Polynucleotide encoding fusion protein of neutrophil elastase and application thereof

Abstract

The invention discloses nucleotide of fusion protein for coding neutrophil elastase and application of the nucleotide. A nucleotide sequence for coding the fusion protein is as shown in SEQ ID NO. 8; the nucleotide sequence of mRNA (messenger ribonucleic acid) for coding the fusion protein is as shown in SEQ ID NO. 12; the fusion protein comprises an optimized human neutrophil elastase (ELANE) fragment and an optimized human alpha2-macroglobulin (A2M) fragment. The mRNA preparation which is encapsulated by the nano-lipid particles and is used for coding the wild type ELANE can achieve a tumor elimination effect only by complex intratumor injection. According to the mRNA preparation which is encapsulated by the nano-lipid particles and is used for coding the ELANE fusion protein, tumor elimination in a mouse body can be realized only through intramuscular injection administration, the operation is simpler and more convenient, and the mRNA preparation is beneficial to treatment of scattered and tiny tumor focuses in the body.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a polynucleotide encoding neutrophil elastase fusion protein and application thereof. BACKGROUND

[0002] Human neutrophil elastase (ELANE) is a serine protease. Recent studies have shown that this protease can selectively kill tumor cells in vitro but not normal cells, thus having potential anti-tumor applications. However, this protein is not resistant to serine protease inhibitors, as reported in a paper (doi: 10.1016 / j.cell.2021.04.016) that wild-type ELANE is easily inhibited by the widely existing serine protease inhibitors in the body, thus reducing the tumor elimination effect. The paper reports that the remaining enzyme activity of human natural ELANE (Elastin Products Company, item number SE563) is 0% after being treated with 50 nM α-1-antitrypsin (A1AT).

[0003] Alpha2-macroglobulin (A2M) is a glycoprotein with a large molecular weight (about 720 kDa) in human plasma, and is a broad-spectrum protease inhibitor that can capture and inactivate almost all proteolytic enzymes such as serine proteases and metalloproteinases through a unique "trap" mechanism. Patent WO2024211493A2 discloses a protein complex formed by mixing A2M and serine proteases (such as PPE, ELANE, etc.) at an optimal ratio. This complex retains the enzyme cutting activity of serine proteases on natural substrates CD95 and the tumor cell killing activity, but inhibits the binding of serine proteases to serine protease inhibitors in terms of spatial conformation, thus resisting the influence of various serine protease inhibitors in the body.

[0004] The mRNA vaccine technology delivers mRNA into cells in the body with the help of delivery systems such as nano-lipid particles, so that the natural protein is expressed and the corresponding function is played. This technical path not only saves the complicated process of recombinant protein preparation and formulation, but also effectively avoids the introduction of protein impurities, thus showing high application value in the fields of vaccine research and development, protein replacement therapy, etc. A paper (DOI: 10.1158 / 0008-5472.CAN-24-3914) discloses an mRNA preparation encapsulated by a lipid nanoparticle (LNP), which encodes a tumor-specific toxin protein, wild-type neutrophil elastase. The preparation can selectively kill tumor cells and stimulate T cells to infiltrate the tumor site. In this scheme, the mRNA preparation can only eliminate tumors by intratumoral injection, and other methods (such as intravenous injection, intramuscular injection, and peritumoral injection) are ineffective. However, intratumoral injection has the problems of high risk and difficulty in puncture operation, and it is extremely difficult to locate the small lesions of extensive metastasis.

[0005] Therefore, there is an urgent need in the art for a nano-lipid particle encapsulated mRNA formulation encoding ELANE that is convenient to administer. SUMMARY

[0006] The present application aims to overcome the defects of the prior art, i.e., the prior nano-lipid particle encapsulated mRNA formulation encoding wild-type ELANE can only achieve tumor elimination by complex intratumoral injection. To this end, the present application provides a novel nucleotide sequence encoding an ELANE fusion protein; the fusion protein is rationally fused from an optimized ELANE functional fragment and an optimized A2M functional fragment, which not only has higher enzyme activity, but also greatly improves the tolerance to serine protease inhibitors. The nano-lipid particle encapsulated mRNA formulation encoding the ELANE fusion protein can achieve tumor elimination effect only by intramuscular injection.

[0007] The object of the present application is achieved by the following technical solutions:

[0008] <First aspect>

[0009] The present application relates to a mRNA molecule encoding a fusion protein of neutrophil elastase.

