Gene for improving reducing power and producing monensin at high yield through multi-gene synergistic expression, vector and strain
By tandemly linking the zwf, gnd, and fadB genes in *Streptomyces cinnamon*, a high-reducing-power donor fusion gene was constructed and co-expressed under the drive of a strong promoter, thus solving the problem of low monensin yield and achieving efficient monensin production.
Patent Information
- Application Number
- CN202511987136.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-26
- Publication Date
- 2026-03-20
AI Technical Summary
Wild-type strains have low monensin production, limited by the total amount of intracellular NADPH and NADH. Existing genes show low enhancement and lack synergistic regulation. Vector integration efficiency and stability are insufficient, affecting the sustained expression of exogenous genes.
A high-reducing-power donor fusion gene was constructed by tandemly linking the genes of glucose-6-phosphate dehydrogenase (zwf), 6-phosphate gluconate dehydrogenase (gnd), and 3-hydroxyacyl-ACP dehydratase (fadB). The gene was co-expressed in *Streptomyces cinnamon* under the strong promoter PermE, and the fd transcription terminator was used to improve the stability of the vector.
It significantly increased the total amount of intracellular NADPH and NADH, boosting monensin production by approximately 45% to 55%, while maintaining good genetic stability; the production retention rate remained above 90% after five consecutive generations of passage.
Smart Images

Figure CN121699952A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a gene, a vector and a strain for improving reducing power and high-yield monensin through synergistic expression of multiple genes. BACKGROUND
[0002] Monensin is a polyether antibiotic produced by Streptomyces (such as Streptomyces cinnamoneus), which has the effects of broad-spectrum anticoccidial and growth promotion, and is widely used in the fields of animal husbandry and veterinary medicine. At present, the industrial production of monensin mainly relies on microbial fermentation, but the yield of wild-type strains is low, and is limited by the supply of key cofactors in the metabolic network. The biosynthesis process of monensin needs a large amount of NADPH and NADH as reducing power (such as the reduction reaction in the polyketide chain extension stage), and the total amount of intracellular NADPH and NADH is one of the core bottlenecks limiting the yield.
[0003] Although some genes can increase the amount of NADPH or NADH, the increase is low, and there is a lack of synergistic regulation among the genes. Moreover, the commonly used vector such as pSET152 has insufficient integration efficiency or stability in Streptomyces cinnamoneus, which affects the sustained expression of exogenous genes. SUMMARY
[0004] In view of the above technical problems, the application provides a gene, a vector and a recombinant strain for improving reducing power and high-yield monensin through synergistic expression of multiple genes. Through synergistic overexpression of the genes, the supply level of intracellular NADPH and NADH is significantly improved, and the yield of monensin is effectively improved.
[0005] Specifically, the application provides a high-reducing-power donor fusion gene, which is composed of a coding gene of glucose-6-phosphate dehydrogenase, a coding gene of 6-phosphogluconate dehydrogenase and a coding gene of 3-hydroxyacyl-ACP dehydratase connected in series.
[0006] In a preferred mode of the application, the nucleotide sequence of the coding gene of glucose-6-phosphate dehydrogenase is shown in SEQ ID No. 1, the nucleotide sequence of the coding gene of 6-phosphogluconate dehydrogenase is shown in SEQ ID No. 2, and the nucleotide sequence of the coding gene of 3-hydroxyacyl-ACP dehydratase is shown in SEQ ID No. 3.
[0007] The application further provides a recombinant expression vector comprising the above-mentioned high-reducing-power donor fusion gene.
[0008] In a preferred mode of the present application, the recombinant expression vector comprises a PermE strong promoter, a multiple cloning site and an fd transcription terminator; wherein the high-reducing power donor fusion gene is located in the multiple cloning site, the PermE strong promoter is connected upstream of the high-reducing power donor fusion gene, and the fd transcription terminator is located downstream of the high-reducing power donor fusion gene. The nucleotide sequence of the PermE strong promoter is shown in SEQ ID No. 4, and the nucleotide sequence of the fd transcription terminator is shown in SEQ ID No. 5.
[0009] In a preferred mode of the present application, the backbone of the recombinant expression vector is a pSET152 plasmid.
[0010] The present application also provides a construction method of the above-mentioned recombinant expression vector, comprising the following steps: assembling a zwf gene fragment comprising a glucose-6-phosphate dehydrogenase encoding gene, a gnd gene fragment comprising a 6-phosphogluconate dehydrogenase encoding gene, a fadB gene fragment comprising a 3-hydroxyacyl-ACP dehydratase encoding gene, and a linearized carrier fragment to obtain the recombinant expression vector. The linearized carrier fragment comprises a PermE strong promoter, a carrier backbone and an fd transcription terminator.
[0011] In a preferred mode of the present application, the zwf gene fragment, the gnd gene fragment and the fadB gene fragment are all amplified from the Streptomyces cinnamonensis genome by PCR reaction; wherein the nucleotide sequence of the primer pair used for amplifying the zwf gene fragment is shown in SEQ ID No. 6 and SEQ ID No. 7, the nucleotide sequence of the primer pair used for amplifying the gnd gene fragment is shown in SEQ ID No. 8 and SEQ ID No. 9, and the nucleotide sequence of the primer pair used for amplifying the fadB gene fragment is shown in SEQ ID No. 10 and SEQ ID No. 11.
