescent localization points in response to different target DNAs (p<0.0001, Student's t-test; error bars represent the standard deviation of the three experiments). Figure 9 A represents the results of real sample testing; A represents the STORM imaging results of inactivated serum from 5 positive patients (P1-P5) and 6 negative patients (N1-N6); B represents the fluorescence localization point count of single molecular imaging in serum from positive and negative patients. Error bars represent the standard deviation of the three experiments (p<0.0001, Student's t-test). Detailed Implementation

[0022] This invention selects a 50 bp conserved sequence from the 47 kDa gene of Orientia tsutsugamushi as a target to construct a single-molecule sensing platform. This platform includes the synthesis of multifluorophore nucleic acid probes, the ligation of magnetic bead complexes, target strand displacement reaction, and single-molecule fluorescence localization imaging.

[0023] First, the multifluorescent nucleic acid probe was synthesized. The nucleotide analog 5-ethynyl-2'-deoxyuridine triphosphate (5-EdUTP) was used instead of dTTP in the PCR reaction. The amplified product was digested by λ exonuclease, resulting in a 5' phosphorylated nucleic acid strand, which was then purified to obtain a polyethynyl single strand. Through a cycloaddition reaction between the ethynyl and azido groups, the azido-modified fluorescent group Cy5 was attached to the probe single strand, thus preparing the multifluorescent nucleic acid probe.

[0024] Next is the target strand displacement reaction. Specifically, there is a 20-base complementary pairing between the signal probe and the biotinylated capture probe. First, the signal probe and the biotinylated capture probe are co-incubated to form a double-stranded reporter unit. The reporter unit is then attached to streptavidin magnetic beads via the binding between streptavidin and biotin. After adding scrub typhus target DNA, because there is a 50-base complementary pairing between the scrub typhus target DNA and the capture probe, the capture probe tends to bind to the target DNA, thereby displacing the multifluorescent nucleic acid probe. Under the influence of a magnetic field, the magnetic beads, along with the target DNA, are deposited at the bottom, and the supernatant contains the displaced multifluorescent nucleic acid probe.

[0025] Finally, single-molecule localization (STORM) imaging was performed on the supernatant. During STORM imaging, the random switching of fluorescence signals between active and dark states causes a "scintillation" phenomenon. Therefore, based on scintillation, spatially discrete fluorescent spots are located. By localizing tens of thousands of single molecules through thousands of images, the signal can be greatly amplified, thus allowing the detection of low-abundance nucleic acid biomarkers. ImageJ software is used to count the images to complete the quantitative detection of the target.

[0026] This invention also provides an amplification-free method for detecting target nucleic acids, which mainly includes three core steps: 1. Synthesis of multifluorescent nucleic acid probes: PCR amplification was performed by replacing dTTP with 5-EdUTP to generate DNA strands with multiple alkyne modifications. Subsequently, a large number of Cy5 fluorophores were linked through click chemistry to form a multifluorescent probe with strong signal and resistance to bleaching.

[0027] 2. Target-triggered chain displacement reaction: The above-mentioned multifluorescent probes are hybridized with the capture probes immobilized on magnetic beads. When the target is present, its stronger binding force with the capture probes displaces the multifluorescent probes into the solution.

[0028] 3. Single-molecule localization imaging and detection: STORM imaging is performed on the displaced multi-fluorescent probe solution. Utilizing the random "scintillation" characteristic of fluorescent molecules, thousands of images are acquired to precisely locate and count hundreds of thousands of single-molecule events, thereby achieving ultrasensitive quantification of the target.

[0029] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0030] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0031] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.

[0032] Example 1: Construction of a Single-Molecular Sensing Platform 1.1 Synthesis of Multifluorescent Nucleic Acid Probes (1) Preparation of double-stranded DNA: First, take 200 μL of EP tube and add 10 μL of 10×PCR Buffer, 0.2 μL of 100 mM deoxyadenosine triphosphate (dATP), 0.2 μL of 100 mM 2'-deoxyguanosine-5'-triphosphate (dGTP), 0.2 μL of 100 mM deoxycytidine diphosphate (dCTP), 0.2 μL of 100 mM 5-ethynyldeoxyuridine triphosphate (5-EdUTP), 1 μL of forward primer, 1 μL of reverse primer, 0.2 μL of template (a 50 bp conserved sequence from the 47 kDa gene of Orientia tsutsugamushi was selected as the detection target, and then a 20 bp sequence with high AT content was selected from the target, with forward and reverse primer sequences added to both ends respectively, and the antisense sequence is the template), 1 μL of Taq DNA polymerase, and finally add DEPC water to 100 mL. μL, mix well and place in a PCR amplification instrument. Perform 40 cycles of 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 15 s. Finally, treat at 72℃ for 5 min to complete the amplification. Purify the amplified product by ethanol precipitation.