[0010] The fusion protein comprises, in sequence from N-terminus to C-terminus, a signal peptide, an optimized neutrophil elastase fragment, a linker, and an optimized alpha2-macroglobulin fragment; the amino acid sequence of the signal peptide is shown as SEQ ID NO. 9; the optimized neutrophil elastase fragment is the 28th to 252nd amino acid of human neutrophil elastase and contains a mutation of glutamine at position 137 to proline; the amino acid sequence of the linker is shown as SEQ ID NO. 10; the optimized alpha2-macroglobulin fragment is the 575th to 1339th amino acid of human alpha2-macroglobulin and contains a mutation of cysteine at position 972 to serine; the amino acid sequence of the fusion protein is shown as SEQ ID NO. 3; and the nucleotide sequence of the fusion protein is shown as SEQ ID NO. 8.

[0011] Neutrophil elastase can selectively kill tumor cells but not normal cells, and has potential for anti-tumor applications. Alpha2-macroglobulin is a broad-spectrum protease inhibitor that can capture and inactivate almost all proteolytic enzymes such as serine proteases and metalloproteinases through a unique "trap" mechanism.

[0012] The fusion protein not only retains high protease activity of ELANE, but also effectively suppresses the inhibition of ELANE activity by a serine protease inhibitor through the action of the A2M fragment, and by truncating the A2M fragment, it is beneficial to prepare the fusion protein.

[0013] As an embodiment, the nucleotide sequence of the mRNA molecule is shown as SEQ ID NO. 12.

[0014] <Second aspect>

[0015] The present application relates to a transcription template for preparing the mRNA molecule of the first aspect.

[0016] As an embodiment, the nucleotide sequence of the transcription template is shown as SEQ ID NO. 11.

[0017] <Third aspect>

[0018] The present application relates to a method for preparing the mRNA molecule of the first aspect, comprising the following steps:

[0019] S1, gene synthesis and gene cloning: the nucleotide sequence of the transcription template (SEQ ID NO. 11) is chemically synthesized, and then inserted into the EcoRI and BsaI multiple cloning site position of the pUC57 vector by homologous recombination to construct a recombinant plasmid; the recombinant plasmid is transformed into E. coli;

[0020] S2, bacterial culture and plasmid DNA extraction, purification and linearization: the fermentation bacteria are harvested from the fermentation of E. coli; the recombinant plasmid DNA is extracted and purified from the E. coli bacteria; the recombinant plasmid is digested with restriction endonuclease BsaI, and then purified to obtain a linearized plasmid;

[0021] S3, linearized plasmid is transcribed in vitro to form mRNA: the linearized plasmid is used as a template to transcribe and purify mRNA in vitro.

[0022] <Fourth aspect>

[0023] The present application relates to an mRNA preparation comprising the mRNA molecule of the fusion protein expressing neutrophil elastase of the first aspect and a nano-lipid particle.

[0024] Compared with directly using the recombinant fusion protein, the use of the nano-liposome encapsulated mRNA preparation can save the complicated process of preparing, activating and formulating the recombinant protein, and effectively avoid the introduction of protein impurities; in addition, the preparation has a known adjuvant effect, which can enhance the immune response of the body, and is further beneficial to tumor treatment.

[0025] <Fifth aspect>

[0026] The present application relates to the use of the mRNA preparation according to the fourth aspect for the preparation of a medicament for the treatment of a tumor.

[0027] As an example, the administration route for the treatment of a tumor is intramuscular injection.

[0028] Compared with the prior art, the present application has the following beneficial effects:

[0029] (1) The present application provides an mRNA molecule (SEQ ID NO. 12) encoding a fusion protein of neutrophil elastase (No. ELANE-A2). The mRNA is encapsulated by nanolipid particles to obtain an mRNA preparation (No. LNP-ELANE-A2b), which solves the problem that the prior art mRNA preparation encapsulating wild-type ELANE can only eliminate tumors through complex intratumoral injection. The mRNA preparation of the present application can eliminate tumors in mice through intramuscular injection, which is more convenient and beneficial to the treatment of scattered and small tumor lesions in vivo.

[0030] (2) The ELANE-A2 protein is optimized to obtain the corresponding nucleotide sequence (SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8). Compared with the nucleotide sequence (SEQ ID NO. 6) obtained by optimization using a public algorithm, the preferred nucleotide sequence (SEQ ID NO. 8) of the present application significantly improves the expression level of the target protein in HEK-293 cells.