[0012] The present application also provides a recombinant Streptomyces comprising the above-mentioned recombinant expression vector, or obtained by transforming the Streptomyces with the recombinant expression vector constructed by the above-mentioned construction method.
[0013] The present application also provides a method for constructing the above-mentioned recombinant Streptomyces, comprising: introducing the above-mentioned recombinant expression vector, or the recombinant expression vector constructed by the above-mentioned construction method, into a Streptomyces host by intergeneric conjugation transfer, and screening to obtain a positive transformant, i.e. the recombinant Streptomyces.
[0014] The present application also provides a method for producing monensin, comprising: culturing the above-mentioned recombinant Streptomyces, and harvesting monensin from the culture product.
[0015] Beneficial effects: The present application realizes the synergistic expression of glucose-6-phosphate dehydrogenase (zwf), 6-phosphogluconate dehydrogenase (gnd) and 3-hydroxyacyl-ACP dehydratase (fadB) in the host bacteria by constructing a high-reducing power donor fusion gene containing the three. Among them, zwf catalyzes the conversion of glucose-6-phosphate to 6-phosphogluconate with the synthesis of NADPH; gnd catalyzes the conversion of 6-phosphogluconate to 5-phosphoribulose, and in the process, another molecule of NADPH is generated; fadB indirectly regulates NADH regeneration through the fatty acid beta-oxidation pathway. The synergistic effect of the three makes the content of NADPH and NADH in the host cell increase by about 2 times, providing sufficient reducing power support for the biosynthesis of monensin.
[0016] The present application further constructs an expression vector containing the fusion gene and introduces it into Streptomyces cinnamoneus, significantly improving the yield of monensin. The obtained recombinant strain has good genetic stability, and the yield retention rate still reaches more than 90% after 5 generations of continuous passage. Through the simple combination of genes and strong promoter strategy, the present application realizes the efficient supply of reducing power through multiple pathways, and has good industrial application prospect.
[0017] Biological preservation information Streptomyces cinnamoneus Streptomyces cinnamoneus ) SDSL6002, preserved in the China General Microbiological Culture Collection Center (CGMCC) on April 22, 2024, located at No. 1, Beichen West Road, Beijing City, Chaoyang District, No. 3, Institute of Microbiology of Chinese Academy of Sciences, with the preservation number of CGMCC No. 30409. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 is the effect diagram of single gene overexpression strain S-zwf, in which A: catalytic reaction of zwf, B: glucose-6-phosphate dehydrogenase activity, C: NADPH content, D: monensin titer; Figure 2 is the effect diagram of single gene overexpression strain S-gnd, in which A: catalytic reaction of gnd, B: 6-phosphogluconate dehydrogenase activity, C: NADPH content, D: monensin titer; Figure 3 is the effect diagram of single gene overexpression strain S-fadB, in which A: catalytic reaction of fadB, B: NADH content, C: monensin titer; Figure 4 is the effect diagram of three gene co-expression strain S-zwf-gnd-fadB, in which A: recombinant vector structure diagram, B: NADPH content, C: NADH content, D: monensin titer; Figure 5 Figure for the effect of double-gene co-expression strain S-zwf-gnd, in which A: recombinant vector structure diagram, B: NADPH content, C: monensin titer; Figure 6 Figure for the effect of double-gene co-expression strain S-zwf-fadB, in which A: recombinant vector structure diagram, B: NADPH content, C: NADH content, D: monensin titer; Figure 7 Figure for the effect of double-gene co-expression strain S-gnd-fadB, in which A: recombinant vector structure diagram, B: NADPH content, C: NADH content, D: monensin titer; Figure 8 Figure for the effect of empty vector control strain (S-pSET152, referred to as S-EV in the figure), in which A: NADPH content, B: NADH content, C: monensin titer; Figure 9 Figure for the effect of empty vector control strain (S-pSET152, referred to as S-EV in the figure), in which A: NADPH content, B: NADH content, C: monensin titer; Figure 10 Figure for the effect of empty vector control strain (S-pSET152, referred to as S-EV in the figure), in which A: NADPH content, B: NADH content, C: monensin titer; DETAILED DESCRIPTION
[0019] The present application provides a high-reducing power donor fusion gene, which comprises, in sequence, a glucose-6-phosphate dehydrogenase (zwf) encoding gene, a 6-phosphogluconate dehydrogenase (gnd) encoding gene and a 3-hydroxyacyl-ACP dehydratase (fadB) encoding gene.
[0020] The glucose-6-phosphate dehydrogenase encoded by the zwf gene is responsible for catalyzing the generation of 6-phosphogluconate from glucose-6-phosphate, and is accompanied by the synthesis of NADPH; the 6-phosphogluconate dehydrogenase encoded by the gnd gene is involved in the pentose phosphate pathway and further catalyzes the reaction to generate NADPH; and the 3-hydroxyacyl-ACP dehydratase encoded by the fadB gene indirectly regulates the regeneration of NADH through the fatty acid beta-oxidation pathway. The present application produces a significant synergistic effect by fusing and co-expressing the three genes, so that the total amount of NADPH and NADH in the host cell is increased by about 2 times compared with the wild-type strain. This improvement effect is significantly better than that of overexpressing any one gene or any combination of two genes alone.
