Specific marker of gins / ndrg4 intergenic dna insertion variation in oplegnathus fasciatus, detection method and application
By designing nucleotide sequences that specifically mark the intergenic region of the gins/ndrg4 gene in striped rock seabream, and using PCR amplification and agarose gel electrophoresis, the problem of sex identification in striped rock seabream was solved, enabling rapid and accurate sex identification and improving breeding efficiency.
Patent Information
- Application Number
- CN202610194848.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-11
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2046-02-11
AI Technical Summary
Current technology cannot efficiently and accurately identify the sex of striped rock seabream, especially in the juvenile stage where phenotypic selection is difficult, resulting in low efficiency in genetic breeding.
By designing specific marker nucleotide sequences for the intergenic region of the gins/ndrg4 gene in the striped rock seabream, and using PCR amplification and agarose gel electrophoresis, DNA insertion variations in the intergenic region of the gins/ndrg4 gene were distinguished between male and female individuals. Primers Chgins/ndrg4_F:1 and Chgins/ndrg4_R:2 were designed for rapid identification.
This technology enables rapid and accurate identification of the genetic sex of striped rock seabream, improving the genetic breeding process and the production efficiency of high-quality seedlings, shortening the identification time, and increasing testing efficiency.
Smart Images

Figure CN121674547B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology technology, specifically to the specific markers, detection methods, and applications of DNA insertion variations in the intergenic region of the gins / ndrg4 gene of the striped seabream. Background Technology
[0002] The striped rockfish, belonging to the family Rhynchidae, is a newly emerging superior species for marine cage and factory aquaculture in my country. Research has revealed that the male possesses an aberrant Y chromosome, formed by the fusion of broken autosomes, exhibiting an X1X2Y sex determination type—a first-time discovery among Chinese fish species. Due to the significant growth advantage of males and their high market value, breeding all-male fry through genetic means is an urgent need for industry development. However, the sex determination mechanism in fish is complex, making sex identification difficult in juveniles, and relying on phenotypic selection is inefficient and unreliable. Therefore, it is essential to elucidate the sex determination mechanism at the genomic level, develop genetically sex-specific molecular markers linked to the Y chromosome, and establish efficient and accurate early identification methods. This will provide core technological support for sex-controlled breeding, ensuring seed industry security and industrial competitiveness.
[0003] GINS3 (GINS complex subunit 3) is a key subunit of the GINS heterotetramer, forming the CMG complex (Cdc45-MCM-GINS) with Psf1, Psf2, Psf4, and the MCM complex, driving DNA replication fork unwinding. This gene is active in the S phase, maintaining genome stability and has become a key molecule for studying replication stress and cancer targets. NDRG4 (N-Myc downstream regulatory gene 4) belongs to the NDRG family and is essential in astrocyte cell cycle regulation, protecting neurons in the brain and regulating myocardial proliferation in the heart. The epigenetic regulation of this multifunctional protein holds great potential in tumor diagnosis and treatment, making it a noteworthy molecule. To date, there are no reports of using DNA insertion variations in the GINS / NDRG4 intergenic region for the genetic identification of male and female striped seabream. Summary of the Invention
[0004] The purpose of this invention is to overcome the shortcomings of existing techniques for detecting DNA insertion variations in the intergenic region of the Gins / ndrg4 gene in the striped seabream, and to provide specific markers, detection methods, and applications for DNA insertion variations in the intergenic region of the Gins / ndrg4 gene in the striped seabream.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] A specific marker for DNA insertion variation in the intergenic region of the gins / ndrg4 gene of the striped seabream is provided. The specific marker is the nucleotide sequence of the non-insertion and insertion specific markers of the DNA fragment in the intergenic region of the gins / ndrg4 gene of the striped seabream, and the sequence is shown in SEQ ID NO:1 and SEQ ID NO:2.
[0007] The nucleotide sequence shown in SEQ ID NO:1 of the intergenic DNA fragment of the gins / ndrg4 gene intergenic region of the striped rock sea bream is a homologous fragment of the gins / ndrg4 gene intergenic region shared by the X1 chromosomes of both male and female striped rock sea bream that has not undergone DNA insertion variation.