[0031] (3) LNP-ELANE-A2b has a significant effect on eliminating tumors when administered by intramuscular injection. After injection of mice with melanoma cell line B16F10, the average tumor volume of the LNP-ELANE-A2b group was reduced to 92mm 3 , which is significantly lower than that of the wild-type ELANE group (i.e. ELANE-wt group, 1108mm 3 ).

[0032] (4) LNP-ELANE-A2b is safe for administration to mice. The AST, ALT, PT, and APTT of 6-8 week old C57BL / 6 mice were measured 1 day and 14 days after administration of the drug to the hind limbs, and no abnormalities were found. The animals had normal diet, weight, activity, and mental state.

[0033] (5) LNP-ELANE-A2b has a significant killing effect on mouse melanoma cells B16F10 in vitro, and shows a clear dose-dependent effect.

[0034] (6) Compared with commercial ELANE, the enzyme activity of the fusion protein encoded by the mRNA molecule corresponding to the nucleotide sequence of the application is increased by 0.7 times, the resistance to the ubiquitous serine protease inhibitor (such as A1AT) in the body is greatly improved, and it is possible that this is an important mechanism for LNP-ELANE-A2b to achieve efficient elimination of tumors by intramuscular injection. BRIEF DESCRIPTION OF DRAWINGS

[0035] Other features, objects, and advantages of the application will become more apparent from the following detailed description of non-limiting embodiments, made with reference to the following drawings.

[0036] Figure 1 Each mRNA agarose gel electrophoresis chart;

[0037] Figure 2 Transmission electron microscope observation morphology chart of sample LNP-ELANE-A2b;

[0038] Figure 3 Western blot detection of ELANE expression results chart;

[0039] Figure 4 Tumor growth curve in each group of mice after intramuscular injection administration;

[0040] Figure 5 Observation of the morphology of tumors in each group of mice at the end of the observation;

[0041] Figure 6 LNP-ELANE-A2b in vitro killing B16F10 tumor cell results chart. DETAILED DESCRIPTION

[0042] The application will be described in detail below with reference to the examples. The following examples will help those skilled in the art to further understand the application, but do not limit the application in any form. It should be noted that for those skilled in the art, without departing from the concept of the application, a number of adjustments and improvements can be made. These all belong to the protection scope of the application.

[0043] Example 1, protein design

[0044] The full-length amino acid sequence of human neutrophil elastase (ELANE) was downloaded from GenBank (Accession No. P08246, numbered ELANE-wt). Based on the random mutation of ELANE and the docking study with the natural substrate CD95 molecule of ELANE, a mutant of human neutrophil elastase with theoretically higher affinity to CD95 was obtained. Based on the prediction of the 3D structure of the functional fragment of alpha-2-macroglobulin (A2M) and the docking study with the ELANE molecule, a functional fragment of alpha-2-macroglobulin with theoretically high affinity was obtained. Further, the human neutrophil elastase mutant and these alpha-2-macroglobulin functional fragments were combined into fusion proteins: fusion protein 1 (numbered ELANE-A1), fusion protein 2 (numbered ELANE-A2), the amino acid sequences of ELANE-wt, ELANE-A1, and ELANE-A2 are SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3, respectively. The design and introduction of each protein are shown in Table 1.

[0045] Using humans as expression hosts, the codon optimization of the ELANE-wt, ELANE-A1, and ELANE-A2 protein sequences was performed using a public platform (University of Queensland, mRNArchitect) to obtain the nucleotide sequences of ELANE-wt, ELANE-A1, and ELANE-A2. Further codon optimization of the ELANE-A2 protein sequence resulted in two new nucleotide sequences, numbered ELANE-A2a and ELANE-A2b. The nucleotide sequences of ELANE-wt, ELANE-A1, ELANE-A2, ELANE-A2a, and ELANE-A2b are SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8, respectively.

[0046] Table 1 Protein design

[0047] Protein No. Protein design (from N-terminal to C-terminal) ELANE-wt ELANE 1-267 ]] ELANE-A1 Signal peptide - ELANE 28-252（Q137P） - Linker - A2M 564-1468（C972S） ]]> ELANE-A2 Signal peptide - ELANE 28-252（Q137P） - Linker - A2M 575-1339（C972S） ]]>

[0048] The signal peptide in Table 1 has the amino acid sequence METDTLLLWVLLLWVPGSTGD (SEQ ID NO. 9), which is used to promote protein expression and secretion into the extracellular space, and is cleaved during protein expression and secretion; ELANE and A2M are human neutrophil elastase (Neutrophil elastase). ELANE (Accession No. P08246) and human α2-macroglobulin (Accession No. P01023); subscripts 1-267 and 28-252 are amino acid sequence fragments of ELANE (amino acid sequences 1-267 and 28-252, respectively); subscripts 564-1468 and 575-1339 are amino acid sequence fragments of A2M (amino acid sequences 564-1468 and 575-1339, respectively); Q137P and C972S are glutamine-proline mutation at position 137 in ELANE and cysteine-serine mutation at position 972 in A2M, respectively; the linker amino acid sequence is GGGGSGGGGS (SEQ ID NO. 10), used to reduce functional interference between proteins.