[0033] The forward primer (FP) sequence is: GTATCGTGCAAGGGTGAATGC (SEQ ID NO.1); the reverse primer (RP-5'P) sequence is: / Phos / ATCCTAGCCCATACGGCAATG (SEQ ID NO.2); and the template sequence is: ATCCTAGCCCATACGGCAATGTAACATTTAACATACCACGAGCATTCACCCTTGCACGATAC (SEQ ID NO.3).

[0034] (2) Preparation of probe single strands: Add λ exonuclease to the amplification product and incubate at 37℃ for 50 min and 75℃ for 10 min to digest the DNA double strand into single strands and purify by ethanol precipitation to obtain polyacetylated single strand DNA.

[0035] (3) Linking single-stranded DNA with multiple fluorescent molecules: Add 200 pmol of the synthesized single-stranded DNA, 0.2 μL of 10 mM Cy5-N3, and 10 μL of 10 mM Cu. + The catalyst solution, 10 μL of 100 mM phosphate buffer, and water were added to a final volume of 100 μL. The mixture was reacted in a metal bath at 37°C for 50 min. After purification by ethanol precipitation, a multi-fluorescent nucleic acid probe was prepared. The flowchart of the synthesis of the multi-fluorescent nucleic acid probe is shown below. Figure 2 As shown in (A).

[0036] The synthesized multifluorescent nucleic acid probe sequence is: GTATCGTGCAAGGGTGAATGCTCGTGGTATGTTAAATGTTACATTGCCGTATGGGCTAGGAT (SEQ ID NO.4).

[0037] 1.2 Linkage of magnetic bead composites The capture probe was designed as an ssDNA with biotin attached to its 5' end, and the base sequence of the capture probe was: / biotin / TTAATTCATTAAGCATAACATTTAACATACCACGACGAATTTTTTCTCCT (SEQ ID NO.5).

[0038] To a 10 μL reaction system, add the capture probe, the synthesized signal probe described above, and 5 μL of Binding Buffer I (10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 2 M NaCl, 0.1% Tween-20). Incubate at room temperature in a rotary mixer in the dark for 1 h to form a reporter unit solution. Take 20 μL of a well-mixed streptavidin magnetic bead suspension (10 mg / mL), wash three times with 1×TBS, resuspend with 2 times the suspension volume of Binding Buffer I, add 10 μL of the above reporter unit solution, and incubate at room temperature in a rotary mixer in the dark for 30 min. Wash away any unconnected reporter units, resuspend with 40 μL of Binding Buffer I to obtain the magnetic bead complex solution.

[0039] 1.3 Target chain displacement reaction A 50 bp conserved sequence from the 47 kDa gene of Orientia tsutsugamushi was selected as the target. The target sequence OT-DNA is: AGGAGAAAAAATTCGTCGTGGTATGTTAAATGTTATGCTTAATGAATTAA (SEQ ID NO.6).

[0040] Take 10 μL of the resuspended magnetic bead complex, add different concentrations of the above target OT-DNA and DEPC water to a final volume of 20 μL, and react in a rotary mixer at room temperature in the dark for 40 min. Magnetic separation for 1 min yields the strand displacement reaction supernatant.

[0041] 1.4 Single-molecule fluorescence localization imaging STORM images were captured on a custom Olympus ix-73 total internal reflection fluorescence (TIRF) microscope with an excitation light of 640 nm and a ×60 1.45 NA oil immersion objective. STORM imaging was performed in imaging buffer (50 mM Tris pH 8.0), 50 mM NaCl, 5 mM MgCl, 1400 AU catalase, 168 AU glucose oxidase, 10% (w / v) glucose, and 1% (v / v) β-mercaptoethanol. Five regions were selected for each sample using a five-point sampling method, and each region was imaged 1000 times. ImageJ software (Thunderstorm plugin) was used to construct the STORM images and perform localization and counting.