[0008] The nucleotide sequence SEQ ID NO:2 represents DNA insertion fragments (402 bp) at positions 187 and 188, deletion fragments (3 bp) at positions 218 and 220, and insertion fragments (2 bp) at positions 267 and 268 in the intergenic region of the striped seabream gins / ndrg4 gene.
[0009] The application of a specific marker for DNA insertion variation in the intergenic region of the gins / ndrg4 gene of the striped rock seabream, and the application of the specific marker in detecting the genetic sex of male and female striped rock seabream.
[0010] A method for identifying the genetic sex of male and female striped rockfish using the specific markers described above involves taking the striped rockfish to be tested and extracting genomic DNA; using the obtained genomic DNA as a template, performing PCR amplification using specific primers for the intergenic region of the striped rockfish gins / ndrg4 gene; comparing the obtained PCR amplification products with the non-insertion and insertion specific markers of the striped rockfish gins / ndrg4 intergenic region DNA fragments, and thus distinguishing the genetic sex of the striped rockfish to be tested by amplifying the fragments.
[0011] The specific primer is
[0012] Ch gins / ndrg4 _F:1 : 5'-TATGAAGCATCGAAGCTCCATTT-3';
[0013] Ch gins / ndrg4 _R:2 : 5'-GCTCATTCAGGTGTTCTCATACA-3'.
[0014] The amplification of a single DNA fragment of only 392 bp indicates that the tested striped rock seabream is an individual in which no DNA fragment insertion mutation has occurred in the intergenic region of the gins / ndrg4 gene; this individual is female X1X1X2X2;
[0015] Two DNA fragments, 392bp and 793bp, were amplified, which determined that the tested striped rock seabream was an individual with a DNA fragment insertion mutation in the intergenic region of the gins / ndrg4 gene; the individual was male X1X2Y.
[0016] Advantages of this invention:
[0017] This invention identifies a large DNA sequence insertion in the intergenic region of the gins / ndrg4 gene on the fusion chromosome Y of male striped rockfish compared to the intergenic region of the gins / ndrg4 gene on the homologous chromosome X of female striped rockfish. This allows for efficient, rapid, and accurate identification of whether DNA fragment insertion variation has occurred in the intergenic region of the gins / ndrg4 gene in striped rockfish. This discovery is of great significance and application value for revealing the regulation of DNA replication and neuronal development in male and female striped rockfish, achieving rapid identification of the genetic sex of males and females, and improving the genetic breeding process and large-scale production of high-quality seedlings in striped rockfish.
[0018] This invention screened and obtained homologous regions with large DNA insertion marker sequences in the intergenic region of the Gins / ndrg4 gene on the X and Y chromosomes of *Synostemma pentaphyllum* from the whole genome sequence. Using these sequences, a rapid detection method for DNA insertion variations in the Gins / ndrg4 intergenic region of *Synostemma pentaphyllum* was established. This method can quickly, accurately, and efficiently identify whether DNA sequence insertion variations have occurred in the Gins / ndrg4 intergenic region of *Synostemma pentaphyllum*, and can be used to determine the genetic sex of the *Synostemma pentaphyllum*. The method uses a pair of primers to amplify two bands (793 bp and 392 bp, differing by 401 bp) in individuals with DNA sequence insertion variations in the Gins / ndrg4 intergenic region. In individuals without DNA fragment insertions in the Gins / ndrg4 intergenic region, only a single 392 bp band is amplified, which can be distinguished by agarose gel electrophoresis. This shortens the time for accurate identification of Gins / ndrg4 intergenic region variations in *Synostemma pentaphyllum* and improves detection efficiency. This study has significant implications and application value for the regulation of female and male DNA replication and neuronal development in striped rock seabream based on intergenic variation in the gins / ndrg4 gene region, as well as for sex identification, preparation of male seedlings, and family selection. Attached Figure Description
[0019] Figure 1 This invention provides an embodiment of the nucleotide sequence alignment diagram of the Y chromosome gins / ndrg4 intergenic region, the X chromosome gins / ndrg4 intergenic region, and the ChrX1 chromosome. The modules connected by the lines in the diagram represent highly homologous regions of the gins / ndrg4 intergenic region on the X and Y chromosomes, with the areas enclosed by diagonal lines on the left and right representing the target sequence ChrX1 of this invention. gins / ndrg4 and Chry gins / ndrg4 Location.