[0049] Example 2: Construction of Transcription Template and Recombinant Plasmid

[0050] A transcription template for ELANE-A2b (numbered mELANE-A2b) was constructed, and its nucleotide sequence is shown in SEQ ID NO.11. From the 5' end to the 3' end, it consists of: EcoRI restriction site sequence, T7 promoter sequence, 5' untranslated region (5' UTR) sequence, the nucleotide sequence corresponding to the target protein ELANE-A2b, the 3' untranslated region (3' UTR) sequence, poly(A)tail, and BsaI restriction site sequence. The nucleotide sequence corresponding to the target protein in the above transcription template sequence was replaced with the nucleotide sequences of ELANE-wt, ELANE-A1, ELANE-A2, or ELANE-A2a, respectively, to obtain transcription template sequences for four other mRNAs (numbered mELANE-wt, mELANE-A1, mELANE-A2, and mELANE-A2a, respectively). Five transcription template sequences were chemically synthesized and inserted into the EcoRI / BsaI multiple cloning site of the pUC57 vector via homologous recombination to obtain five recombinant plasmid DNAs (numbered pELANE-wt, pELANE-A1, pELANE-A2, pELANE-A2a, and pELANE-A2b, respectively). These were further transformed to obtain competent Escherichia coli DH5α (numbered dELANE-wt, dELANE-A1, dELANE-A2, dELANE-A2a, and dELANE-A2b, respectively), and the results were verified by sequencing.

[0051] Example 3: Escherichia coli fermentation and preparation of recombinant plasmids

[0052] Escherichia coli fermentation: DH5α strains of Escherichia coli (numbered dELANE-wt, dELANE-A1, dELANE-A2, dELANE-A2a, and dELANE-A2b, respectively) were inoculated into 500 mL of LB medium containing antibiotic (100 μg / mL ampicillin) and cultured with shaking at 28–32 °C until OD (dose retardation). 600 When the OD value is around 2.0–4.0, inoculate the seed culture into a 5L fermenter at an inoculation rate of 0.5–3% for fermentation culture. When the cell OD value reaches approximately 2.0–4.0, the fermentation culture continues. 600 When the value reaches approximately 80-100, the bacterial cells are collected by centrifugation. The wet weights are 924g, 918g, 1142g, 937g, and 902g respectively, which meet the requirements.

[0053] Plasmid DNA extraction: (1) Take 200g of harvested E. coli fermentation cells and add 1.6L of solution I stored at 4℃ at a mass-to-volume ratio of 1:8 (cells to solution I (50mM Tris-HL, 10mM EDTA, pH 8.0)). Stir until dissolved. (2) After dissolution, add 1.6L of solution II (0.2M NaOH, 1.0% SDS), stir slowly, and then let stand for 3-10 minutes. (3) After the reaction is complete, add 1.6L of solution III (3M KAC, pH 5.5, pre-cooled at 4℃), shake well, and let stand for 30 minutes. (4) After the reaction is complete, add 1.6L of 2M CaCl2 solution, shake gently, and let stand for 1 hour. The lysate solution will separate into two layers, with the upper layer being solid and the lower layer being liquid. The liquid will be pumped out and filtered through a 1.0μm pore size filter to remove impurities. (5) Filter the lysis buffer through a 300KD hollow fiber ultrafiltration membrane on a Quickstand ultrafiltration system for 1.5 hours, concentrating it to 8 times its volume. (6) Purify the plasmid using DEAE (GE Healthcare Life Science, USA) in an AKTA purifier system. Equilibrate 5 column volumes with loading buffer (0.55M NaCl, 50mM Tris-HCl, 10mM EDTA, pH 8.0), and elute the sample with a gradient of elution buffer (0.65M NaCl, 50mM Tris-HCl, 10mM EDTA, pH 8.0). (7) Equilibrate 3 column volumes of Capto™ core 700 (GE Healthcare Life Science, USA) resin with PBS, then load the sample collected after purification by the ion exchange column, elute with PBS, and collect the eluted sample. (8) A 100 kDa hollow fiber ultrafiltration membrane (GE HealthcareLife Science, USA, membrane area 500 cm²) was used on a Quickstand ultrafiltration separation system. 2 (Membrane fiber tube diameter 1mm) Concentration and percolation, transmembrane pressure (TMP) 1psi, concentration factor 8 times, percolation factor 8 times.

