A genetically engineered surfactin-producing bacterium and use thereof

By introducing the T7 promoter and overexpressing the long-chain fatty acid-coenzyme A ligase gene into Bacillus subtilis, the problem of insufficient surfactant production was solved, and efficient surfactant production was achieved, which is applicable to petrochemical, agricultural, food and cosmetic fields.

CN121699819BActive Publication Date: 2026-07-24SHANGHAI SENSAN BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI SENSAN BIOTECHNOLOGY CO LTD
Filing Date
2025-12-02
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively increase the yield of surfactants, especially in Bacillus subtilis, where heterologous cloning and expression of non-ribosomal peptide synthase gene clusters are difficult, resulting in insufficient yield.

Method used

The T7 promoter was used to drive the overexpression of the surfactant nonribosomal peptide synthesis gene cluster and the long-chain fatty acid-coenzyme A ligase gene lcfA. By integrating the expression cassette of T7 RNA polymerase, the T7 promoter was activated by xylose induction, thereby achieving efficient expression of surfactant synthase and the generation of precursor substances.

Benefits of technology

The yield of surfactant was increased by more than 17 times at the shake flask level, reaching 40.3 g/L in a 5 L fermenter, with a production intensity of 1.6 g/L/h, which significantly improved the production efficiency of surfactant.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121699819B_ABST
    Figure CN121699819B_ABST
Patent Text Reader

Abstract

The present application relates to the field of genetic engineering and bioengineering, and particularly relates to a genetically engineered surfactin-producing bacterium and application thereof.The genome of the genetically engineered bacterium comprises the following: an expression frame of T7 RNA polymerase; an expression frame of a surfactin synthesis gene cluster srfAABCD; and an expression frame of a long-chain fatty acid-coenzyme A ligase gene lcfA; the expression frame of the surfactin synthesis gene cluster srfAABCD and the expression frame of the long-chain fatty acid-coenzyme A ligase gene lcfA further comprise a T7 promoter.The present application realizes efficient synthesis of surfactin by Bacillus subtilis, and the final shake flask yield reaches more than 19.3 g / L, which has great industrial application potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and bioengineering technology, and in particular to a genetically engineered bacterium that produces surfactants and its uses. Background Technology

[0002] Surfactants are secondary metabolites produced by Bacillus microorganisms during metabolism and belong to the lipopeptide class of biosurfactants. Surfactants can reduce the surface tension of water, have good emulsifying properties, and also possess antibacterial and antiviral biological activities. Therefore, they have broad application potential in petrochemical, agricultural, food, and cosmetic fields.

[0003] Surfactants possess an amphiphilic structure, composed of β-hydroxy fatty acids linked to cyclic heptapeptides via lactone bonds. The typical amino acid sequence of the cyclic heptapeptide is L-Glu-L-Leu-D-Leu-L-Val-L-Asp-D-Leu-L-Leu. Surfactants are synthesized via non-ribosomal peptide synthases. The precursor synthesis of surfactants is tightly regulated, involving multiple reactions and regulatory factors. Various studies have explored different methods to enhance surfactant production. Enriching and culturing Bacillus from environments such as soil, organisms, and oilfield wastewater allows for the screening of naturally occurring high-yielding strains using plate confrontation culture or high-throughput screening methods. With the development of molecular biology, various metabolic engineering techniques have been developed to enhance surfactant production, such as global regulatory factor modification, promoter engineering of non-ribosomal peptide synthases, and enhancement of key genes in branched-chain amino acid and fatty acid pathways. Optimizing culture media and conditions, and adding exogenous precursor substances, can further increase yield.

[0004] Bacillus subtilis ATCC 21332 is a positive control bacterium for bacterial biotoxin assays and is known for its high natural production of surfactants. For a long time, various optimizations have been conducted based on ATCC 21332 to obtain strains with high surfactant production. For example, adding 25 g / L activated carbon as a solid-phase carrier to the fermentation broth resulted in a surfactant yield of 3600 mg / L. Supplementing the culture medium with ferrous ions increased surfactant production tenfold. Metabolic pathway modification further improved yield; enhancing nitrogen metabolism genes narG and narH and efflux genes secA, ftsY, and ftsE resulted in a shake-flask yield of 14.4 g / L in the optimized medium.

[0005] Surfactants are produced through the elongation and release of peptide chains via a non-ribosomal peptide synthesis pathway. Because the size of the non-ribosomal synthesis gene cluster is >27 kJ, existing genetic modification methods struggle with heterologous cloning. Therefore, the main modification method is to replace the srfA promoter using the artificially hybridized promoter Pg3, increasing surfactant production to 9.74 g / L. The T7 expression system is a commonly used and highly efficient expression system for *E. coli*, characterized by simple genetic manipulation, strict gene regulation, and high protein expression efficiency. It relies on T7 RNA polymerase and utilizes the potent phage T7 promoter to initiate efficient transcriptional expression. In recent years, the T7 expression system has also been applied to strains such as *Corynebacterium glutamicum* and *Bacillus subtilis*, achieving good results, but there are no reports of high surfactant production using the T7 promoter. Summary of the Invention

[0006] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a genetically engineered bacterium that produces surfactants and its uses, in order to solve the problems in the prior art.

[0007] To achieve the above and other related objectives, the present invention provides a genetically engineered bacterium that produces surfactant, the genome of which comprises the following: an expression cassette encoding T7 RNA polymerase; an expression cassette encoding the surfactant synthesis gene cluster srfAABCD; and an expression cassette encoding the long-chain fatty acid-coenzyme A ligase gene lcfA; the expression cassettes of the surfactant synthesis gene cluster srfAABCD and the long-chain fatty acid-coenzyme A ligase gene lcfA further comprising a T7 promoter.

[0008] The present invention also provides a method for constructing the genetically engineered bacteria described above, the method comprising: integrating a nucleic acid molecule encoding T7 RNA polymerase, a nucleic acid molecule encoding the T7 promoter and the surfactant synthesis gene cluster srfAABCD, and a nucleic acid molecule encoding the T7 promoter and the long-chain fatty acid-coenzyme A ligase gene lcfA into the genome of the starting strain.

[0009] The present invention also provides the use of the genetically engineered bacteria described above in the preparation of surfactants.

[0010] The present invention also provides a method for preparing a surfactant, comprising: inoculating the genetically engineered bacteria described above into a fermentation medium for fermentation, and inducing fermentation with xylose to obtain the surfactant.

[0011] As described above, the present invention provides a surfactant-producing genetically engineered bacterium and its uses, which have the following beneficial effects:

[0012] At the shake-flask level, the surfactant-producing genetically engineered bacteria of this invention achieves a surfactant yield of over 19.3 g / L in shake-flask fermentation, which is more than 17 times higher than the starting strain (Bacillus subtilis ATCC 6051a). In a 5 L fermenter with fed-batch fermentation, the yield reaches over 40.3 g / L, and the production intensity reaches over 1.6 g / L / h. The yield and production intensity are higher than the currently known fermentation levels, thus showing great potential for industrial application. Attached Figure Description

[0013] Figure 1 The diagram shows the construction process of the surfactant-producing genetically engineered bacteria 164SF0 and 164SF of the present invention.

[0014] Figure 2 The graph shows the results of surfactant production during shake-flask fermentation of Bacillus subtilis 164SF0, 164SF and the genetically engineered bacteria of Comparative Examples 1-4 according to the present invention.

[0015] Figure 3 The diagram shows the parameters of fed-bacterium subtilis 164SF fermentation in a 5 L bioreactor, as presented in this invention.

[0016] Figure 4 The diagram shows the parameters of fed-bacterial fermentation of Bacillus subtilis 164SF0 in a 5 L bioreactor according to the present invention. Detailed Implementation

[0017] Surfactants are cyclic lipopeptide bioactive substances synthesized from four amino acids (glutamic acid, aspartic acid, leucine, and valine) and β-hydroxy fatty acids as precursors via non-ribosomal polypeptide synthases (NRPS). Their biosynthesis mainly consists of three parts: (1) β-hydroxy fatty acid precursors are generated through glycolysis and fatty acid synthesis pathways, which are then activated by acyl-CoA ligase to form acyl-CoA; (2) the four amino acid precursors are synthesized de novo; (3) finally, acyl-CoA and the four amino acids are sequentially linked and cyclically formed under the catalysis of surfactant synthase SrfAABCD to form surfactant.