[0042] Example 2 Synthesis and Characterization of Multifluorescent Nucleic Acid Probes The synthesized multifluorescent nucleic acid probes underwent a series of characterizations. For example... Figure 2 As shown in (B), the band of the PCR purified product with the addition of 5-ethynyl-2'-deoxyuridine triphosphate (5-EdUTP) is in the same position as the corresponding product with the dNTPs, indicating that PCR amplification can be successfully performed with the addition of 5-EdUTP containing an alkyne group. A clear band appeared in lane 3, and the band position was between 40-60 bp, which is as expected, proving that the poly-alkynyl double strand was successfully digested into a single strand.

[0043] Subsequently, the multifluorescent DNA strands were characterized by UV-Vis absorption and fluorescence spectra, such as... Figure 2 (CD) shown. Figure 2 (C) The UV-Vis absorption spectrum shows a distinct DNA absorption peak at 260 nm and a distinct Cy5 absorption peak at 655 nm. Figure 2 (D) Fluorescence spectroscopy revealed a characteristic Cy5 emission peak at 665 nm, and the fluorescence value of the ssDNA-Cy5 group was significantly higher than that of the control group. These results demonstrate the successful synthesis of the multi-fluorescent nucleic acid probe.

[0044] Example 3 Feasibility Study of the Detection System To verify the feasibility of the detection system, 1 nM of target was added to the experimental group while no target was added to the control group, and then the supernatant of the chain displacement reaction was detected.

[0045] The fluorescence spectrum results are as follows Figure 3 (A) shows that the chain displacement reaction only occurs in the presence of the target, successfully displacing the multifluorescent nucleic acid probe. A characteristic Cy5 emission peak was observed at 665 nm in the magnetically separated supernatant. Further single-molecule localization imaging was used to verify the successful displacement of the multifluorescent nucleic acid probe by the target. Figure 3 As shown in (B), clearly visible Cy5 fluorescent spots are present in the presence of the target. Quantitative analysis of the imaging results was then performed. Figure 3 (C) shows that there is a significant difference between the single-molecule fluorescence localization counting points in the experimental group and the counting points in the blank group.

[0046] The results above all indicate that the strand displacement reaction can only proceed successfully after the addition of target DNA, and that the detection system can be used for the quantitative detection of the target.

[0047] Example 4: Optimization of the Detection System To obtain the best experimental results, several experimental parameters, including double-stranded DNA digestion time, capture probe concentration, strand displacement reaction time, temperature, and magnetic bead dosage, were optimized.

[0048] First, the digestion reaction time was optimized, and the experimental results are as follows: Figure 4 (A) shows that as digestion time increases, the amount of single-stranded DNA in the system gradually increases, while the amount of double-stranded DNA gradually decreases; the quantitative results are as follows. Figure 4 (B) shows that the concentration of single-stranded DNA reached its highest level after 50 min of digestion, so a digestion time of 50 min was selected for subsequent experiments.

[0049] To accommodate a larger number of probes while minimizing the impact of steric hindrance on target recognition, the effects of different probe concentrations on the detection system were investigated. The optimized results are shown below. Figure 4 As shown in (C), the connectivity rate is positively correlated with the concentration of the capture probe as it increases from 80 nM to 160 nM, reaching a peak at 160 nM. However, the connectivity rate decreases when the capture probe concentration exceeds 160 nM. This may be because the excessively high concentration of the capture probe leads to competitive inhibition of its connection with the magnetic bead, resulting in a decrease in the capture probe connectivity rate. Based on these results, 160 nM was chosen as the capture probe concentration.

[0050] The chain displacement reaction is the core component of the detection system, and the reaction time and temperature have been optimized. Experimental results for the optimized reaction time are as follows: Figure 4 (D) shows that the fluorescence intensity of the targeted group gradually increased with increasing reaction time, reaching its peak at 40 min, and then decreased after 40 min. In the untargeted group, the fluorescence signal continuously increased with time, ranging from 5 to 80 min. The fluorescence intensity ratio between the targeted and untargeted groups was calculated, and the signal-to-noise ratio (targeted group / untargeted group) was lowest at a reaction time of 40 min.

[0051] The optimization results for the reaction temperature show that... Figure 5 As shown in (AC) and Table 1, the chain displacement reaction efficiency was highest at 22℃. Therefore, the subsequent chain displacement reaction conditions were 40 min at 22℃.

