Absolute quantitative detection kit for AmoA gene of nitrospirillum
By designing specific primers NimoA_F and NimoA_R and combining them with real-time PCR technology, the problem of low detection efficiency of the amoA gene in Nitrostrophus genus was solved, achieving high-efficiency amplification and quantitative detection with an amplification efficiency of up to 96.78%.
Patent Information
- Application Number
- CN202411291197.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-14
- Publication Date
- 2026-03-17
AI Technical Summary
The lack of efficient quantitative detection methods for amplifying the amoA gene of Nitrostrophus in existing technologies leads to low detection efficiency.
This invention provides primers and a kit for efficiently amplifying the amoA gene of Nitrostrophus, using real-time PCR technology with specific primers NimoA_F and NimoA_R, and detection using SYBR Green I Mix.
It achieves efficient amplification and absolute quantitative detection of the amoA gene of Nitrostrophus, with clear amplification curves and reasonable CT value ranges, suitable for quantitative PCR experiments, and amplification efficiency of up to 96.78%.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This application belongs to the field of biological detection technology, and in particular relates to an absolute quantitative detection method, primers and kit for the amoA gene of Nitrostrophus. Background Technology
[0002] *Nitrosospira* are Gram-negative bacteria whose individual cells typically present as spirochetes. They obtain energy through nitrification, specifically by utilizing ammonia nitrogen and oxygen to produce nitrite and water, making them typical chemoautotrophic bacteria. Research on *Nitrosospira* contributes to a deeper understanding of the microbial mechanisms of the nitrogen cycle, providing scientific evidence for environmental protection, agricultural production, and ecological restoration. *Nitrosospira* also has potential applications in wastewater treatment and biological denitrification. By optimizing culture conditions and enhancing their activity, wastewater treatment efficiency can be improved and treatment costs reduced.
[0003] The amoA gene encodes the α subunit of ammonia monooxygenase, a key enzyme in the ammonia oxidation process. Quantitative analysis of the amoA gene content in the genomic DNA of *Nitrostrophus* using qPCR can assess the abundance of *Nitrostrophus* microorganisms under different environmental conditions. In conclusion, the amoA gene is an important tool in the study of *Nitrostrophus* microorganisms.
[0004] The advantages of quantitative real-time PCR analysis are mainly reflected in its ease of operation, speed, and high accuracy. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a primer and kit for the absolute quantitative detection of the amoA gene of Nitrostrophus spp. in order to overcome the shortcomings of the prior art, and at the same time provide a method for the absolute quantitative detection of the amoA gene of Nitrostrophus spp.
[0006] The technical solution adopted by this invention to solve its technical problem is: A primer for the absolute quantitative detection of the amoA gene of *Nitrosporium* spp., which is highly efficient, has the following sequence: NimoA_F:AACATGAGCATGGAGACGAA NimoA_R:TGACTACACCGGCTTCCTG The present invention also provides an absolute quantitative detection kit for the amoA gene of Nitrostrophus, comprising the above-mentioned detection primers, SYBR Green I Mix (Jiangsu Weiqing Biotechnology) and standards.
[0007] This invention also provides an application of high-efficiency primers for the absolute quantitative detection of the amoA gene of Nitrostrophus in soil.
[0008] This invention also provides an absolute quantitative detection method for the amoA gene of *Nitrostrophus*, comprising the following steps: Genomic DNA of *Nitrosporium* was extracted to obtain the sample to be tested; The primers described in claim 2 were used to perform a fluorescence quantitative PCR amplification reaction on the sample to be tested. The amplification products were then detected.
[0009] Preferably, the quantitative PCR amplification reaction system for the absolute quantitative detection method of the *Nitrostrophus* spp. *amoA* gene of the present invention is as follows: qPCR Mix: 10 μL Primer_F+R: 1ul DNA template: 0.5 μl Add water to 20 µL.
[0010] Preferably, the method for absolute quantitative detection of the amoA gene of Nitrostrophus genus of the present invention is used, wherein the Nitrostrophus genus is derived from soil.