[0018] SrfAABCD is a multi-enzyme complex system composed of multiple modules. Encoding surfactant synthase, srfAABCD is a gene cluster of 27 kb containing four genes: srfAA, srfAB, srfAC, and srfAD. Its fragments are longer than 27 kb, and cloning large gene fragments is prone to instability such as recombination and deletion, affecting the normal function of surfactant synthesis-related genes. Insufficient expression of the synthase driven by the natural promoter limits yield.

[0019] This invention utilizes the superior performance of the T7 promoter to drive the overexpression of the surfactant non-ribosomal peptide synthesis gene cluster, and further overexpresses the long-chain fatty acid-coenzyme A ligase gene lcfA, improving the production efficiency of acyl-CoA, alleviating precursor limitations, and significantly increasing the surfactant yield of the genetically engineered bacteria, by approximately 16 times compared to the starting strain. Furthermore, overexpression of the long-chain fatty acid-coenzyme A ligase yhfL further significantly increases the surfactant yield of the genetically engineered bacteria, by more than 21 times compared to the starting strain. This invention provides a novel strategy for the biosynthesis of surfactant.

[0020] This invention provides a genetically engineered bacterium that produces surfactants, the genome of which includes the following;

[0021] Expression cassette encoding T7 RNA polymerase;

[0022] The expression cascade of the surfactant synthesis gene cluster srfAABCD; and

[0023] Expression cassette of the long-chain fatty acid-coenzyme A ligase gene lcfA;

[0024] The expression cassettes of the surfactant synthesis gene cluster srfAABCD and the long-chain fatty acid-coenzyme A ligase gene lcfA also contain the T7 promoter.

[0025] In the present invention, the genetically engineered bacteria producing surfactant undergoes xylose induction, which inactivates the xylose repressor protein encoding gene XylR, leading to the activation of the xylose promoter PxylA, which in turn activates the expression of T7 RNA polymerase. The T7 RNA polymerase binds to the T7 promoter, driving the expression of downstream genes srfAABCD and lcfA. Overexpression of lcfA results in an abundance of surfactant synthesis precursor (long-chain acyl-CoA), while srfAABCD efficiently synthesizes surfactant, synergistically leading to an exponential amplification of surfactant expression.

[0026] In some embodiments, the gene sequence of the T7 promoter comprises the sequence shown in SEQ ID NO: 1.

[0027] TAATACGACTCACTATAGG (SEQ ID NO: 1)

[0028] In some implementations, the T7 promoter is derived from a bacteriophage.

[0029] In some embodiments, the expression cassette of the T7 RNA polymerase includes, in sequence, a xylose repressor protein encoding gene sequence, a xylose promoter gene sequence, and a T7 RNA polymerase encoding gene sequence.

[0030] In some embodiments, the nucleotide sequence of the T7 RNA polymerase comprises the sequence shown in SEQ ID NO: 2, or a sequence that has more than 85% homology with SEQ ID NO: 2 and has the same function.

[0031] In some embodiments, the T7 RNA polymerase encoding gene sequence is integrated into the ganA site on the genome of the genetically engineered bacterium.

[0032] In some embodiments, the T7 RNA polymerase is derived from Escherichia coli.

[0033]

[0034] In some embodiments, the xylose repressor protein encoding gene sequence comprises the sequence shown in SEQ ID NO: 3, or a sequence that has more than 85% homology with SEQ ID NO: 3 and has the same function.

[0035] In some embodiments, the xylose repressor protein is derived from *Priestiamegaterium*.

[0036]

[0037] In some embodiments, the xylose promoter gene sequence comprises the sequence shown in SEQ ID NO: 4.

[0038] In some embodiments, the xylose promoter is derived from *Priestiamegaterium*.

[0039] tttttttaactaaagcttgatctgcaatttgaataataaccgctcctttgtttatctatcgaactaagttagtgttttatgaagcttgaattagatatttaaaagtatcatacctaatattataactaaattttct aaaaaaaacattgaaatagacatttattttgtatatgatgaaataaagttagtttattggataaacaaactaactttattaaggtagttgatggataaacttgttcacttaaatcaaagggggaaatgacaa (seq ID NO: 4)

[0040] In some embodiments, the expression cassette of the surfactant synthesis gene cluster srfAABCD includes a T7 promoter gene sequence and a surfactant synthesis gene cluster srfAABCD encoding gene sequence connected in sequence.

[0041] In some embodiments, the nucleotide sequence of the surfactant synthesis gene cluster srfAABCD comprises the sequence shown in SEQ ID NO: 5-7, or a sequence that has more than 85% homology with SEQ ID NO: 5-7 and has the same function.

[0042] In some embodiments, the expression cassette of the long-chain fatty acid-coenzyme A ligase gene lcfA includes a T7 promoter gene sequence and a long-chain fatty acid-coenzyme A ligase lcfA encoding gene sequence connected in sequence.

[0043] In some embodiments, the nucleotide sequence of the long-chain fatty acid-coenzyme A ligase gene lcfA comprises the sequence shown in SEQ ID NO: 8, or a sequence that has more than 85% homology with SEQ ID NO: 8 and has the same function.

[0044]

[0045] In some embodiments, the genetically engineered bacteria further includes an expression cassette of the long-chain fatty acid-coenzyme A ligase gene yhfL.

[0046] In some embodiments, the expression cassette of the long-chain fatty acid-coenzyme A ligase gene yhfL further includes the T7 promoter.

[0047] In some specific embodiments, the expression cassette of the long-chain fatty acid-coenzyme A ligase gene yhfL includes a T7 promoter gene sequence and a long-chain fatty acid-coenzyme A ligase lcfA encoding gene sequence connected in sequence.

[0048] In some more specific embodiments, the long-chain fatty acid-coenzyme A ligase yhfL encoding gene sequence comprises the sequence shown in SEQ ID NO: 9, or a sequence that has more than 85% homology with SEQ ID NO: 9 and has the same function.

[0049]

[0050] In some more specific embodiments, the long-chain fatty acid-coenzyme A ligase gene yhfL encoding gene sequence is integrated into the capA site on the genome of the genetically engineered bacterium.

[0051] In some embodiments, the starting strain of the genetically engineered bacteria is Bacillus subtilis.

[0052] In some embodiments, the Bacillus subtilis is selected from either Bacillus subtilis ATCC 6051a or Bacillus subtilis ATCC 21332.

[0053] The present invention also provides a method for constructing the genetically engineered bacteria described above, the method comprising: integrating a nucleic acid molecule encoding T7 RNA polymerase, a nucleic acid molecule encoding the T7 promoter and the surfactant synthesis gene cluster srfAABCD, and a nucleic acid molecule encoding the T7 promoter and the long-chain fatty acid-coenzyme A ligase gene lcfA into the genome of the starting strain.

[0054] In some embodiments, the starting strain of the genetically engineered bacterium is Bacillus subtilis. In some embodiments, the Bacillus subtilis is selected from either Bacillus subtilis ATCC 6051a or Bacillus subtilis ATCC 21332. Preferably, it is Bacillus subtilis ATCC 6051a.

[0055] In some embodiments, an expression cassette encoding T7 RNA polymerase is integrated via homologous recombination. The T7 RNA polymerase expression cassette comprises, in sequence, a xylose repressor gene sequence, a xylose promoter gene sequence, and a T7 RNA polymerase gene sequence.

[0056] In some specific embodiments, the expression cassette of the T7 RNA polymerase further includes an upstream homologous arm of ganA and a downstream homologous arm of ganA.

[0057] In some more specific embodiments, the expression cassette of the T7 RNA polymerase includes: an upstream homologous region of ganA from ATCC 6051a, an erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends, a xylose repressor protein encoding gene and a xylose promoter from *Priscilla megaterium*, a T7 RNA polymerase encoding gene from *Escherichia coli* BL21(DE3), and a downstream homologous region of ganA from ATCC 6051a. The sequence of the T7 RNA polymerase expression cassette includes that shown in SEQ ID NO: 10. In one specific embodiment, the expression cassette of the T7 RNA polymerase is transformed into the starting strain *Bacillus subtilis* ATCC 6051a to obtain *Bacillus subtilis* 164T7P. The transformation method includes, but is not limited to, the Spizizen transformation method.