[0020] Figure 2 ChrX1 provided for embodiments of the present invention gins / ndrg4 and Chry gins / ndrg4 Specific location information on the X and Y chromosomes; 392bp represents ChrX1.gins / ndrg4 The length of the fragment, 793bp represents Chrys. gins / ndrg4 Length; Chry gins / ndrg4 The middle low region represents the inserted 401 bp nucleotide sequence, and this region is related to ChrX1. gins / ndrg4 The fragment has no homologous matching sequence.
[0021] Figure 3 The X chromosome ChrX1 obtained as provided in the embodiments of the present invention gins / ndrg4 ChrY with Y chromosome gins / ndrg4 Nucleotide sequence alignment diagram, with primer positions at both ends indicated by double black underlines; *: represents ChrX1 gins / ndrg4 and Chry gins / ndrg4 Sequence consistency: blank areas indicate sequences with inconsistent bases; -------: represents insertion or deletion sequences; black single underline represents the region where the insertion sequence is located.
[0022] Figure 4 The X chromosome ChrX1 provided in the embodiments of the present invention gins / ndrg4 ChrY with Y chromosome gins / ndrg4 A schematic diagram of DNA fragments with homologous insertions / deletions in nucleotide sequences; black areas represent homologous regions, blank areas represent deletion regions and site information, and gray areas represent insertion regions and site information.
[0023] Figure 5 The image shows the 1.5% agarose gel electrophoresis results of PCR products from male and female striped rockfish provided in this embodiment of the invention. M: DL 2000 DNA Maker; ♀: physiological female fish; ♂: physiological male fish. Individuals showing a single band (392bp) are genetically female, and their histological sex is determined to be female, as no DNA sequence insertion has occurred in the intergenic region of the gins / ndrg4 gene. Individuals showing two bands (793bp and 392bp) are genetically male, and their histological sex is determined to be male. Detailed Implementation
[0024] The following examples further illustrate specific embodiments of the present invention. It should be noted that the specific embodiments described herein are merely for illustration and explanation and are not intended to limit the scope of the present invention.
[0025] This invention first used third-generation PacBio whole-genome sequencing technology to complete the sequencing and assembly of the whole genomes of female and male striped rockfish, obtaining high-quality genomes at the chromosome level (SRP160016, SRP220007, Xiao et al., 2019, 2020). Comparative genomic bioinformatics analysis revealed a large DNA sequence insertion variation in the homologous gins / ndrg4 intergenic region on the Y chromosome of male striped rockfish, compared to the gins / ndrg4 intergenic region on the X1 chromosome of females. Figure 1 and Figure 2 The target regions for this study were selected from the 30,184,393bp~30,184,784bp region of the Gins / ndrg4 intergenic region on the X1 chromosome of female fish and the 29,981,790bp~29,982,582bp region of the Y chromosome of male fish that is homologous to the Gins / ndrg4 gene and contains DNA sequence insertions. Figure 1 The DNA fragment on chromosome X1 is 392 bp in length and is named ChrX1. gins / ndrg4 Its sequence is X gins / ndrg4 The bases in ID No:1 are shown in SEQ ID NO:1; the DNA fragment on the Y chromosome is 793 bp in length and contains a homologous sequence to the intergenic region of gins / ndrg4 on the X1 chromosome, named ChrY. gins / ndrg4 Its sequence is Y gins / ndrg4 The bases in ID No:2 are as shown in SEQ ID NO:2; Chry gins / ndrg4 With ChrX1 gins / ndrg4 Homologous sequence alignment revealed that it was related to ChrX1 gins / ndrg4r Three DNA sequence insertions and deletions were found between positions 187 and 188 (402 bp insertion), positions 218 and 220 (3 bp deletion), and positions 267 and 268 (2 bp insertion), with a total size of 401 bp. Figure 3 and Figure 4 In the male Y chromosome, the intergenic region of the gins / ndrg4 gene sequence (30,382,543 bp to 30,383,973 bp) contains a 401 bp DNA sequence inserted into the homologous region of the gins / ndrg4 intergenic region compared to the female X1 chromosome. This fragment serves as a DNA marker for detecting DNA insertion variation in the gins / ndrg4 intergenic region of the striped rock snapper. Furthermore, because this marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics, this fragment is also a DNA marker unique to the male Y chromosome of the striped rock snapper. gins / ndrg4 These are DNA markers shared by males and females of the striped rock seabream to indicate their genetic sex.