[0052] Table 1 Optimization of chain displacement reaction temperature

[0053] The amount of magnetic beads used is crucial for reducing the background signal of the detection system. Experimental results for optimizing the amount of magnetic beads are as follows: Figure 4 As shown in (EF), the fluorescence intensity of the supernatant decreased accordingly with increasing magnetic bead concentration, indicating that the magnetic beads effectively adsorbed the reporter unit. When the magnetic bead concentration reached 4 mg / mL, the fluorescence intensity of the supernatant dropped to its lowest point, indicating that the amount of magnetic beads at this point was sufficient to maximize the connection of the reporter unit. Therefore, considering both experimental cost and effectiveness, a final magnetic bead concentration of 4 mg / mL was ultimately selected for subsequent experiments.

[0054] Example 5 Sensitivity Analysis of the Detection System The sensitivity of the detection system was analyzed under optimized experimental conditions. When the supernatant was used for single-molecule imaging, the imaging results at different target concentrations were as follows: Figure 6 As shown in (A), the fluorescence signal can be directly observed, and the fluorescence signal increases with increasing target concentration. Quantitative analysis results are as follows: Figure 6 (B) shows a concentration-dependent increasing trend between the fluorescence localization point count and the target concentration.

[0055] Figure 6 (C) This shows a good linear relationship between the logarithm of the target concentration and the fluorescence localization point count within the concentration range of 10 aM to 1 pM. The linear regression equation is Y = 5236 × X + 902.4 (Y: fluorescence localization point count, X: logarithm of the target concentration). 10 C DNA ), coefficient of determination (R) 2The mean value was 0.9706. The limit of detection (LOD), calculated by adding three times the standard deviation of the blank values ​​to the mean of the blank values, was 2.74 aM. In a 10 µL detection system, the absolute limit of detection for the target was 274 yoctomoles.

[0056] Example 6 Specificity Analysis of the Detection System To evaluate the specificity of the detection system, the fluorescence intensity and fluorescence localization point counts of the target DNA (Oriental scrub typhus) and non-target DNA (hepatitis B virus, herpes simplex virus, Pseudomonas aeruginosa, Plasmodium, monkeypox virus) and their mixtures were compared.

[0057] Different target DNAs (Oriental scrub typhus, hepatitis B virus, herpes simplex virus, Pseudomonas aeruginosa, Plasmodium, and monkeypox virus) and their mixtures were added, reacted, and the supernatant was extracted by magnetic separation for detection. The blank group was a negative control without targets, and the mixed group was a mixture of six DNAs (Oriental scrub typhus, hepatitis B virus, herpes simplex virus, Pseudomonas aeruginosa, Plasmodium, and monkeypox virus).

[0058] The results are as follows Figure 7 As shown in (AB), compared with the blank group, the changes in fluorescence intensity of the hepatitis B virus, herpes simplex virus, Pseudomonas aeruginosa, Plasmodium and monkeypox virus groups were negligible. Only the group with scrub typhus target DNA (scrub typhus and mixed sample group) showed a significant increase in fluorescence intensity.

[0059] Single-molecule results as follows Figure 8 (A) shows that obvious fluorescent localization points can be observed in the scrub typhus and mixed sample groups, while they are almost invisible in other groups.

[0060] Quantitative analysis results as follows Figure 8 (B) showed no difference between the scrub typhus and mixed sample groups, but significant differences between the mixed and other groups (p < 0.0001). Significant fluorescence signals were directly observed in both the target and mixed groups, indicating that the detection system can effectively distinguish between target and non-target samples even in the presence of interfering substances.

[0061] Example 7: Detection of Complex Samples Orientia scrub typhus typically exists in low abundance in host blood, making the specific differentiation of scrub typhus DNA targets from a large number of coexisting interfering substances a significant challenge. Fetal bovine serum (10% FBS) was used to simulate serum samples for detection. Target DNA at concentrations of 1 fM, 10 fM, and 100 fM were added to the serum for detection. The results, shown in Table 2, indicate that the quantitative recoveries ranged from 97.75% to 104.75%, meeting expectations.

[0062] Table 2. Recovery rate of target DNA in 10% fetal bovine serum.

[0063] Subsequently, inactivated serum samples from patients and non-patients were tested, and the results were as follows: Figure 9 As shown in (AB), a significantly higher Cy5 fluorescence signal was observed in patient serum samples compared to non-patient serum samples, while there was no statistically significant difference between non-patient serum samples and the control group. This further confirms the effectiveness of the detection method of the present invention in detecting actual samples.