[0021] In an embodiment of the present application, the nucleotide sequence of the zwf gene is shown in SEQ ID No. 1; the nucleotide sequence of the gnd gene is shown in SEQ ID No. 2; and the nucleotide sequence of the fadB encoding gene is shown in SEQ ID No. 3. The nucleotide sequence of the fadB encoding gene is shown in SEQ ID No. 3.
[0022] The application also provides an expression vector containing the high-reducing power donor fusion gene.
[0023] In a preferred embodiment of the application, the expression vector is based on the pSET152 plasmid as a backbone. The C31 integrase coding sequence, the conjugation origin (oriT) and the apramycin resistance gene (aac(3)-IV, Apr) are used as a screening marker. In order to drive efficient expression of the fusion gene, the strong promoter PermE commonly used in Streptomyces is introduced to ensure that the zwf, gnd and fadB genes are synchronously and efficiently overexpressed in Streptomyces cinnamonensis. Downstream of the fadB gene, the transcription terminator fd terminator is connected, which can effectively avoid the adverse effects on the stability of the vector caused by the excessive length of the foreign gene transcript, prevent transcription interference between different gene units, ensure the independence of each gene expression, and help to improve the stability of mRNA, thereby indirectly improving the translation efficiency of the target protein.
[0024] In an embodiment of the application, the nucleotide sequence of the strong PermE promoter is shown in SEQ ID No. 4: GTGCACGCGGTCGATCTTGACGGCTGGCGAGAGGTGCGGGGAGGATCTGACCGACGCGGTCCACACGTGGCACCGCGATGCTGTTGTGGGCACAATCGTGCCGGTTGGTAGGATCCACAT. The nucleotide sequence of the transcription terminator fd terminator is shown in SEQ ID No. 5: AAAATCTCCAAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATCGGT.
[0025] The construction process of the pSET152 plasmid containing the ermE promoter and the fd terminator in the embodiment of the application is as follows: (1) Preparation of linearized pSET152 vector fragment The pSET152 plasmid is used as a template, and polymerase chain reaction (PCR) is used for amplification. The primer pairs used include: the upstream primer Fd-F (SEQ ID No. 16), which contains a 49-base-length fd terminator homologous sequence at the 5' end; and the downstream primer Fd-R (SEQ ID No. 17). The linearized pSET152 vector fragment is obtained by PCR reaction with the above primer pairs. The two ends of the fragment are respectively provided with homologous regions to the subsequent to-be-inserted fragment: the 5' end carries the complete fd terminator sequence as a homologous arm, and the 3' end contains a sequence complementary to the downstream region of the ermE promoter.
[0026] (2) Amplification of the ermE promoter fragment A ermE promoter fragment with homologous arms at both ends was obtained by PCR amplification using the synthesized ermE promoter DNA fragment (length of 120 bp) as a template. The primer pair used was: upstream primer ermE-fd-F (SEQ ID No. 18), the sequence of which comprises a homologous region complementary to the 3' end of the linearized pSET152 vector fragment; downstream primer ermE-fd-R (SEQ ID No. 19), the sequence of which comprises a homologous region complementary to the fd terminator region. After PCR amplification, the obtained ermE promoter fragment is homologous to the downstream region of the vector at the 5' end and homologous to the fd terminator sequence at the 3' end.
[0027] Fd-F (SEQ ID No. 16): ACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTTGGAGATTTTATGTTGGGGATCCTCTAGA; Fd-R (SEQ ID No. 17): CTGCGATCGCCGATC; ermE-fd-F (SEQ ID No. 18): GATCGGCGATCGCAGGTGCACGCGGTCGATCT; ermE-fd-R (SEQ ID No. 19): GAGCCTTTAATTGTATCGGTATGTGGATCCTACCAACCGGC.
[0028] The application also provides a construction method of the above-mentioned expression vector, comprising the following steps: (1) Using the genome of Streptomyces cinnamonensis as a template, the coding gene zwf fragment of glucose-6-phosphate dehydrogenase, the coding gene gnd fragment of 6-phosphogluconate dehydrogenase and the coding gene fadB fragment of 3-hydroxyacyl-ACP dehydratase are obtained by amplification using primer pairs zwf-F and zwf-R, primer pairs gnd-F and gnd-R and primer pairs fadB-F and fadB-R, respectively; the nucleotide sequence of zwf-F is shown in SEQ ID No. 6, the nucleotide sequence of zwf-R is shown in SEQ ID No. 7, the nucleotide sequence of gnd-F is shown in SEQ ID No. 8, the nucleotide sequence of gnd-R is shown in SEQ ID No. 9, the nucleotide sequence of fadB-F is shown in SEQ ID No. 10, and the nucleotide sequence of fadB-R is shown in SEQ ID No. 11; (2) taking the pSET152 plasmid as a template, and taking primer pair P-F and P-R as a primer pair to carry out amplification to obtain a linearized pSET152 plasmid fragment; the nucleotide sequence of P-F is shown in SEQ ID No. 12, and the nucleotide sequence of P-R is shown in SEQ ID No. 13; (3) Gibson assembly is carried out on the zwf fragment, the gnd fragment and the fadB fragment obtained in step (1) and the linearized pSET152 plasmid fragment (PermE strong promoter and fd terminator) obtained in step (2) to obtain the expression vector.