[0026] This invention uses a long DNA insertion sequence marker found at positions 30,382,543bp~30,383,973bp in the intergenic region of the Gins / ndrg4 gene on the Y chromosome of male striped rockfish to determine whether a DNA insertion variation has occurred in the Gins / ndrg4 gene region. This difference is then used for the rapid identification of the genetic sex of striped rockfish. Specifically, the detection method involves determining whether the striped rockfish to be tested has a Y chromosome. gins / ndrg4 The nucleotide fragment (793 bp) of ID No:2 was rapidly identified using PCR primers. This invention is based on comparative analysis of the intergenic region sequence of the gins / ndrg4 gene on the Y chromosome of the striped rock seabream and homologous gene sequences on chromosomes X1 and X2, identifying the intergenic region X on chromosome X1. gins / ndrg4 The Y chromosome with a nucleotide sequence homologous to ID No:1 gins / ndrg4 Based on the nucleotide sequence ID No:2, and utilizing the characteristic of a large insertion of DNA fragments in the homologous region of the aforementioned gins / ndrg4 gene intergenic region on the Y chromosome of the striped rockfish, two primers were designed. The PCR products were detected by 1.5% agarose gel electrophoresis to quickly determine whether DNA fragment insertion variation had occurred in the gins / ndrg4 gene intergenic region of the tested striped rockfish. Simultaneously, utilizing the fact that this marker is located on the male Y chromosome and has a male-linked inheritance characteristic, it can be applied to the accurate identification of the genetic sex of the striped rockfish. The upstream and downstream primer sequences are as follows:
[0027] Ch gins / ndrg4 _F:1 : 5'-TATGAAGCATCGAAGCTCCATTT-3'(X gins / ndrg4 ID No:2)(SEQ IDNO:3;
[0028] Ch gins / ndrg4 _R:2 : 5'-GCTCATTCAGGTGTTCTCATACA-3'(X gins / ndrg4 ID No:3 (SEQ IDNO:4).
[0029] The steps for identifying DNA insertion mutations in the intergenic region of the Gins / ndrg4 gene in *Syngonium ginsinense* using the primers described above mainly include: extracting high-quality whole-genome DNA from *Syngonium ginsinense*, amplifying specific marker DNA fragments of insertion mutations in the intergenic region of the Gins / ndrg4 gene on the Y chromosome, and detecting the DNA of the PCR products by agarose gel electrophoresis. Among them, two DNA fragments of 793bp and 392bp were amplified in the Y chromosome and X1 chromosome of male *Syngonium ginsinense* (X1X2Y), respectively. The 793bp fragment is a marker fragment specific to the intergenic region of the Gins / ndrg4 gene where DNA insertion mutations occurred. In contrast, only a single DNA fragment of 392bp was amplified in female *Syngonium ginsinense* (X1X1X2X2).