[0058] In some embodiments, the expression cassette of the surfactant synthesis gene cluster srfAABCD is integrated by homologous recombination, wherein the expression cassette of the surfactant synthesis gene cluster srfAABCD comprises a T7 promoter gene sequence and the surfactant synthesis gene cluster srfAABCD connected in sequence.

[0059] In some embodiments, the expression cassette of the surfactant synthesis gene cluster srfAABCD further includes an upstream homologous arm of srfAABCD and a downstream homologous arm of srfAABCD.

[0060] In some specific embodiments, the expression cassette of the surfactant synthesis gene cluster srfAABCD (i.e., the T7-srfAA expression cassette) includes: an upstream homologous region of the srfAAB promoter region derived from ATCC 6051a, an erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends, and a downstream homologous region of the T7 promoter (PT7) derived from pET-28a(+) and a partial sequence of the srfAA derived from ATCC6051a. The nucleotide sequence of the T7-srfAA expression cassette includes that shown in SEQ ID NO: 11. In one specific embodiment, the expression cassette of the surfactant synthesis gene cluster srfAABCD is transformed into the aforementioned Bacillus subtilis 164T7P to obtain Bacillus subtilis 164T7Psrf. The transformation method includes, but is not limited to, the Spizizen transformation method.

[0061] In some embodiments, the expression cassette of the long-chain fatty acid-coenzyme A ligase gene lcfA is integrated by homologous recombination, wherein the expression cassette of the long-chain fatty acid-coenzyme A ligase gene lcfA includes a T7 promoter gene sequence and a long-chain fatty acid-coenzyme A ligase lcfA encoding gene sequence connected sequentially.

[0062] In some embodiments, the expression cassette of the long-chain fatty acid-coenzyme A ligase gene lcfA further includes an upstream homologous arm and a downstream homologous arm of lcfA.

[0063] In some specific embodiments, the expression cassette of the long-chain fatty acid-coenzyme A ligase gene lcfA (i.e., the T7-lcfA expression cassette) includes: an lcfA promoter region derived from ATCC 6051a as the upstream homologous region, an erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends, and a T7 promoter (PT7) derived from pET-28a(+) and a partial sequence of lcfA derived from ATCC6051a as the downstream homologous region. The nucleotide sequence of the T7-lcfA expression cassette includes that shown in SEQ ID NO: 12. In one specific embodiment, the T7-lcfA expression cassette is transformed into Bacillus subtilis 164T7Psrf as described above to obtain Bacillus subtilis 164SF0. The transformation method includes, but is not limited to, the Spizizen transformation method.

[0064] In some embodiments, the method also includes integrating a nucleic acid molecule encoding the T7 promoter and the long-chain fatty acid-coenzyme A ligase gene yhfL onto the starting strain.

[0065] In some embodiments, the expression cassette of the long-chain fatty acid-coenzyme A ligase gene yhfL is integrated by homologous recombination, wherein the expression cassette of the long-chain fatty acid-coenzyme A ligase gene yhfL comprises a gene sequence containing a T7 promoter and a gene sequence encoding the long-chain fatty acid-coenzyme A ligase yhfL connected in sequence.

[0066] In some specific embodiments, the expression cassette of the long-chain fatty acid-coenzyme A ligase gene yhfL further includes an upstream homologous arm of capA and a downstream homologous arm of capA.

[0067] In some more specific embodiments, the expression cassette of the long-chain fatty acid-coenzyme A ligase gene yhfL (i.e., the T7-yhfL expression cassette) comprises five DNA fragments: an upstream 1000 bp region upstream of capA from ATCC 6051a as an upstream homologous region; an erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends; a T7 promoter (PT7) from pET-28a(+); the yhfL gene from ATCC 6051a; and a downstream 1000 bp region downstream of capA from ATCC 6051a as a downstream homologous region. The nucleotide sequence of the T7-yhfL expression cassette includes that shown in SEQ ID NO: 13. In one specific embodiment, the expression cassette of the long-chain fatty acid-coenzyme A ligase gene yhfL is transformed into the aforementioned Bacillus subtilis 164SF0 to obtain Bacillus subtilis 164SF. The transformation method includes, but is not limited to, the Spizizen transformation method.

[0068] The present invention also provides the use of the genetically engineered bacteria described above in the preparation of surfactants.

[0069] The present invention also provides a method for preparing a surfactant, comprising inoculating the genetically engineered bacteria described above into a fermentation medium for fermentation, and inducing fermentation with xylose to obtain the surfactant.

[0070] In some embodiments, the fermentation medium comprises a carbon source, a nitrogen source, and inorganic salts.

[0071] In some embodiments, the carbon source is selected from one or more of sucrose, glucose, fructose, brown sugar, maltose, starch, dextrin, glycerol, cellulose, cellulose hydrolysate, and molasses. Based on the total volume of the fermentation medium, the concentration of the carbon source is 1–80 g / L, for example, 1–12 g / L, 10–22 g / L, 20–33 g / L, 31–45 g / L, 40–58 g / L, 50–67 g / L, 60–77 g / L, or 70–80 g / L.

[0072] In some embodiments, the nitrogen source is selected from one or more of yeast extract, peptone (e.g., soybean peptone or tryptone), corn steep liquor, urea, ammonium sulfate, ammonium chloride, sodium nitrate, potassium nitrate, ammonium nitrate, monosodium glutamate, leucine, soybean flour, soybean meal, peanut flour, and cottonseed flour. For example, a combination of tryptone and corn steep liquor. The concentration of the nitrogen source is 10–50 g / L based on the total volume of the fermentation medium, for example, 10–20 g / L, 20–30 g / L, 30–40 g / L, or 40–50 g / L.

[0073] In some embodiments, the inorganic salt is selected from Ca. 2+ Fe 2+Mn 2+ Mg 2+ The inorganic salts are in the form of hydrochloride or sulfate, or a phosphate (disodium hydrogen phosphate, sodium dihydrogen phosphate, dipotassium hydrogen phosphate, or potassium dihydrogen phosphate) buffer system. The concentration of inorganic salts is 0.01–20 g / L based on the total volume of the fermentation medium. The pH of the fermentation medium is 6.5–7.5.

[0074] In some embodiments, the fermentation medium further includes amino acids selected from leucine, isoleucine, glutamic acid, aspartic acid, and valine. Preferably, the amino acid is leucine. Based on the total volume of the fermentation medium, the concentration of the amino acid is 8-15 g / L, for example, 8-10 g / L, 10-11 g / L, 11-13 g / L, or 13-15 g / L.

[0075] In some embodiments, the fermentation medium further includes an antifoaming agent. The antifoaming agent is selected from polyether-based antifoaming agents, vegetable oil-based antifoaming agents, organosilicon-based antifoaming agents, or a combination of the above three components. Based on the total volume of the fermentation medium, the volume fraction of the antifoaming agent is 1-5‰, for example, 1-2.5‰, 2.2-3.4‰, 3-4.5‰, or 4-5‰.

[0076] In some specific embodiments, the polyether-based defoamer is, for example, a defoamer comprising a polyoxypropylene-polyoxyethylene block copolymer.

[0077] In some specific embodiments, the vegetable oil defoamer is a defoamer containing one or more of the following substances: soybean oil, rapeseed oil, corn oil, rice bran oil, sesame oil, walnut oil, and castor oil.

[0078] In some specific embodiments, the silicone defoamer is a defoamer containing silicone oil or modified silicone oil.

[0079] In some more specific embodiments, the fermentation medium comprises 40-80 g / L glucose, 10-30 g / L tryptone, 5-15 g / L corn steep liquor, 0.6-1.0 g / L potassium dihydrogen phosphate, 2-2.6 g / L disodium hydrogen phosphate, 0.05-0.15 g / L manganese chloride, 0.05-0.15 g / L calcium chloride, 0.1-0.3 g / L magnesium sulfate, 0.1-0.3 g / L ferrous sulfate, and 10-14 g / L leucine.