[0029] In one embodiment of the present application, when the zwf fragment is amplified by using high-fidelity enzyme 2×Super Pfx Master Mix to carry out PCR amplification reaction, the extracted Streptomyces cinnamoneus genome is taken as a template, and zwf-F and zwf-R are taken as primers.
[0030] zwf-F (SEQ ID No. 6): GGTTGGTAGGATCCACATAACACCATCGCGGGCAC; zwf-R (SEQ ID No. 7): GAGCCTTTAATTGTATCGGTTTGATGACCACGAGGGTGC.
[0031] In one embodiment of the present application, when the gnd fragment is amplified by using high-fidelity enzyme 2×Super Pfx Master Mix to carry out PCR amplification reaction, the extracted Streptomyces cinnamoneus genome is taken as a template, and gnd-F and gnd-R are taken as primers.
[0032] gnd-F (SEQ ID No. 8): GGTTGGTAGGATCCACATTACAAGTACCTGATCATGCCTGTACG; gnd-R (SEQ ID No. 9): GAGCCTTTAATTGTATCGGTTTGGTCTTGCCCTGTCCGT.
[0033] In one embodiment of the present application, when amplifying the fadB fragment using high-fidelity enzyme 2xSuper Pfx Master Mix for PCR amplification reaction, the extracted S. cinnamonii genome is used as a template, and fadB-F and fadB-R are used as primers. The PCR amplification reaction program comprises: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 60℃ annealing for 35 s, 72℃ extension for 26 s, 30 cycles; and 72℃ terminal extension for 5 min.
[0034] fadB-F (SEQ ID No. 10): GGTTGGTAGGATCCACATTACGCCTGATGACGCAGC; fadB-R (SEQ ID No. 11): GAGCCTTTAATTGTATCGGTTACGGGAGTTGTCCCGTACG.
[0035] In one embodiment of the present application, the pSET152 plasmid is used as a template, P-F and P-R are used as primers, and high-fidelity enzyme 2xSuper Pfx Master Mix is used for reverse PCR amplification reaction. The PCR amplification reaction program comprises: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min 45 s, 30 cycles; and 72℃ terminal extension for 7 min, to obtain a linearized pSET152 plasmid fragment.
[0036] P-F (SEQ ID No. 12): ACCGATACAATTAAAGGCTC; P-R (SEQ ID No. 13): ATGTGGATCCTACCAACCGGC.
[0037] The linearized pSET152 plasmid fragment containing the strong promoter PermE and fd terminator is Gibson assembled with zwf, gnd, fadB and Hieff Clone® Plus Multi One Step Cloning Kit to obtain a pSET152-PermE The zwf-gnd-fadB-fd Ter recombinant vector; the reaction condition is 50℃, and the reaction time is 20-30 min. The reaction system of 10 μL comprises: Clone® Plus Multi One Step Cloning Kit 5 μL, linearized pSET152 plasmid fragment 0.02 pmol, zwf 0.02 pmol, gnd 0.02 pmol and fadB 0.02 pmol.
[0038] The present invention also provides a recombinant Streptomyces containing the above-described expression vector or an expression vector constructed using the above-described construction method.
[0039] In one embodiment of this invention, *Streptomyces cinnamonensis* is used as the host strain. Specifically, the host strain is *Streptomyces cinnamonensis* SDSL6002, with accession number CGMCC No. 30409. Compared to the wild-type strain, the recombinant *Streptomyces* strain constructed in this invention exhibits a two-fold increase in total intracellular NADPH and NADH, providing sufficient reducing power for monensin biosynthesis. Simultaneously, the monensin yield of the recombinant strain is 45%–55% higher than that of the wild-type strain, and it demonstrates good genetic stability, maintaining a yield retention rate of over 90% after five consecutive passages. The present invention also provides a method for constructing the above-mentioned recombinant Streptomyces, comprising the following steps: transforming the above-mentioned expression vector or the expression vector constructed using the above-mentioned method into E. coli ET12567 / pUZ8002 donor bacteria, performing genus-to-generic synergistic transfer with competent cells of Streptomyces, selecting conjugates, and obtaining the recombinant Streptomyces.
[0040] In this embodiment of the invention, the pSET152-PermE is first... The zwf-gnd-fadB-fd Ter recombinant vector was transformed into E. coli JM109 competent cells. Positive clones were initially screened by PCR and sequenced for verification. The correct recombinant plasmid was then further transformed into... E. coli The ET12567 / pUZ8002 donor strain (a kind gift from the laboratory of Jiangnan University, and previously published in the article: Xin Ying, Zhang Shanfei, Liu Minwei, et al. Heterologous expression of the vgb gene of *Streptomyces cinnamonis* producing high monensin [J]. Food and Fermentation Industries, 2024, 50(10): 1-9. DOI: 10.13995 / j.cnki.11-1802 / ts.037949.) was amplified in LB medium with triple antibodies (25 μg / mL Apr, 15 μg / mL Chl and 20 μg / mL Kan), and then washed with antibiotic-free LB medium with MgCl2 to a final concentration of 20 mM to obtain a donor strain suitable for indirect genus fusion transfer.