[0064] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A single molecule biosensing platform, characterized in that, The single-molecule biosensing platform comprises synthesis of a multi-fluorophore nucleic acid probe, connection of a magnetic bead complex, target strand displacement reaction and single-molecule fluorescence localization imaging.

2. The single molecule biosensing platform of claim 1, wherein, The synthesis of the multi-fluorophore nucleic acid probe comprises the following steps: S1, preparation of double-stranded DNA: 10 μL of 10×PCR Buffer, 0.2 μL of dATP (100 mM), 0.2 μL of dGTP (100 mM), 0.2 μL of dCTP (100 mM), 0.2 μL of 5-EdUTP (100 mM), 1 μL of a forward primer, 1 μL of a reverse primer, 0.2 μL of a template, 1 μL of Taq DNA polymerase are added into an EP tube, and finally DEPC water is added to 100 μL, and after mixing, PCR amplification reaction is performed, and the amplification product is purified by ethanol precipitation; S2, Lambda exonuclease is added into the amplification product, and DNA double strands are digested at 37℃ for 50 min and at 75℃ for 10 min, and then purified by ethanol precipitation to obtain single-stranded DNA; S3, 200 pmol of single-stranded DNA was added with 0.2 μL of 10 mM Cy5-N3, 10 μL of 10 mM Cu + The catalytic solution, 10 μL of 100 mM phosphate buffer, and water were added to a final volume of 100 μL, and the mixture was reacted at 37°C in a metal bath for 50 min. After purification by ethanol precipitation, the multi-fluorescent nucleic acid probe was obtained.

3. The single molecule biosensor platform of claim 2, wherein, The nucleotide sequences of the forward primer, the reverse primer and the template in step S1 are shown in the sequence table SEQ ID NO. 1-3.

4. The single molecule biosensor platform of claim 2, wherein, The PCR reaction process in step S1 is 40 cycles of 95℃ for 30 s, 55℃ for 30 s, 72℃ for 15 s, and finally 72℃ for 5 min to complete amplification.

5. The single molecule biosensing platform of claim 1, wherein, The connection process of the magnetic bead complex comprises: 5' end capture probe connected with biotin, the multi-fluorophore nucleic acid probe of claim 2 and 5 μL of Binding Buffer I (10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 2 M NaCl, 0.1% Tween-20) are added into a 10 μL reaction system, and the reaction is carried out at room temperature in the dark for 1 h to form a reporter unit solution; After 20 μL of streptavidin magnetic bead suspension (10 mg / mL) is washed with 1×TBS for 3 times, it is resuspended with 2 times the volume of Binding Buffer I, and then 10 μL of the reporter unit solution is added, and the reaction is carried out at room temperature in the dark for 30 min, then the unconnected reporter unit is washed away, and then 40 μL of Binding Buffer I is added to resuspend to obtain a magnetic bead complex solution.

6. The single molecule biosensing platform of claim 1, wherein, The process of the target strand displacement reaction is as follows: different concentrations of target DNA and DEPC water are added into 10 μL of the magnetic bead complex to a final volume of 20 μL, and the reaction is carried out at room temperature in the dark for 40 min on a rotating mixer; and after magnetic separation for 1 min, the supernatant of the strand displacement reaction is obtained.

7. The single molecule biosensing platform of claim 1, wherein, The process of the single-molecule fluorescence localization imaging comprises: taking a STORM image on a customized Olympus ix-73 total internal reflection fluorescence (TIRF) microscope, the excitation light is 640 nm, ×60 1.45 NA oil immersion objective, STORM imaging is carried out in an imaging buffer, five-point sampling method is used to select five regions for each sample, 1000 frames of image are taken for each region, ImageJ software is used to construct the STORM image and carry out localization and counting; The imaging buffer comprises: 50 mM Tris pH 8.0, 50 mM NaCl, 5 mM MgCl, 1400 AU catalase, 168 AU glucose oxidase, 10% w / v glucose and 1% v / v β-mercaptoethanol.

8. The single-molecule biosensing platform of claim 1 is used for detecting Tsutsugamushi Orientia DNA.

9. Use according to claim 8, characterized in that, The Tsutsugamushi Orientia DNA is a 50 bp conserved sequence in a 47KDa gene of Tsutsugamushi Orientia; the conserved sequence is shown in the nucleotide sequence of SEQ ID NO. 6.

Images