[0011] Preferably, the absolute quantitative detection method for the amoA gene of *Nitrostrophus* of the present invention includes the following PCR amplification reaction steps: Pre-denaturation: temperature 95℃, time 5 min, cycle number 1; Denaturation: 95℃ for 10 seconds; Annealing extension: 40 seconds at 60°C, 40 cycles; Melting curve acquisition: 15 sec at 95℃, 60 sec at 60℃, 30 sec at 95℃, 15 sec at 60℃, for a total of 1 cycle.
[0012] The beneficial effects of this invention are: (1). The primers for absolute quantitative detection of the amoA gene of Nitrostrophus in this application showed an S-shaped amplification curve, which was normal. The melting curve showed a single peak, indicating that the amplification product was singular and there was no non-specific amplification.
[0013] (2). The CT value of the primers for absolute quantitative detection of the amoA gene of Nitrostrophus in this application is between 26 and 30, which is a reasonable range and suitable for quantitative PCR experiments.
[0014] (3). Through comparison with NCBI and the construction of the BLAST database, it was found that this primer can amplify more of the amoA gene of Nitrostrophus. Attached Figure Description
[0015] The technical solution of this application will be further described below with reference to the accompanying drawings and embodiments.
[0016] Figure 1 This is the amplification curve of the primers for absolute quantitative detection of the amoA gene of Nitrostrophus in this application embodiment; Figure 2 This is the melting curve of the primers for absolute quantitative detection of the amoA gene of Nitrostrophus in this application embodiment; Figure 3 This is the standard curve of the primers for absolute quantitative detection of the amoA gene of Nitrostrophus in this application. Detailed Implementation
[0017] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. Example
[0018] This embodiment provides a primer for the absolute quantitative detection of the amoA gene of *Nitrosporobacter* spp., which is highly efficient. The sequence of the primer is as follows: NimoA_F:AACATGAGCATGGAGACGAA NimoA_R:TGACTACACCGGCTTCCTG Example
[0019] This embodiment provides an absolute quantitative detection kit for the amoA gene of Nitrostrophus, including the detection primers as described in Example 1, SYBR Green I Mix (Jiangsu Weiqing Biotechnology), and standards. Example
[0020] This embodiment provides an application of high-efficiency primers for the absolute quantitative detection of the amoA gene of Nitrostrophus in soil. Example
[0021] This embodiment provides a method for absolute quantitative detection of the amoA gene in *Nitrostrophus*, including the following steps: S1: Genomic DNA was extracted from *Nitrostrophus* to obtain the sample to be tested; DNA was extracted using the Tiangen Soil Genomic DNA Extraction Kit (DP336).
[0022] S2: Perform qPCR amplification reaction on the sample to be tested using the kit described in Example 2; The quantitative PCR amplification reaction system is as follows: qPCR Mix: 10 μL Primer_F+R: 1ul DNA template: 0.5 μl Add water to 20 µL.
[0023] S3: Detect the PCR amplification products.
[0024] The PCR amplification reaction steps are as follows: Pre-denaturation: temperature 95℃, time 5 min, cycle number 1; Denaturation: 95°C for 10 seconds; Annealing extension: 40 seconds at 60°C, 40 cycles; Melting curve acquisition: 15 sec at 95℃, 60 sec at 60℃, 30 sec at 95℃, 15 sec at 60℃, for a total of 1 cycle. Example
[0025] 1. Material preparation: Genomic DNA of Nitrostrophus genus was extracted from the soil using the Tiangen Soil Genomic DNA Extraction Kit (DP336). The DNA was collected by elution, approximately 80 μL, and 10 μL was diluted to 300 μL for detection.
[0026] 2. Construction of Standards: Standards were constructed using gene synthesis, with the sequence: AACATGAGCATGGAGACGAAGGCGGCAAAGAATGAGGCGATGACGGTGGTGTGGCCGCCAAAGGTTCTGAGTGAGCCTTGTTCGATGTTGCGTACGTACTCGGGGGTGCCGGTGCGAACGTACAGGAAGCCGGTGTAGTCA, which was used to calculate amplification efficiency.