[0041] The E. coli JM109 competent cells described in this invention can be prepared by the CaCl2 method, which includes the following steps: Day 1: Activate the strain: streak the frozen strain at -80℃ onto LB agar plates (without antibiotics) and incubate overnight at 37℃. Pick a single colony and transfer it to 3 mL SOB, then pre-incubate overnight at 37℃ and 200 rpm.
[0042] Second day main culture: 1:100 transfer, 300 μL overnight bacteria to 30 mL SOB (250 mL flask), 37℃, 200 rpm shaking to OD 600 =0.4~0.5 (about 2~2.5h).
[0043] Immediately put into ice bath for 10 min, stop shaking. 4℃, 4000g centrifugation for 10 min, discard the supernatant.
[0044] CaCl2 washing, resuspended in 10 mL ice pre-cooled TFBII, light blow. Ice bath for 30 min.
[0045] 4℃, 4000g centrifugation for 10 min, discard the supernatant. Each 30 mL original bacteria liquid is resuspended with 600 μL TFBII (≈50× concentration). 50 μL / tube on ice, frozen with liquid nitrogen and stored at -80℃.
[0046] The application takes (Streptomyces cinnamonensis) SDSL6002 as a receptor bacteria, and the receptor bacteria SDSL6002 is cultured in an SM culture medium, and then the mycelium is repeatedly washed in a 2×YT culture medium to prepare a competent state. The culture time is 30-48h.
[0047] When the intergeneric conjugation transfer is performed, the donor bacteria and the receptor bacteria are mixed and coated on an antibiotic-free MS plate at a volume ratio of 1:1, wherein when the mixing is performed, the donor bacteria (ET12567) are about 1-2×10 9 CFU / mL, and the receptor bacteria are 1×10 8 ~10 9 spores / mL. After 18h of co-culture at 30℃, sterile water containing Nal (nalidixic acid, final concentration 20 μg / mL) and Apr (Apramycin 50 μg / ml) is covered for resistance screening; after 7d of culture, the conjugants are picked, and aam(3)-IV-F and aac(3)-IV-R are used as primers to amplify the apramycin resistance marker by genome PCR using 2×Taq MasterMix (Dye), and the amplification procedure includes: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 15 s, 30 cycles; final extension for 2 min. After the positive strain is verified and stably inherited after three generations of antibiotic-free slant culture, the spores are collected for strain preservation. The whole process is confirmed by DNA sequencing comparison to ensure the correct integration of the genome, and to ensure that the overexpression strain is successfully constructed.
[0048] aac(3)-IV-F (SEQ ID No. 14): GTGCAATACGAATGGCGAAA; aac(3)-IV-R (SEQ ID No. 15): TCAGCCAATCGACTGGCGAG.
[0049] The application further provides application of the recombinant Streptomyces or the recombinant Streptomyces constructed by the construction method in high-yield monensin.
[0050] The application can produce monensin by a shake flask fermentation method, and in the test, the recombinant Streptomyces can be inoculated into a shake flask seed (100 mL / 500 mL) at 33.0 ℃, 180 rpm, and cultured for 24 h. Then, the shake flask seed is inoculated into a fermentation medium (50 mL / 500 mL) at 10%, and the fermentation medium is subjected to fermentation at 33.0 ℃, 200 rpm, for 12 d.
[0051] The culture medium contained in the shake flask seed of the application is: soybean cake powder 15 g / L, glucose 5 g / L, dextrin 20 g / L, yeast extract 2.5 g / L, light calcium carbonate 1 g / L, and the fermentation medium is: soybean cake powder 35 g / L, glucose 35 g / L, Na2SO4 2.2 g / L, K2HPO4 0.08 g / L, FeSO4·7H2O 0.1 g / L, Al2(SO4)3 0.7 g / L, soybean oil 45 g / L, and CaCO3 2.5 g / L.
[0052] In order to further illustrate the application, the genes, vectors and strains for improving reducing power and high-yield monensin by multi-gene synergistic expression provided by the application are described in detail in combination with examples below, but they should not be understood as limiting the protection scope of the application.
[0053] The test methods used in the examples of the application are all conventional methods in the art, unless otherwise specified, and the conventional methods are as follows: 1. Enzyme activity determination Streptomyces cinnamonensis cells were resuspended in 100 mM Tris-HCl buffer (pH 7.5) containing 20% glycerol and 1 mM dithiothreitol. Subsequently, the cell suspension was placed in an ice bath and treated using an ultrasonic cell disruptor. Enzyme activity was determined spectrophotometrically, glucose-6-phosphate dehydrogenase (G6PDH) activity was calculated by monitoring the increase in absorbance of NADPH at 340 nm, the reaction temperature was 30 °C [Improved oxytetracycline production in Streptomyces rimosus M4018 by metabolic engineering of the G6PDH gene in the pentose phosphate pathway]; 6-phosphogluconate dehydrogenase enzyme activity was determined according to the method of the reference [Red cell metabolism. A manual of biochemical methods]. Calculated in units of absorbance change per minute 0.01, according to the following formula.