[0080] In some more specific embodiments, the fermentation medium comprises 10-30 g / L glucose, 10-30 g / L tryptone, 10-30 g / L corn steep liquor, 3.5-4.5 g / L potassium dihydrogen phosphate, 11-13 g / L disodium hydrogen phosphate, 0.8-1.2 g / L magnesium sulfate, 0.2-0.6 g / L ferrous sulfate, and a polyether defoamer with a volume fraction of 1-3‰. The culture medium is sterilized by filtration or autoclaving after preparation.

[0081] In some implementations, the fermentation temperature is 20~45°C. Specifically, the fermentation temperature is, for example, 20~25°C, 25~30°C, 30~35°C, 35~38°C, or 38~45°C.

[0082] In some implementations, the fermentation time is 10 to 96 hours. The specific processing time can be adjusted as needed, for example, 10 to 24 hours, 24 to 36 hours, 36 to 48 hours, 48 ​​to 60 hours, 60 to 72 hours, or 72 to 96 hours.

[0083] In some embodiments, the final concentration of xylose added is 1~20 g / L, for example 1~11 g / L, 8~17 g / L, 12~20 g / L, or 10 g / L.

[0084] In some implementations, the induction time is 150-180 hours, for example, 150-162 hours, 155-172 hours, or 170-180 hours.

[0085] In some implementations, the addition of feed culture medium to the culture system is also included.

[0086] In some embodiments, the fed-batch medium includes a carbon source and a nitrogen source, based on the total volume of the feeding medium. The concentration of the carbon source is 500-1000 g / L, and the concentration of the nitrogen source is 100-200 g / L. The types of carbon and nitrogen sources in the feeding medium can be the same as those in the fermentation medium.

[0087] In some specific embodiments, the supplemental culture medium also includes amino acids at a concentration of 5-30 g / L, such as 5-15 g / L, 10-21 g / L, 12-25 g / L, or 23-30 g / L. The amino acids are selected from leucine, isoleucine, glutamic acid, aspartic acid, and valine; preferably, the amino acid is leucine.

[0088] In some more specific embodiments, the feed culture medium comprises 700-900 g / L glucose, 100-200 g / L tryptone, and 8-12 g / L leucine.

[0089] In some embodiments, the fermentation method is shaking culture. The shaking speed is 100~600 rpm. The shaking speed is, for example, 100~150 rpm, 150~200 rpm, 200~250 rpm, 250~300 rpm, 300~350 rpm, 350~400 rpm, 400~500 rpm, or 500~600 rpm.

[0090] In some embodiments, air is also introduced into the culture system at a rate of 3 to 7 L / min.

[0091] In some implementations, the pH of the system during fermentation is 6 to 8, preferably 6.5 to 7.5.

[0092] In some implementations, the DO (dissolved oxygen) value of the system is above 20% during fermentation, for example, 20-40%.

[0093] In some implementations, the steps include:

[0094] 1) Activate the genetically engineered bacteria to obtain seed culture;

[0095] 2) Inoculate the seed liquid into the fermentation medium for fermentation.

[0096] Based on the total volume of the fermentation medium, the inoculation amount of the seed liquid is 1~10 v / v.

[0097] In this invention, the genetically engineered bacteria, under xylose induction, inactivate the xylose repressor protein encoding gene XylR, leading to the activation of the xylose promoter PxylA, which in turn activates T7 RNA polymerase expression. T7 RNA polymerase binds to the T7 promoter, driving the expression of downstream genes srfAABCD and lcfA. Overexpression of lcfA results in sufficient precursors for surfactant synthesis (long-chain acyl-CoA), while srfAABCD efficiently synthesizes surfactant, synergistically leading to an exponential amplification of surfactant expression. The obtained genetically engineered bacteria, at the shake-flask fermentation level, increased surfactant production by more than 17 times compared to the starting strain (Bacillus subtilis ATCC 6051a); and after fed-batch fermentation, surfactant production increased by more than 16 times compared to the starting strain (Bacillus subtilis ATCC 6051a). Furthermore, overexpression of the long-chain fatty acid-coenzyme A ligase yhfL significantly increased the surfactant production of the genetically engineered bacteria. At the shake-flask fermentation level, surfactant production was more than 21 times higher than that of the original strain (Bacillus subtilis ATCC 6051a); after fed-batch fermentation, surfactant production was more than 23 times higher than that of the original strain (Bacillus subtilis ATCC 6051a). This invention provides a novel strategy for the biosynthesis of surfactants.

[0098] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0099] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0100] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0101] The materials and methods used in the embodiments are as follows:

[0102] Bacillus subtilis ATCC 6051a and Priestiamegaterium ATCC 14581 are type strains of the American Type Culture Collection (ATCC). 6051a and 14581 are their collection numbers and can be purchased from the ATCC Collection.

[0103] The DNA polymerase used in the PCR reaction was purchased from Nanjing Novizan Biotechnology Co., Ltd., product name 2×PhantaFlash Master Mix (Dye Plus). Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0104] LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride. Add 20 g / L agar powder to prepare LB solid medium.

[0105] Example 1: Construction of genetically engineered bacteria 164SF0 and 164SF with high surfactant production

[0106] 1. Constructing the T7 RNA polymerase expression cassette

[0107] The starting strain was Bacillus subtilis ATCC 6051a.

[0108] The xylose-induced T7 RNA polymerase expression cassette comprises five DNA fragments: an upstream homologous region of ganA from ATCC 6051a (BsUHR fragment); an erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends (BsErmC fragment); a xylose repressor protein encoding gene and xylose promoter from *Priscilla megaterium* (BsXylR-PxylA); a T7 RNA polymerase encoding gene from *Escherichia coli* BL21(DE3) (T7 RNAP fragment) (SEQ ID NO: 2); and a downstream homologous region of ganA from ATCC 6051a (BsDHR fragment). The DNA sequence of the T7 RNA polymerase expression cassette is shown in SEQ ID NO: 10.

[0109]

[0110] 1.1 Fragment Amplification

[0111] The BsUHR fragment was obtained by PCR amplification using the ATCC 6051a genome as a template and primers BsUHRF (SEQ ID NO: 14) and BsUHRR (SEQ ID NO: 15).

[0112] Taaattgacaatgcagtccagc (SEQ ID NO: 14)

[0113] Gcggccgcaagcttaagcttaaaaaattctcctccttgttctcttagccc (SEQ ID NO: 15)

[0114] The BsErmC fragment was obtained by PCR amplification using the synthesized resistance gene ErmC as a template and primers BsErmCF (SEQ ID NO: 16) and BsErmCR (SEQ ID NO: 17).

[0115] Gggctaagagaacaaggaggagaattttttaagcttaagcttgcggccgc (SEQ ID NO: 16)

[0116] TTTCTTAAGTGTTACCCCTATAAGTTAGcggtacccccgggcatatgtac (SEQ ID NO: 17)

[0117] BsXylR-PxylA was obtained by PCR amplification using the genome of *Priscilla megaterium* ATCC 14581 as a DNA template and primers BsxylF (SEQ ID NO: 18) and BsxylR (SEQ ID NO: 19).

[0118] gtacatatgcccgggggtaccgCTAACTTATAGGGGTAACACTTAAGAAA (SEQ ID NO: 18)

[0119] tcttagcgatgttaatcgtgttcatTTGTCATTTCCCCCTTTGATTTAAG (SEQ ID NO: 19)

[0120] The T7 RNAP fragment was obtained by PCR amplification using BL21(DE3) competent cells (Sangon Biotech) as templates and BsT7PF (SEQ ID NO: 20) and BsT7PR (SEQ ID NO: 21) as primers.

[0121] CTTAAATCAAAGGGGGAAATGACAAatgaacacgattaacatcgctaaga (SEQ ID NO: 20)

[0122] Cgcccatatcgagcggagcatcagcttacgcgaacgcgaagtccgactct (SEQ ID NO: 21)

[0123] The BsDHR fragment was obtained by PCR amplification using the ATCC 6051a genome as a template and primers BsDHRF (SEQ ID NO: 22) and BsDHRR (SEQ ID NO: 23).

[0124] Agagtcggacttcgcgttcgcgtaagctgatgctccgctcgatatgggcg (SEQ ID NO: 22)

[0125] Atttccatgcccatcgcca (SEQ ID NO: 23)

[0126] The PCR reaction system is shown in Table 1, and the PCR procedure and process are shown in Table 2.