[0027] 3. Primer design for the soil sulfur metabolism gene AmoA: First, the amoA gene sequence of *Nitrosporium* was downloaded from NCBI, and a large number of primers were designed using Primer3 software. Second, a local prime blast database was constructed using the downloaded sequence, and all primers were subjected to local prime blast to screen for primers that could amplify more of the amoA gene. Finally, the obtained primers were primed on NCBI to select primers that could amplify more of the amoA gene, and which were mostly from the *Nitrosporium* genus. Specific primer information is as follows: Primer Name Primer Sequence (5' -> 3') Product Length NimoA_F:AACATGAGCATGGAGACGAA 141bp NimoA_R:TGACTACACCGGCTTCCTG 4. Quantitative PCR amplification reaction system (SYBR Green I Jiangsu Weiqing Biotechnology): qPCR Mix: 10 μL Primer_F+R: 1ul DNA template: 0.5 μl Add water to 20 µL.
[0028] Quantitative PCR reaction steps: Pre-denaturation: temperature 95℃, time 5 min, cycle number 1; Denaturation: 95°C for 10 seconds; Annealing extension: 40 seconds at 60°C, 40 cycles; Melting curve acquisition: 15 sec at 95℃, 60 sec at 60℃, 30 sec at 95℃, 15 sec at 60℃, for a total of 1 cycle.
[0029] 5. After dissolving the standard prepared in step two, perform a 10-fold serial dilution, fit a standard curve, and calculate the amplification efficiency. The standard curve equation for this primer is: Y = -3.4013X + 37.4531. Figure 3 As shown, R² is 0.9999, and the amplification efficiency is 96.78%.
[0030] 6. Sample testing and verification: Using the DNA extracted in the first step as a template, the amplification of the primers was tested. The CT value of this sample was between 26 and 30, and the calculated copy number of the *Nitrosporium* spp. *amoA* gene per gram of soil was approximately 10. 4 -10 7 Due to differences in soil pH, element content, and suitable bacterial living environments, the copy number may vary significantly between different soils.
[0031] Based on the above-described preferred embodiments according to this application, and through the foregoing description, those skilled in the art can make changes and modifications to the samples without departing from the technical concept of this application. The technical scope of this application is not limited to the contents of the specification, but must be determined according to the scope of the claims.
Claims
1. A highly efficient amplification of Nitrosospira amoA gene absolute quantitative detection primer, characterized in that, The sequence of the primer is: NimoA_F: AACATGAGCATGGAGACGAA NimoA_R: TGACTACACCGGCTTCCTG 2. A nitrosospira amoA gene absolute quantification detection kit, characterized in that, The detection primer as claimed in claim 1.
3. Application of the amplification absolute quantitative detection primer of Nitrosospira amoA gene in detecting Nitrosospira amoA gene in soil.
4. A method for absolute quantification of Nitrosospira amoA gene, characterized by, The method comprises the following steps: extracting Nitrosospira genome DNA to obtain a sample to be detected; performing a fluorescent quantitative PCR amplification reaction on the sample to be detected by using the primer as claimed in claim 2; detecting the amplification product.
5. The method according to claim 4, wherein the method is characterized by, The quantitative PCR amplification reaction system is as follows: qPCR Mix: 10ul, Primer_F+R: 1ul, DNA template: 0.5ul, and adding water to 20ul.
6. The method according to claim 4, wherein the method is characterized by, The PCR amplification reaction steps are as follows: pre-denaturation: temperature 95℃, time 5min, cycle number 1; denaturation: temperature 95℃, time 10sec; annealing and extension: temperature 60℃, time 40sec, cycle number 40; melting curve collection: temperature 95℃, time 15sec, temperature 60℃, time 60sec, temperature 95℃, time 30sec, temperature 60℃, time 15sec, cycle number 1.