[0054] ; In the formula: U: enzyme activity; A: change in absorbance value within the reaction time; t: reaction time (min); D: dilution factor.
[0055] 2. NADPH and NADH content determination Kit method: Take an appropriate amount of mycelium, homogenize with 0.1 M Tris-HCl (pH 7.5), centrifuge to take the supernatant; detect NADPH (refer to the NADP+ / NADPH detection kit (WST-8 method) of Biyun Tian) and NADH (refer to the NAD+ / NADH detection kit (WST-8 method) of Biyun Tian) respectively.
[0056] 3. Monensin shake flask fermentation Inoculate single bacteria into shake flask seed (100 mL / 500 mL), 33.0 °C, 180 rpm, cultivate for 24 h. Then, transfer into fermentation medium (50 mL / 500 mL) according to the inoculation amount of 10%, 33.0 °C, 200 rpm, ferment for 12 d.
[0057] 4. Monensin content determination Take 1.0 g of fermentation broth and mix well with 50 mL of methanol. Then the mixture is subjected to ultrasonic treatment with the parameter setting of 260 W power, pulse on for 2 seconds, pulse off for 2 seconds, and the total duration of 30 minutes. Subsequently, the crude extract is filtered through a 0.45 μm organic filter membrane and transferred to a liquid phase vial. High performance liquid chromatography is used with a C18 column (250 x 4.6 mm, 5 μm) and a mobile phase of methanol: water: glacial acetic acid (94:6:0.1). The flow rate is set to 0.7 mL / min. The detection wavelength is 520 nm, and the injection volume is 20.0 μL. The derivatization temperature is maintained at 98 °C. The diluent consists of a 90:10 mixture of methanol and water.
[0058] Example 1 The following experiments were carried out according to the flowchart shown in Figure 10 (1) PCR amplification of fragments and recovery Using the extracted S. cinnamomicus genome as a template, PCR amplification was performed using high-fidelity enzyme 2xSuper Pfx Master Mix with zwf-F and zwf-R as primers to obtain the zwf fragment shown in Figure 9 Using the extracted S. cinnamomicus genome as a template, PCR amplification was performed using high-fidelity enzyme 2xSuper Pfx Master Mix with gnd-F and gnd-R as primers to obtain the gnd fragment shown in Figure 9 Using the extracted S. cinnamomicus genome as a template, PCR amplification was performed using high-fidelity enzyme 2xSuper Pfx Master Mix with fadB -F and fadB -R as primers to obtain the fadB fragment shown in Figure 9 Using the pSET152 plasmid (containing the ermE promoter and fd terminator) as a template, reverse PCR amplification was performed using high-fidelity enzyme 2xSuper Pfx Master Mix with P-F and P-R as primers to obtain the linearized pSET152 plasmid fragment; (2) Gibson assembly The linearized vector was assembled with zwf, gnd, fadB, and the three fragments respectively using Hieff Clone® Plus Multi One Step Cloning Kit for Gibson assembly, obtaining pSET152-PermE zwf-fd Ter, pSET152-PermE gnd-fd Ter, pSET152-PermE fadB-fd Ter, pSET152-PermE zwf-gnd-fd Ter, pSET152-PermE zwf-fadB-fd Ter, pSET152-PermE gnd-fadB-fd Ter and pSET152-PermE zwf-gnd-fadB-fd Ter recombination vector The reaction conditions are single fragment connection 50℃, 10 min; multi-fragment connection 50℃, 20~30 min; and the reaction system is: Clone® Plus Multi One Step Cloning Kit 5 μL, pre-linearized pSET152 containing the start PermE and the end fd terminator 0.02 pmol, zwf / gnd / fadB 0.02 pmol.
[0059] (3) Bacterial transformation, colony PCR identification and identification of combined transfer and recombination plasmid The recombination plasmid is transformed into E. coli JM109 competent cells, and positive clones are screened by PCR and sent for sequencing verification. The correct recombination plasmid is further transformed into E. coli ET12567 / pUZ8002 donor bacteria. Then, intergeneric conjugation transfer is carried out, and the donor bacteria are amplified in three-antibiotic (Apr, Chl, Kan) LB medium, and then prepared by washing with MgCl2-free LB medium; the recipient bacteria SDSL6002 are cultured in SM medium, and then the competent cells are prepared by repeatedly washing the mycelium in 2×YT medium. The donor and recipient bacteria are mixed at a ratio of 1:1 and coated on an antibiotic-free MS plate, and then incubated at 30℃ for 18 h, and then covered with sterile water containing Nal and Apr for resistance screening. After 7 days of culture, the conjugants are picked and subjected to genome PCR, using aac(3)-IV-F and aac(3)-IV-R as primers to amplify the apramycin resistance marker. The positive strain obtained is verified by three generations of antibiotic-free slant culture to stabilize the genetic inheritance, and spores are collected. The whole process is confirmed by DNA sequencing comparison to ensure the correct integration of the genome, and to ensure the successful construction of the overexpression strain.