[0127] Table 1 PCR reaction system

[0128] reagents volume DNA polymerase 25 μL DNA template 0.5 μL Upstream amplification primer F 1 μL Downstream amplification primer R 1 μL <![CDATA[ddH2O]]> 22.5 μL total 50 μL

[0129] Table 2 PCR reaction procedure

[0130]

[0131] After the PCR-obtained system was verified by agarose gel electrophoresis, it was purified using the SanPrep column PCR product purification kit (Sangon Biotech) to obtain purified DNA fragments.

[0132] 1.2 Fragment Fusion

[0133] The five fragments obtained in step 1.1 were fused using fusion PCR. The fusion PCR method is as follows:

[0134] Reaction system: 1 μL of upstream amplification primer BsUHRF, 1 μL of downstream amplification primer BsDHRR, 0.5 μL of purified DNA solution containing the above 5 fragments, 10 μL of 2×Phanta Flash Master Mix (Dye Plus), and 5.5 μL of ddH2O.

[0135] The reaction system was subjected to fusion PCR, with the annealing temperature set to 60℃, the extension time set to 40s, and other parameters set according to Table 2.

[0136] After the fusion PCR product was verified to be correct by agarose gel electrophoresis, it was purified using the SanPrep column PCR product purification kit (Sangon Biotech). The obtained DNA fragment was the fusion fragment of BsUHR-BsErmC-BsXylR-PxylA-BsT7 RNAP-BsDHR, which is the T7 RNA polymerase expression cassette.

[0137] 2. The T7 RNA polymerase expression cassette was transformed into Bacillus subtilis ATCC 6051a.

[0138] Transformation of Bacillus subtilis ATCC 6051a was performed using a modified Spizizen transformation method on an oligotrophic medium. This induced the Bacillus to enter competent states, take up exogenous DNA fragments, and undergo double crossover via endogenous recombinases, with BsUHR and BsDHR as homologous regions. This resulted in the integration of the fragment located between BsUHR and BsDHR, namely BsErmC-BsXylR-PxylA-BsT7RNAP, into the genome, replacing the ganA gene. Because the strains containing the resistance gene (ErmC) exhibited erythromycin resistance, they could be screened using erythromycin-resistant plates.

[0139] 2.1 Spizizen Conversion

[0140] 2.1.1 Material Preparation

[0141] Preparation of 10×Spizizen stock solution: 150 g / L K2HPO4·3H2O, 60 g / L KH2PO4, 20 g / L (NH4)2SO4, 2 g / L MgSO4, 10 g / L sodium citrate were dissolved in distilled water, sterilized at 115℃ and 101 kPa, and stored at room temperature.

[0142] Preparation of yeast powder mother liquor, hydrolyzed casein mother liquor, and MgCl2 mother liquor: 100 g / L yeast powder, 10 g / L hydrolyzed casein, and 25 mmol / L MgCl2 were sterilized at 115℃ and 101 kPa, respectively, and stored at room temperature.

[0143] Preparation of glucose mother liquor and CaCl2 mother liquor: 1200 g / L glucose and 0.1 mol / L CaCl2 were sterilized by filtration through a 0.22 μm microporous membrane and stored at room temperature.

[0144] GM I medium: 1 mL 10×Spizizen stock solution, 0.1 mL 100 g / L yeast extract, 0.25 mL 200 g / L glucose, 0.2 mL 10 g / L hydrolyzed casein, and add sterile distilled water to a total volume of 10 mL.

[0145] GM II medium: 1 mL 10×Spizizen stock solution, 0.05 mL 100 g / L yeast extract, 0.25 mL 200 g / L glucose, 0.04 mL 10 g / L hydrolyzed casein, 0.05 mL 0.1 mol / L CaCl2, 1 mL 25 mmol / L MgCl2, and add sterile distilled water to a total volume of 10 mL.

[0146] 2.1.2 Preparation of Bacillus subtilis competent cells

[0147] 1) Pick a single colony of Bacillus subtilis ATCC 6051a from an LB plate and inoculate it into 2.5 mL of GMI medium. Incubate overnight at 37°C with shaking at 200 rpm.

[0148] 2) Inoculate 250 μL of the overnight culture into 2.5 mL of fresh GMI medium and incubate at 37°C with shaking at 200 rpm for 4 h.

[0149] 3) Transfer 500 μL of bacterial culture obtained in step 2) to 5 mL of GM II medium and incubate at 37°C with shaking at 200 rpm for 3 h.

[0150] 4) Take 2 mL of bacterial culture obtained in step 3), centrifuge at 5000 rpm for 5 min, and resuspend the bacterial precipitate with 200 μL of supernatant to obtain Bacillus subtilis competent cells.

[0151] 2.1.3. Transformation of exogenous DNA

[0152] In the 200 μL of Bacillus subtilis competent cells obtained in step 2.1.2, 100 ng of the linear DNA fragment of the T7 RNA polymerase expression cassette obtained in step 1 was added. Specifically:

[0153] The mixture of competent cells and DNA fragments was incubated at 37°C on a shaker at 200 rpm for 6 h. After incubation, the cells were centrifuged at 4000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in 100 μL of physiological saline. The cells were then spread on LB agar plates containing 10 μg / mL erythromycin and incubated at 37°C for 36 h to obtain transformants.

[0154] Transformants were identified by colony PCR. Positive transformants were colonies in which the T7 RNA polymerase expression cassette was integrated into the genome of Bacillus subtilis ATCC 6051a.

[0155] Single colonies of transformants were selected as templates, and the integrated fragments were amplified using 2×Phanta Master Mix. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Transformants whose sequencing results were verified to be correct were named Bacillus subtilis 164T7PE.

[0156] 3. Eliminate the resistance gene ErmC

[0157] Elimination was performed using the Cre-LoxP recombinase system. The ErmC fragment contains lox66 and lox71 sites, which the Cre enzyme can specifically recognize and delete the resistance gene in the middle. This step was achieved by transforming the pMK4-Cre plasmid, see reference 5 (Reference 5: Ji M et al. De novo synthesis of 2'-fucosyllactose in engineered Bacillus subtilis ATCC 6051a[J]. Process biochemistry, 2022.DOI:10.1016 / j.procbio.2022.06.007).

[0158] Prepare Bacillus subtilis 164T7PE competent cells as described in step 2.

[0159] 100 ng pMK4-Cre plasmid was added to 200 μL of Bacillus subtilis competent 164T7PE cells.

[0160] The mixture of competent cells and plasmids was placed in a shaker at 37°C and cultured at 200 rpm for 6 h. After culture, the cells were centrifuged at 4000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in 100 μL of physiological saline. The cells were then spread on LB agar plates containing 25 μg / mL chloramphenicol and cultured at 37°C for 36 h to obtain transformants.

[0161] Transformants were identified using the photocopy plate method. Single colonies that grew on LB plates but not on photocopy plates containing 10 μg / mL erythromycin were selected and sequenced for verification. Positive transformants containing the aforementioned BsXylR-PxylA-BsT7RNAP fragment and with the erythromycin resistance gene ErmC eliminated were named Bacillus subtilis 164T7PCre.

[0162] Single colonies of 164T7PCre were picked and inoculated into antibiotic-free LB tubes and cultured at 42℃ and 200rpm for 16 h. 30 μL of the bacterial culture was transferred to a new antibiotic-free LB tube and cultured at 42℃ and 200rpm for 16 h. This transfer and culture were repeated twice. 30 μL of the bacterial culture was streaked onto antibiotic-free LB plates, and the recombinant strains with plasmid loss (i.e., elimination of the pMK4-Cre plasmid) were identified using the replica plate method. Single colonies that grew on LB plates but not on replica plates containing 25 μg / mL chloramphenicol were named Bacillus subtilis 164T7P and preserved.

[0163] 4. Construct the T7-srfAA expression frame

[0164] The T7-srfAA expression cassette comprises four DNA fragments: the srfAA promoter region derived from ATCC 6051a as the upstream homologous region; the erythromycin resistance gene expression cassette (BsErmC fragment) with lox66 and lox71 sites at both ends; and the T7 promoter (PT7) derived from pET-28a(+) and a partial sequence of srfAA derived from ATCC 6051a as the downstream homologous region.

[0165] T7-srfAA was constructed by fusion PCR, as described in step 1.