[0030] This invention is based on the whole genome sequencing of male and female striped rockfish and the localization and DNA sequence alignment analysis of the intergenic region of the gins / ndrg4 gene in male and female individuals. It was found that a long DNA fragment insertion variation occurred in the intergenic region of the gins / ndrg4 gene on the Y chromosome of male striped rockfish. This DNA fragment insertion variation is used as a unique DNA marker for the intergenic region of the gins / ndrg4 gene on the Y chromosome of striped rockfish. The sex of striped rockfish can be quickly identified by the DNA sequence insertion variation in the intergenic region of the gins / ndrg4 gene. This method can quickly, accurately and efficiently distinguish whether the tested striped rockfish has the sequence insertion variation in the intergenic region of the gins / ndrg4 gene. This method amplifies two bands, 793 bp and 392 bp, in individuals of the striped rockfish with DNA insertion in the Gins / ndrg4 intergenic region. The 793 bp band is the specific target band, while only a single band (392 bp) is amplified in individuals without DNA insertion in the Gins / ndrg4 intergenic region. These target bands can be rapidly and accurately distinguished using agarose gel electrophoresis, enabling rapid identification of whether DNA sequence insertion has occurred in the Gins / ndrg4 intergenic region of the striped rockfish. Furthermore, since this specific target band (793 bp) is located on the male Y chromosome and exhibits male-linked inheritance characteristics, this fragment is also a DNA marker unique to the male Y chromosome of the striped rockfish, and can be used for rapid identification of the genetic sex of the striped rockfish.
[0031] Example 1: Screening and Validation of DNA Markers Specific to Intergenic Sequence Variations in the Gins / ndrg4 Gene of the Rockfish
[0032] Discovery of homologous regions between the gins / ndrg4 genes on the Y and X chromosomes of the striped rock seabream containing large insert target DNA sequences: The neo-Y chromosome DNA sequences from male fish and the X1 chromosome DNA sequences from female fish were obtained from the research team of Li Jun at the Marine Fish Culture and Breeding Technology Laboratory, Institute of Oceanology, Chinese Academy of Sciences. The team commissioned Wuhan Fraser Gene Information Co., Ltd. to complete the sequencing and assembly of the whole genomes of male and female striped rock seabream using third-generation PacBio whole-genome sequencing technology. The assembly results have been published (SRP160016, SRP220007, Xiao et al., 2019, 2020). Comparative genomic bioinformatics analysis of the male and female striped rock seabream genome sequences shows (see...). Figure 1 and Figure 2 The intergenic region of the gins / ndrg4 gene on the heteromorphic Y chromosome of the male striped rock snapper is homologous to the intergenic region of the gins / ndrg4 gene on the X1 chromosome of the female striped rock snapper, and a large DNA insertion fragment is present. The target DNA fragment in the intergenic region of the gins / ndrg4 gene on the X1 chromosome is 392 bp in length and is named ChrX1.gins / ndrg4 Its sequence is SEQ ID NO:1:
[0033] TATGAAGCATCGAAGCTCCATTTAAAGACCTTTCAGTTTAATGACCTGACAGCATGAGAAGACTGAAGATATACCAGTACAGTTCATATACGTGTTAAGCATTTTCATTACATACTTTTCTTTTTGCATGTGGATTTGGGATGTGCATAATAGTCACAAGTAAATGCAATTCCGATTCCATTTATTAAGGTTTGTG CAAATAATCATTAGTGAACTATAGTGACTCATTTTCAGTCAGCTGTTTACAGAGAATAGTGTTGTTGATAGACAAAACCTTCTGGTTAAAATAATTGAACACACAACGAGGTGTGAAGTGGAAGATTTCCACAGTGCAAAATAAGACTTCTCTCCACACTGAGCGTTATTTTCTTGTATGAGAACACCTGAATGAGC.
[0034] The target DNA fragment homologous to the intergenic region of the gins / ndrg4 gene on the heteromorphic Y chromosome of male fish is 793 bp in length, and it contains a sequence homologous to X1, named ChrY. gins / ndrg4 Its sequence is SEQ ID NO:2:
[0035] .