[0060] Using the method described in the application, single gene overexpression strains (S-zwf, S-gnd and S-fadB), double gene overexpression strains (S-zwf-gnd, S-zwf-fadB, S-gnd-fadB), triple gene co-expression strains (S-zwf-gnd-fadB) and empty vector control strains (S-pSET152) are successfully constructed.
[0061] Compared with the wild-type WT strain SDSL6002, the intracellular NADPH level and monensin fermentation titer of the single-gene overexpression strain S-zwf were as follows: Figure 1 As shown, overexpression of the glucose-6-phosphate dehydrogenase gene (zwf) effectively enhances the pentose phosphate pathway. The results showed that the intracellular NADPH content of the recombinant strain S-zwf was significantly increased compared to the wild-type strain, with an increase of approximately 1.8-fold, confirming the key role of this gene in enhancing reducing power supply. However, the monensin fermentation titer of this strain did not show a significant improvement compared to the wild-type. This result indicates that although overexpression of the zwf gene alone successfully drives intracellular NADPH production, the single enhancement of reducing NADPH is insufficient to effectively promote the biosynthesis of monensin. This result indirectly demonstrates that the efficient synthesis of monensin is a complex metabolic engineering problem, which, in addition to reducing power supply, strictly depends on the sufficient supply of synthetic precursors (such as methylmalonyl-CoA).
[0062] Compared with wild-type WT, the assay results of the single-gene overexpression strain S-gnd are as follows: Figure 2 As shown, overexpression of the 6-phosphoglucate dehydrogenase gene (gnd) also aims to enhance the latter part of the pentose phosphate pathway. The results showed that the intracellular NADPH content of the recombinant strain S-gnd was significantly increased compared to the wild-type strain, similar to the effect of overexpressing the zwf gene, further confirming the effectiveness of the strategy of enhancing reducing power supply by modifying the pentose phosphate pathway. However, consistent with the results of the S-zwf strain, despite the significantly increased NADPH level, the monensin fermentation titer of the S-gnd strain was not effectively improved. This result is consistent with... Figure 1 Together, these findings form a strong chain of evidence indicating that while enhancing the pentose phosphate pathway (either the first or second part) to provide NADPH can successfully increase intracellular reducing power levels, it is not the sole key factor limiting monensin synthesis. This further supports the aforementioned analysis: high monensin production requires a synergistic effect between reducing power supply and precursor supply. Compared with wild-type WT, the assay results of the single-gene overexpression strain S-fadB are as follows: Figure 3As shown, strain S-fadB directly intervenes in the fatty acid β-oxidation pathway by overexpressing the 3-hydroxyacyl-ACP dehydratase gene. Experimental data show that the intracellular NADH content of this strain was significantly increased, indicating that overexpression of the fadB gene effectively enhances the reducing power regeneration capacity of this metabolic pathway. More importantly, unlike strains that overexpress zwf or gnd genes alone, strain S-fadB showed a significant increase in monensin fermentation titer. This result confirms that regulating the fatty acid metabolic pathway through the fadB gene not only directly replenishes the reducing power NADH required for monensin synthesis, but more importantly, promotes fatty acid degradation, providing essential precursors for monensin synthesis, thereby achieving an effective increase in yield.
[0063] The results of the assay for the three-gene co-expression strain S-zwf-gnd-fadB are as follows: Figure 4 As shown, the zwf, gnd, and fadB genes are co-expressed in tandem through a strong promoter. Figure 4 (A); Compared with wild-type WT, the NADPH and NADH contents of the three-gene co-expression strain S-zwf-gnd-fadB were significantly increased ( Figure 4 The co-expression of the three genes (BC) enhanced intracellular reducing power supply; the monensin titer of the engineered strain was significantly higher than that of the wild type, indicating that the co-expression of the three genes effectively promoted the biosynthesis of monensin by enhancing reducing power. Figure 4 (D).
[0064] The assay results of the dual-gene overexpression strain S-zwf-gnd are as follows: Figure 5 As shown, the zwf and gnd genes are co-expressed in tandem under the strong promoter PermE. Figure 5 (A); Compared with wild-type WT, the NADPH content of the dual-gene overexpression strain S-zwf-gnd was significantly increased ( Figure 5 (B); the monensin titer of this engineered strain was also significantly higher than that of the wild type ( Figure 5 (C). In summary, overexpression of both zwf and gnd genes provides sufficient reducing power for monensin biosynthesis by enhancing intracellular NADPH synthesis, ultimately significantly improving monensin potency.
[0065] Dual gene overexpression strains S- The measurement results of zwf-fadB are as follows: Figure 6 As shown, the zwf and fadB genes are co-expressed in tandem under the strong promoter PermE. Figure 6 Compared with wild-type WT, the NADPH and NADH contents of the dual-gene overexpression strain S-zwf-fadB were significantly increased (A); Figure 6 The monensin titer of this engineered strain was significantly higher than that of the wild type (BC), which enhanced the supply of intracellular reducing power.Figure 6 (D). In summary, overexpression of the zwf and fadB genes provides sufficient energy for monensin biosynthesis by enhancing intracellular reducing power (NADPH, NADH), ultimately significantly improving monensin potency.