[0166] The sequence of the T7-srfAA expression box is shown in SEQ ID NO: 11.

[0167] The T7 srfAA expression cassette contains the T7 promoter (SEQ ID NO: 1). The T7 promoter is located upstream of the surfactant synthesis gene cluster srfAABCD (SEQ ID NO: 5-7). Due to polycistronic effects, the surfactant synthesis gene cluster srfAABCD is simultaneously overexpressed.

[0168] TAATACGACTCACTATAGG (SEQ ID NO: 1)

[0169]

[0170]

[0171] 5. The linear DNA fragment of the T7-srfAA expression cassette was transformed into Bacillus subtilis 164T7P

[0172] The T7-srfAA expression cassette obtained in step 4 was converted into Bacillus subtilis 164T7P obtained in step 3.

[0173] The conversion method is as described in step 2.

[0174] Transformants were identified by colony PCR. Positive transformants were colonies in which the T7 srfAA expression cassette was integrated into the 164T7P genome.

[0175] Single colonies of the transformants were selected as templates, and the integrated fragments were amplified using 2×Phanta Master Mix. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The transformants whose sequencing results were verified were named Bacillus subtilis 164T7PsrfE.

[0176] Eliminating the resistance gene ErmC in Bacillus subtilis 164T7PsrfE: The method and steps are the same as in step 3.

[0177] The strain that eliminated the resistance gene ErmC was obtained and named Bacillus subtilis 164T7Psrf.

[0178] 6. Replace the original promoter PlcfA of the long-chain fatty acid-coenzyme A ligase encoding gene lcfA with the T7 promoter.

[0179] 6.1 Constructing the T7-lcfA expression frame

[0180] The T7-lcfA expression cassette comprises four DNA fragments: the upstream homologous region of the lcfA promoter region derived from ATCC 6051a, the erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends, and the downstream homologous region of the T7 promoter (PT7) derived from pET-28a(+) and a partial lcfA sequence derived from ATCC 6051a.

[0181] The T7-lcfA expression cassette was obtained by fusion PCR, as described in step 1, and the sequence is shown in SEQ ID NO: 12.

[0182] The T7-lcfA expression cassette linear fragment was transformed in step 2, and the resistance gene ErmC and pMK4-Cre plasmid were eliminated in step 3.

[0183] The obtained positive transformant was a strain whose T7-lcfA expression cassette was integrated into the 164T7Psrf genome obtained in step 5, and which did not carry the resistance gene ErmC and pMK4-Cre plasmid. The recombinant strain was named Bacillus subtilis 164SF0.

[0184] The T7 promoter is located upstream of the lcfA gene, therefore, lcfA (SEQ ID NO: 8) is overexpressed.

[0185] 7. Integration of the T7-yhfL expression cassette at the capA site

[0186] 7.1 Constructing the T7-yhfL expression frame

[0187] The T7-yhfL expression cassette comprises five DNA fragments: an upstream 1000 bp region from capA derived from ATCC 6051a as the upstream homologous region; an erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends; a T7 promoter (PT7) from pET-28a(+); the yhfL gene (SEQ ID NO: 9) from ATCC 6051a; and a downstream 1000 bp region from capA derived from ATCC 6051a as the downstream homologous region.

[0188] The T7-yhfL expression cassette was obtained by fusion PCR, as described in step 1, and the sequence is shown in SEQ ID NO: 13.

[0189] 7.2 Transformation

[0190] Single colonies of *Bacillus subtilis* 164T7P obtained in step 3 were picked and inoculated into antibiotic-free LB tubes and cultured at 42°C and 200 rpm for 16 h. 30 μL of the bacterial culture was transferred to a new antibiotic-free LB tube and cultured at 42°C and 200 rpm for 16 h. This transfer and culture were repeated twice. 30 μL of the bacterial culture was then streaked onto antibiotic-free LB plates, and the recombinant strains with plasmid loss were identified using the replica plate method. Single colonies that grew on LB plates but not on replica plates containing 25 μg / mL chloramphenicol were picked, named *Bacillus subtilis* 164T7P, and preserved.

[0191] The T7-yhfL expression cassette linear fragment was transformed as described in step 2, and the resistance gene ErmC and pMK4-Cre plasmid were eliminated as described in step 3.

[0192] The obtained positive transformants were strains with the T7-yhfL expression cassette integrated into the 164SF0 genome, and did not carry the resistance gene or the pMK4-Cre plasmid. The recombinant strain was named Bacillus subtilis 164SF.

[0193] Example 2: Shake-flask fermentation of a surfactant-producing genetically engineered bacterium

[0194] The fermentation medium consisted of: 60 g / L glucose, 20 g / L tryptone, 10 g / L corn steep liquor, 0.82 g / L potassium dihydrogen phosphate, 2.49 g / L disodium hydrogen phosphate, 0.1 g / L manganese chloride, 0.1 g / L calcium chloride, 0.2 g / L magnesium sulfate, 0.2 g / L ferrous sulfate, and 12 g / L leucine.

[0195] 1) Take ATCC strains 6051a, 164T7P, 164T7Psrf, 164SF0 and 164SF stored in a -80℃ freezer, streak them on LB solid plates and incubate them in a 37℃ incubator for 16 h.

[0196] 2) Pick a loopful of Bacillus colony from an LB agar plate and inoculate it into a test tube containing 3 mL of LB medium. Incubate overnight at 37°C and 200 rpm for 16 h to obtain the activated seed culture.

[0197] 3) Take 500 μL of seed culture and inoculate it into a 500 mL Erlenmeyer flask containing 50 mL of fermentation medium. Incubate at 37℃ and 200 rpm for 6 h. Add xylose solution with a final concentration of 10 g / L to induce fermentation and ferment for 72 h.

[0198] 4) After fermentation, take 1 mL of fermentation broth, centrifuge at 12000 rpm for 3 min, filter through a 0.22 μm filter, dilute 20 times with water, and perform high-performance liquid chromatography (HPLC) to detect the surfactant content in the fermentation broth. Perform three replicates and calculate the average yield.

[0199] The conditions for high-performance liquid chromatography (HPLC) analysis of surfactants were as follows: Agilent ZORBAX EclipseXDB-C18 column, column temperature 35℃, mobile phase of trifluoroacetic acid, methanol, and water in a ratio of 1:900:100, flow rate 1 mL / min, injection volume 10 μL, and detection wavelength 214 nm. Surfactant standards were purchased from Shanghai Titan Technology Co., Ltd., brand: Adamas, original code: 112801A, exploration code: 015138967. Standard curves were prepared with concentrations of 0 g / L, 0.5 g / L, 1 g / L, and 5 g / L. A standard curve was then plotted, y = 2.1843x, R0. 2 =0.9999.

[0200] The final yields obtained by fermenting wild-type strains and various surfactant-producing genetically engineered bacteria in culture medium are as follows: Figure 2 As shown.

[0201] Under the conditions described in Example 2, the surfactant yield of ATCC 6051a was 1.1 g / L, the surfactant yield of 164T7P was 1.2 g / L, the surfactant yield of 164T7Psrf was 15.3 g / L, the surfactant yield of 164SF0 was 19.3 g / L, and the surfactant yield of 164SF was 23.7 g / L.

[0202] Example 3 Fed-feed fermentation of surfactant-producing genetically engineered bacteria 164SF0 and 164SF

[0203] The initial culture medium consisted of: 20.0 g / L glucose, 20.0 g / L tryptone, 20.0 g / L corn steep liquor, 3.0 g / L potassium dihydrogen phosphate, 10.0 g / L disodium hydrogen phosphate, 1.0 g / L magnesium sulfate, 0.5 g / L ferrous sulfate, and 2‰ (v / v) polyether defoamer (Dow DOWFAX DF-103 defoamer).

[0204] The fed culture medium was a mixture of 800 g / L glucose, 500 g / L xylose, 150 g / L tryptone and 10 g / L leucine.

[0205] The supplementary fermentation steps are as follows:

[0206] 1) Take Bacillus subtilis 164SF stored at -80℃, streak it on LB solid plates, and incubate it in a 37℃ incubator for 16 h.

[0207] 2) Pick a single colony of Bacillus subtilis 164SF from a loop of LB agarose plate, inoculate it into a test tube containing 3 mL of LB medium, and incubate at 37℃ and 200 rpm for 9 h to obtain the activated primary seed culture.