[0036] Whole genome scans of males and females, and localization and DNA sequence alignment analysis of the intergenic region of the gins / ndrg4 gene in both individuals, showed that it corresponds to the ChrX1 segment located in the intergenic region of the gins / ndrg4 gene on chromosome X1. gins / ndrg4 homologous Chrys gins / ndrg4 Three DNA sequence insertions and deletions occurred on the Y chromosome, corresponding to ChrX1. gins / ndrg4Three DNA sequence insertions and deletions were found between positions 187 and 188 (402 bp insertion), positions 218 and 220 (3 bp deletion), and positions 267 and 268 (2 bp insertion), with a total insertion and deletion size of 401 bp. Figure 4 The target region between the Gins / ndrg4 genes on the Y chromosome (ChrY). gins / ndrg4 DNA sequence ratio with homologous DNA regions of chromosome X1 (ChrX1) gins / ndrg4 A 401bp DNA sequence was inserted, and this fragment is a unique DNA marker for the intergenic insertion variation in the gins / ndrg4 gene region of the striped rock seabream. Its presence or absence can be used to identify whether a DNA sequence insertion variation has occurred in the gins / ndrg4 gene region. Furthermore, because this marker is located on the male Y chromosome, it exhibits male-linked inheritance characteristics; therefore, ChrY... gins / ndrg4 This fragment is also a DNA marker unique to the Y chromosome of male striped rockfish, and ChrX1 gins / ndrg4 These are DNA markers shared by males and females of the striped rock seabream, such as... Figure 3 and Figure 4 As shown.
[0037] Sequence verification of DNA markers specific to the intergenic region sequence variation of the gins / ndrg4 gene: Based on the nucleotide sequence characteristics of SEQ ID NO:2 of the gins / ndrg4 intergenic region on the Y chromosome and the homologous gene SEQ ID NO:1 on the X1 chromosome, two primers were designed ( Figure 4 Selected female and male striped rock seabream of known physiological sex and extracted high-quality DNA from them, while using Ch... gins / ndrg4 _F:1、Ch gins / ndrg4 PCR amplification was performed using two primers, _R:2. The reaction conditions and procedure were as follows: The PCR reaction system was 20 µL, including 5.8 µL of 10× Buffer; 4.0 µL of dNTPs (2.5 mmol / L); 0.2 µL of rTaq enzyme (5 U / µL); and Ch... gins / ndrg4 _F:1 0.4µL; Ch gins / ndrg4_R: 2 0.4 µL; DNA template 2.0 µL, 7.2 µL ddH2O; mix and centrifuge. Touch-down PCR amplification program: 94℃ 3 mins, 61℃ (-1℃, 3 cycles) 1 min, 72℃ 1 min 30 s, 3 cycles; 94℃ 30 s, 58℃ 1 min, 72℃ 1 min 30 s, 30 cycles; 72℃ 10 min, store at 15℃. PCR products were analyzed by 1.5% agarose gel electrophoresis, which revealed differences between individuals in the intergenic region of the Gins / ndrg4 gene with and without inserted DNA fragments. The differentially expressed fragments of the Gins / ndrg4 gene region between inserted and non-inserted DNA sequences were recovered from the gel and transformed into competent cells using the PMD18-T vector. Positive clones were selected and sent to Qingdao Paisennuo Gene Biotechnology Co., Ltd. for sequencing. Sequencing results confirmed that the intergenic region between the homologous gins / ndrg4 genes on the X and Y chromosomes of the striped rock seabream contained a large inserted target DNA sequence fragment, such as... Figure 2 and Figure 3 As shown.
[0038] Example 2: Establishment and Application of DNA Fragment Insertion Variation Identification Technology in the Intergenic Region of the Gins / ndrg4 Gene of the Rockfish
[0039] Genetic identification was performed on striped rock seabream (12 of which were female and 12 were male) raised by Haihe Aquatic Seedling Co., Ltd. in Wendeng District, Weihai City, Shandong Province:
[0040] High-quality DNA extraction: DNA was extracted from the fin rays of the striped rock seabream using the Tiangen Marine Animal DNA Extraction Kit. The integrity of the genomic DNA was identified by 1.0% agarose gel electrophoresis. The OD value of the DNA supernatant was measured using a UV spectrophotometer. The DNA concentration was adjusted to 60 ng / µL and stored at -20℃ for later use.