[0066] The assay results of the dual-gene overexpression strain S-gnd-fadB are as follows: Figure 7 As shown, the gnd and fadB genes are co-expressed in tandem under the strong promoter PermE. Figure 7 (A); Compared with wild-type WT, the NADPH and NADH contents of the dual-gene overexpression strain S-gnd-fadB were significantly increased ( Figure 7 The monensin titer of this engineered strain was significantly higher than that of the wild type (BC), which enhanced the supply of intracellular reducing power. Figure 7 (D). In summary, overexpression of both gnd and fadB genes provides sufficient energy for monensin biosynthesis by enhancing intracellular reducing power (NADPH, NADH), ultimately significantly improving monensin potency.
[0067] Compared with wild-type WT, the assay results of the empty vector control strain (S-pSET152) are as follows: Figure 8 As shown, the NADPH and NADH contents of the empty vector control strain S-EV were not significantly different from those of the wild-type WT. Figure 8 The results (AB) indicate that the introduction of the empty vector did not change the intracellular reducing power level; the monensin titers of the two were also basically the same. Figure 8 (C). This indicates that the vector itself does not interfere with the reducing power metabolism and monensin synthesis of the strain, verifying that the phenotypic changes in the previously overexpressed strains were caused by the target gene (not the vector), thus ensuring the validity of the experimental control.
[0068] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A high-reducing-power donor fusion gene, characterized in that, It is composed of the genes encoding glucose-6-phosphate dehydrogenase, 6-phosphate gluconate dehydrogenase, and 3-hydroxyacyl-ACP dehydratase, linked in tandem.
2. The high-reducing-power donor fusion gene according to claim 1, characterized in that, The nucleotide sequence of the gene encoding glucose-6-phosphate dehydrogenase is shown in SEQ ID No. 1, the nucleotide sequence of the gene encoding 6-phosphate gluconate dehydrogenase is shown in SEQ ID No. 2, and the nucleotide sequence of the gene encoding 3-hydroxyacyl-ACP dehydratase is shown in SEQ ID No.
3.
3. A recombinant expression vector, characterized in that, It contains the high reducing power donor fusion gene as described in claim 1 or 2.
4. The recombinant expression vector according to claim 3, characterized in that, The recombinant expression vector contains a PermE strong promoter, a multiple cloning site, and an fd transcription terminator; wherein the high-reducing-potency donor fusion gene is located at the multiple cloning site, and the PermE strong promoter is connected upstream of the high-reducing-potency donor fusion gene, and the fd transcription terminator is located downstream of the high-reducing-potency donor fusion gene. The nucleotide sequence of the PermE strong promoter is shown in SEQ ID No. 4, and the nucleotide sequence of the fd transcription terminator is shown in SEQ ID No.
5.
5. The recombinant expression vector according to claim 4, characterized in that, The backbone of the recombinant expression vector is the pSET152 plasmid.
6. The method for constructing the recombinant expression vector according to any one of claims 3 to 5, characterized in that, The process includes the following steps: assembling a zwf gene fragment containing a glucose-6-phosphate dehydrogenase encoding gene, a gnd gene fragment containing a 6-phosphate gluconate dehydrogenase encoding gene, a fadB gene fragment containing a 3-hydroxyacyl-ACP dehydrase encoding gene, and a linearized vector fragment to obtain the recombinant expression vector. The linearized vector fragment contains the PermE strong promoter, the vector backbone, and the fd transcription terminator.
7. The construction method according to claim 6, characterized in that, The zwf, gnd, and fadB gene fragments were all obtained by amplification from the genome of *Streptomyces cinnamon* via PCR; wherein, the amplified zwf, gnd, and fadB gene fragments were... zwf The nucleotide sequences of the primer pairs used to amplify the gene fragment are shown in SEQ ID No. 6 and SEQ ID No. 7, the nucleotide sequences of the primer pairs used to amplify the gnd gene fragment are shown in SEQ ID No. 8 and SEQ ID No. 9, and the nucleotide sequences of the primer pairs used to amplify the fadB gene fragment are shown in SEQ ID No. 10 and SEQ ID No.
11.
8. A recombinant Streptomyces, characterized in that, The recombinant Streptomyces comprises the recombinant expression vector according to any one of claims 3 to 5, or is obtained by transforming Streptomyces with a recombinant expression vector constructed by the construction method according to claim 6 or 7.
9. A method for constructing the recombinant Streptomyces of claim 8, characterized in that, include: The recombinant expression vector according to any one of claims 3 to 5, or the recombinant expression vector constructed using the construction method of claim 6 or 7, is introduced into a Streptomyces host via indirect synergistic transfer, and positive transformants are obtained by screening, thus obtaining the recombinant Streptomyces.
10. A method for producing monensin, characterized in that, include: The recombinant Streptomyces of claim 8 is cultured, and monensin is harvested from the culture product.
Citation Information
Patent Citations
Building method and application of recombinant engineering bacteria for increasing yield of monensin
CN108004194A
Construction method and applications of recombinant engineering bacteria capable of improving yield of monensin
CN108359687A
Recombinant vector for improving yield of monensin, primer group, construction method, engineering bacterium and application
CN119040369A