[0208] 3) Take 2 mL of primary seed culture and inoculate it into a 1 L Erlenmeyer flask containing 200 mL of fermentation medium. Incubate at 37℃ and 200 rpm for 9 h to obtain secondary seed culture.

[0209] 4) Inoculate 100 mL of the secondary seed culture into a 5 L bioreactor containing 2 L of initial culture medium. The initial stirring speed is 200 rpm and the aeration rate is 4 L / min. Adjust the stirring speed and aeration rate according to the dissolved oxygen level. After about 4 hours of incubation, increase the stirring speed to 500 rpm and the aeration rate to 6 L / min, and start feeding the culture medium simultaneously.

[0210] During the feeding process, the concentrations of glucose and xylose in the bioreactor reaction system were maintained at 1-10 g / L, dissolved oxygen was maintained above 30%, and the pH was adjusted to 7.0 using sodium hydroxide. Fermentation was terminated when the production of surfactant ceased to increase within two consecutive hours.

[0211] Key parameters in the fermentation process, such as Figure 3 As shown.

[0212] Meanwhile, 164SF0 was used instead of 164SF in experiments, and key parameters during the fermentation process were as follows: Figure 4 As shown.

[0213] In addition, the starting strain ATCC 6051a was used instead of 164SF for the experiment.

[0214] The fermentation broth treatment and high-performance liquid chromatography analysis methods are as described in Example 2.

[0215] Production intensity = Total output / Liquid volume / Time

[0216] The surfactant yield of the starting strain ATCC 6051a was determined to be 2.4 g / L, with a fermentation period of 24 h and a production intensity of 0.1 g / L / h.

[0217] like Figure 3 As shown, the surfactant yield of the genetically engineered bacterium 164SF in this Example 3 was measured to be 55.8 g / L, the fermentation cycle was 24 h, and the production intensity was 2.3 g / L / h.

[0218] like Figure 4 As shown, the surfactant yield of the genetically engineered bacterium 164SF0 in this Example 3 was 40.3 g / L, the fermentation period was 24 h, and the production intensity was 1.6 g / L / h.

[0219] Comparative Example 1: Construction and fermentation of Bacillus subtilis 164P43SF

[0220] 1-1 Construction of Bacillus subtilis 164P43SF

[0221] P43 has been reported to be used for overexpression of the surfactant synthesis gene cluster srfAABCD, which increased the surfactant production of Bacillus subtilis TD7 by 3.5 times. See reference 6 (Reference 6: Mu B et al. Improvement surfactin production by substitution of promoters in Bacillus subtilis TD7[J]. Applied Environmental Biotechnology, 2021.DOI:10.26789 / aeb.2021.01.004).

[0222] 164P43SF is a gene from Bacillus subtilis 164T7P in which the P43 promoter replaces the original promoter PsrfA of the srfAABCD gene cluster.

[0223] The construction method of 164P43SF can be referred to steps 4 and 5 of Example 1.

[0224] The P43-srfAA linear fragment consists of four DNA fragments: the srfAA promoter region from ATCC 6051a as the upstream homologous region, the erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends, and the P43 promoter and a partial sequence of srfAA from Bacillus subtilis ATCC 6051a as the downstream homologous region.

[0225] P43-srfAA was constructed by fusion PCR as described in step 1 of Example 1. The sequence of the linear fragment of P43-srfAA is shown in SEQ ID NO: 24.

[0226] The P43-srfAA linear DNA fragment was transformed into Bacillus subtilis 164T7P obtained in step 3 of Example 1, as described in step 2 of Example 1. The resulting recombinant strain was Bacillus subtilis 164P43SFE.

[0227] Eliminate the resistance gene ErmC and pMK4-Cre plasmid of 164P43SFE using the same method as step 3 in Example 1. The resulting recombinant strain is Bacillus subtilis 164P43SF.

[0228] 1-2. Bacillus subtilis 164P43SF was used for shake-flask fermentation.

[0229] The difference between this and the shake-flask fermentation of Bacillus subtilis 164SF is that the strain used for fermentation is the Bacillus subtilis 164P43SF strain obtained in step 1-1, while the rest is the same as in Example 2.

[0230] The yield of surfactant was detected using the same method as in Example 2, and the results are shown below. Figure 2 .

[0231] from Figure 2 It can be seen that the surfactant yield of Bacillus subtilis 164P43SF in Comparative Example 1 was 2.4 g / L, which is far lower than the surfactant yield of 15.3 g / L of 164T7Psrf in Example 2.

[0232] Comparative Example 2: Construction and fermentation of Bacillus subtilis 164PspacSF

[0233] 2-1 Construction of Bacillus subtilis 164PspacSF

[0234] Pspac has been reported to be used to overexpress the surfactant synthesis gene cluster srfAABCD, which increased the surfactant production of Bacillus subtilis fmbR by 10.1 times. See reference 7 (Reference 7: Sun H et al. Enhancement of surfactant production of Bacillus subtilis fmbR by replacement of the native promoter with the Pspac promoter[J].Canadian Journal of Microbiology, 2009,55(8):1003-1006.DOI:10.1139 / w09-044).

[0235] Bacillus subtilis 164PspacSF is a gene from Bacillus subtilis 164T7P in which the original promoter PsrfA of the srfAABCD gene cluster is replaced by the Pspac promoter.

[0236] The Pspac promoter contains lacO and is regulated by the lactose operon, thus simultaneously expressing the repressor protein lacI upstream.

[0237] The Pspac-srfAA linear fragment consists of four DNA fragments: the srfAA promoter region from ATCC 6051a as the upstream homologous region, the erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends, the LacI expression cassette and Pspac promoter from plasmid pHCMC05, and a partial sequence of srfAA from ATCC 6051a as the downstream homologous region.

[0238] Pspac-srfAA was constructed by fusion PCR, as described in step 1 of Example 1. The sequence of the linear fragment of Pspac-srfAA is shown in SEQ ID NO: 25.

[0239] The Pspac-srfAA linear DNA fragment was transformed into Bacillus subtilis 164T7P obtained in step 3 of Example 1, using the same method as step 2 of Example 1. The resulting recombinant strain was 164PspacSFE.

[0240] The resistance genes ErmC and pMK4-Cre plasmid of 164PspacSFE were eliminated using the method described in step 3 of Example 1, and the resulting recombinant strain was Bacillus subtilis 164PspacSF.

[0241] 2-2. Bacillus subtilis 164PspacSF was used for shake-flask fermentation.

[0242] The difference between this and the shake-flask fermentation of Bacillus subtilis 164SF is that: 1) the strain used for fermentation is the Bacillus subtilis 164PspacSF strain obtained in step 2-1; 2) after 6 h of culture, an additional 0.5 mmol / L of IPTG is added for induction, and the rest is the same as in Example 2.

[0243] The yield of surfactant was detected using the same method as in Example 2, and the results are shown below. Figure 2 .

[0244] from Figure 2 It can be seen that the surfactant yield of Bacillus subtilis 164PspacSF in Comparative Example 2 was 3.7 g / L, which was lower than the surfactant yield of 15.3 g / L of 164T7Psrf in Example 2.

[0245] Comparative Example 3: Construction and fermentation of Bacillus subtilis 164PvegSF

[0246] 3-1. Construction of Bacillus subtilis 164PvegSF

[0247] Pveg has been reported to be used to overexpress the surfactant synthesis gene cluster srfAABCD, resulting in a 3.7-fold increase in surfactant production in Bacillus subtilis 3A3B. (Reference 8: Willenbacher J et al. Substitution of the native srfA promoter by constitutive Pveg in two B. subtilis strains and evaluation of the effect on Surfactin production[J]. Journal of Biotechnology, 2016, 224:14-17.DOI:10.1016 / j.jbiotec.2016.03.002.).

[0248] 164PvegSF is a gene from Bacillus subtilis 164T7P in which the Pveg promoter replaces the original promoter PsrfA of the srfAABCD gene cluster.

[0249] The Pveg-srfAA linear fragment consists of four DNA fragments: the srfAA promoter region from ATCC 6051a as the upstream homologous region, the erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends, the Pveg promoter from ATCC 6051a, and a partial sequence of srfAA from ATCC 6051a as the downstream homologous region.