[0041] PCR reaction system and PCR amplification identification: Primers specific to the large sequence variation in the intergenic region of the *Gynos gins* / ndrg4 gene were used. gins / ndrg4 _F:1 and Ch gins / ndrg4 _R:2 Insertion mutations in the intergenic DNA region of the *Gins / ndrg4* gene in *Sinocyclocheilus spp.* were detected by PCR. The PCR reaction mixture (20 µL) consisted of: 5.8 µL of 10×Buffer, 4.0 µL of dNTPs, 0.2 µL of rTaq enzyme (5 U / µL), and forward and reverse primers (Ch...). gins / ndrg4 _F:1 and Ch gins / ndrg4_R:2) 0.4µL each, DNA template 2.0µL, ddH2O 7.2µL. Touch-down PCR amplification program: 94℃ 3mins, 61℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 58℃ 1min, 72℃ 1min30s, 30 cycles; 72℃ 10min, 15℃ storage. Add 10×Loading Buffer 2.0µL to each PCR sample to be tested, and perform 1.5% agarose gel electrophoresis at a constant voltage of 110V for 30 minutes. Gel imaging can clearly distinguish individuals with DNA insertion and non-insertion variants in the intergenic region of the gins / ndrg4 gene of the striped rock seabream (see [link to relevant documentation]). Figure 5 ).
[0042] Depend on Figure 5 It is evident that two target bands (793bp and 392bp) are amplified in striped rock seabream individuals with DNA insertion in the gins / ndrg4 intergenic region. The 793bp band is the ChrY band, which is the specific target band for DNA fragment insertion in the gins / ndrg4 intergenic region. gins / ndrg4 In individuals where DNA fragment insertion into the Gins / ndrg4 intergenic region did not occur, only a single band of ChrX1 could be amplified. gins / ndrg4 (392bp). Due to ChrY gins / ndrg4 The marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics; therefore, ChrY... gins / ndrg4 This fragment is also a DNA marker unique to the Y chromosome of male striped rockfish, and ChrX1 gins / ndrg4 This method identifies the shared DNA characteristics of male and female striped rockfish, allowing for the differentiation of selected striped rockfish. The method of this invention can not only quickly, accurately, and efficiently identify whether DNA fragment insertion variations have occurred in the intergenic region of the gins / ndrg4 gene in the striped rockfish to be tested, but also has important significance and application value in the study of female and male DNA replication and neuronal development in the intergenic region of the gins / ndrg4 gene, as well as in sex identification, high-male seedling preparation, and family breeding of striped rockfish.
Claims
1. A specific molecular marker for sex identification of striped seabream, characterized in that: The specific molecular markers are DNA fragments with nucleotide sequences as shown in SEQ ID NO:1 and DNA fragments with nucleotide sequences as shown in SEQ ID NO:
2.
2. The application of the specific molecular marker according to claim 1 in detecting the genetic sex of striped rock seabream, characterized in that: Specifically Genomic DNA was extracted from striped rock seabream and used as a template for PCR amplification. The primers are Ch gins / ndrg4 _F:1 : 5’-TATGAAGCATCGAAGCTCCATTT-3’; Ch gins / ndrg4 _R:2 : 5’-GCTCATTCAGGTGTTCTCATACA-3’; A single DNA fragment of only 392 bp was amplified, which determined that the striped rock seabream being tested was female; Two DNA fragments, 392bp and 793bp, were amplified, which determined that the striped rock seabream being tested was male.
3. A method for identifying the genetic sex of striped rock seabream using the specific molecular markers described in claim 1, characterized in that, Genomic DNA was extracted from the striped rock seabream to be tested. Using the obtained genomic DNA as a template, PCR amplification was performed using primers. The obtained PCR amplification product was compared with the specific molecular marker described in claim 1. The genetic sex of the striped rock seabream to be tested was then distinguished by the amplified fragment. The primers are Ch gins / ndrg4 _F:1 : 5’-TATGAAGCATCGAAGCTCCATTT-3’; Ch gins / ndrg4 _R:2 : 5’-GCTCATTCAGGTGTTCTCATACA-3’; A single DNA fragment of only 392 bp was amplified, which determined that the striped rock seabream being tested was female; Two DNA fragments, 392bp and 793bp, were amplified, which determined that the striped rock seabream being tested was male.
Citation Information
Patent Citations
Specific marker, primer, identification method and kit for detecting intergene region insertion variation of oplegnathus fasciatus and application of specific marker, primer, identification method and kit
CN117947182A
Specific marker, primer, identification method and kit for detecting intron region insertion variation of oplegnathus striatus gene and application of specific marker, primer, identification method and kit
CN117947184A