[0250] Pveg-srfAA was constructed by fusion PCR as described in step 1 of Example 1. The sequence of the linear fragment of Pveg-srfAA is shown in SEQ ID NO: 26.

[0251] The Pveg-srfAA linear DNA fragment was transformed into Bacillus subtilis 164T7P obtained in step 3 of Example 1, as described in step 2 of Example 1. The resulting recombinant strain was Bacillus subtilis 164PvegSFE.

[0252] The ErmC resistance gene and pMK4-Cre plasmid of 164PvegSFE were eliminated, as described in step 3 of the example. The resulting recombinant strain was Bacillus subtilis 164PvegSF.

[0253] 3-2. Bacillus subtilis 164PvegSF was used for shake-flask fermentation.

[0254] The difference between this and the shake-flask fermentation of Bacillus subtilis 164SF is that the strain used for fermentation is Bacillus subtilis 164PvegSF obtained in step 3-1, while the rest is the same as in Example 2.

[0255] The yield of surfactant was detected using the same method as in Example 2, and the results are shown below. Figure 2 .

[0256] from Figure 2 It can be seen that the surfactant yield of Bacillus subtilis 164PvegSF in Comparative Example 3 was 5.7 g / L, which was lower than the surfactant yield of 15.3 g / L of 164T7Psrf in Example 2.

[0257] Comparative Example 4: Construction and fermentation of Bacillus subtilis 164Pg3SF

[0258] 4-1 Construction of Bacillus subtilis 164Pg3SF

[0259] Pg3 has been reported to be used to overexpress the surfactant synthesis gene cluster srfAABCD, which increased the surfactant production of Bacillus subtilis THY-7 by 17.7 times. See reference 4 (Reference 4: Jiao S et al. In situ enhancement of surfactantin biosynthesis in Bacillus subtilis using novel artificial inducible promoters[J]. Biotechnology & Bioengineering, 2017.DOI:10.1002 / bit.26197).

[0260] 164Pg3SF is a gene from Bacillus subtilis 164T7P in which the Pg3 promoter replaces the original promoter PsrfA of the srfAABCD gene cluster.

[0261] The Pg3 promoter contains lacO and is regulated by the lactose operon, thus the repressor protein gene lacI is expressed upstream simultaneously.

[0262] The Pg3-srfAA linear fragment consists of five DNA fragments: the srfAA promoter region from ATCC 6051a as the upstream homologous region, the erythromycin resistance gene expression cassette with lox66 and lox71 sites at both ends, the lacI expression cassette from plasmid pHCMC05, the artificially synthesized Pg3 promoter, and a partial sequence of srfAA from ATCC 6051a as the downstream homologous region.

[0263] Pg3-srfAA was constructed by fusion PCR, as described in step 1 of Example 1. The sequence of the linear fragment of Pg3-srfAA is shown in SEQ ID NO: 27.

[0264] The Pg3-srfAA linear DNA fragment was transformed into Bacillus subtilis 164T7P obtained in step 3 of Example 1, using the same method as step 2 of Example 1. The resulting recombinant strain was Bacillus subtilis 164Pg3SFE.

[0265] Eliminating the resistance genes ErmC and pMK4-Cre plasmid of Bacillus subtilis 164Pg3SFE was performed as described in step 3 of the example, and the resulting recombinant strain was Bacillus subtilis 164Pg3SF.

[0266] 4-2. Bacillus subtilis 164Pg3SF was used for shake-flask fermentation.

[0267] The difference between this and the shake-flask fermentation of Bacillus subtilis 164SF is that: 1) the strain used for fermentation is 164Pg3SF; 2) after 6 h of culture, an additional IPTG solution with a final concentration of 0.5 mmol / L is added, and the other conditions are the same as in Example 2.

[0268] The yield of surfactant was detected using the same method as in Example 2, and the results are shown below. Figure 2 .

[0269] from Figure 2 It can be seen that the surfactant yield of Bacillus subtilis 164Pg3SF in Comparative Example 4 was 10.9 g / L, which is lower than the surfactant yield of 15.3 g / L of 164T7Psrf in Example 2.

[0270] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. A genetically engineered bacterium producing surfactant, characterized in that, The genome of the genetically engineered bacteria includes the following; An expression cassette encoding T7 RNA polymerase, the gene sequence of which is shown in SEQ ID NO: 10; The expression cassette of the surfactant synthesis gene cluster srfAABCD, the gene sequence of which is shown in SEQ ID NO: 11; and The expression cassette of the long-chain fatty acid-coenzyme A ligase gene lcfA, the gene sequence of which is shown in SEQ ID NO: 12; The starting strain of the genetically engineered bacteria is Bacillus subtilis ATCC 6051a.

2. The genetically engineered bacterium according to claim 1, characterized in that, The expression cassette encoding T7 RNA polymerase is integrated into the ganA site on the genome of the genetically engineered bacterium.

3. The genetically engineered bacterium according to claim 1, characterized in that, The genetically engineered bacteria also contain an expression cassette of the long-chain fatty acid-coenzyme A ligase gene yhfL, which includes a T7 promoter gene sequence and a long-chain fatty acid-coenzyme A ligase yhfL coding gene sequence connected in sequence.

4. The genetically engineered bacterium according to claim 3, characterized in that, The gene sequence encoding the long-chain fatty acid-coenzyme A ligase yhfL is shown in SEQ ID NO: 9; And / or, the encoding gene sequence of the long-chain fatty acid-coenzyme A ligase gene yhfL is integrated into the capA site on the genome of the genetically engineered bacteria.

5. The method for constructing the genetically engineered bacteria according to any one of claims 1-4, characterized in that, The construction method includes: The genome of the starting strain integrates nucleic acid molecules encoding T7 RNA polymerase, nucleic acid molecules encoding the T7 promoter and surfactant synthesis gene cluster srfAABCD, and nucleic acid molecules encoding the T7 promoter and long-chain fatty acid-coenzyme A ligase gene lcfA. The starting strain was Bacillus subtilis ATCC 6051a.

6. The construction method according to claim 5, characterized in that, The genome of the starting strain also integrates a nucleic acid molecule encoding the long-chain fatty acid-coenzyme A ligase gene yhfL.

7. Use of the genetically engineered bacteria according to any one of claims 1-4 in the preparation of surfactants.

8. A method for preparing a surfactant, characterized in that, include: The genetically engineered bacteria according to any one of claims 1-4 are inoculated into a fermentation medium for fermentation and induced by xylose to obtain the surfactant.

9. The preparation method according to claim 8, characterized in that, The fermentation medium includes a carbon source, a nitrogen source, and inorganic salts. The carbon source is selected from one or more of sucrose, glucose, fructose, brown sugar, xylose, maltose, starch, dextrin, glycerol, cellulose, cellulose hydrolysate, and molasses; And / or, the nitrogen source is selected from one or more of yeast extract, peptone, corn steep liquor, urea, ammonium sulfate, ammonium chloride, sodium nitrate, potassium nitrate, ammonium nitrate, monosodium glutamate, leucine, soybean flour, soybean meal, peanut flour, and cottonseed flour; And / or, the inorganic salt is selected from Ca 2+ Fe 2+ Mn 2+ Mg 2+ It is a hydrochloride or sulfate, or a phosphate buffer system.

10. The preparation method according to claim 9, characterized in that, Based on the total volume of the fermentation medium, the concentration of the carbon source is 1-80 g / L; And / or, based on the total volume of the fermentation medium, the concentration of the nitrogen source is 10-50 g / L; And / or, based on the total volume of the fermentation medium, the concentration of the inorganic salt is 0.01-20 g / L; And / or, the fermentation medium further includes an antifoaming agent; And / or, the fermentation medium further includes amino acids, the concentration of which is 5-30 g / L.

11. The preparation method according to claim 10, characterized in that, The defoamer is selected from one or more of polyether defoamers, vegetable oil defoamers, and organosilicon defoamers; And / or, based on the total volume of the fermentation medium, the volume fraction of the defoamer is 1-5‰; And / or, the amino acid is one or more selected from leucine, isoleucine, glutamic acid, aspartic acid, and valine.

Citation Information

Patent Citations

  • CN105400784A

  • US20040043451A1