[0054] The four template plasmid DNAs obtained (numbered pELANE-wt, pELANE-A1, pELANE-A2, pELANE-A2a, and pELANE-A2b, respectively) had masses of 118 mg, 127 mg, 153 mg, 124 mg, and 141 mg, respectively. The A260 / A280 ratio was between 1.8 and 2.0. The supercoil ratio was greater than 90% as determined by agarose gel electrophoresis, and the size was correct as determined by BsaI restriction enzyme digestion and agarose gel electrophoresis. All prepared plasmid DNAs met the requirements (see Table 2).

[0055] Table 2 Plasmid DNA Preparation

[0056] No. Mass / 200g of bacterial cells Purity (A260 / A280) Supercoiling ratio / % ELANE-wt 118mg 1.91 91% ELANE-A1 127mg 1.93 90% ELANE-A2 153mg 1.89 94% ELANE-A2a 124mg 1.82 93% ELANE-A2b 141mg 1.93 93%

[0057] Example 4: Preparation of mRNA

[0058] (1) Linearization and purification of plasmid: The recombinant plasmid was linearized by restriction endonuclease BsaI (Suzhou Nearshore Protein Technology Co., Ltd., catalog number GMP-RE036) with a dosage of 100 mg. After digestion, the plasmid was purified using Capto Q ImpRes (Source 30 Q) (Cytiva) (loading buffer: 10 mM PBS, pH 7.4; elution buffer: 10 mM PBS, 500 mM NaCl, pH 7.4) to obtain the linearized plasmid.

[0059] (2) In vitro transcription: Linear mRNA was generated using the EasyCap T7 Co-transcription Kit with CAG Trimer (Nanjing Novizan Biotechnology Co., Ltd., catalog number DD4203-00) with a linearized plasmid as a template. The linear mRNA contained a Cap1 analog structure, a 5' UTR, the target protein corresponding nucleotide, a 3' UTR, and a Poly(A) tail from the 5' end to the 3' end, with uracil modified by N1-methyl-pseudouracil. The transcription products were purified using the BeyoMag™ magnetic bead mRNA purification kit (Beyotime Biotechnology Co., Ltd., catalog number R0071L) to obtain the target mRNA molecules. The purity was above 90% by agarose gel electrophoresis (see Figure 1 (This meets the requirements.) The mRNA sequence encoding ELANE-A2b is shown in SEQ ID NO.12.

[0060] Example 5: Preparation of lipid nanoparticles (LNP)

[0061] mRNA nanolipid particles were prepared using an LNP encapsulation kit (Navitech (Shanghai) Nanotechnology Co., Ltd., catalog number: N01001050). Five RNA molecules (mELANE-wt, mELANE-A1, mELANE-A2, mELANE-A2a, and mELANE-A2b) were diluted to a concentration of 100 μg / mL using a citrate-sodium citrate solution (pH 4.0). The diluted RNA and lipid solution were then mixed in an LNP microfluidic preparation system (NexSTARnano1, Shanghai Nanotechnology Co., Ltd.) to prepare LNP samples (LNP-ELANE-wt, LNP-ELANE-A1, LNP-ELANE-A2, LNP-ELANE-A2a, and LNP-ELANE-A2b). The volume ratio of RNA to lipid solution was 3:1, and the flow rate ratio was 9 ml / min to 3 ml / min. An equal volume of citrate-sodium citrate solution (pH 4.0) was added to the collected samples. 4.0) Dilution: Concentrate the sample twice using a 30KD ultrafiltration tube, then add 15 times the volume of PBS to reduce the ethanol content in the sample to below 0.5%. Finally, add PBS buffer containing 10% sucrose and ultrafilter to concentrate the mRNA content to 200 μg / mL. The final sample is obtained by sterile filtration.

[0062] The average particle size of LNP particles was measured using dynamic light scattering on a Malvern Zetasizer Nano-ZEN 3600 (Malvern) potential-laser particle size analyzer. The particle size range was 90-120 nm, the polydispersity index (PDI) was less than 0.3, and the surface potential was negative. The encapsulation efficiency was determined to be no less than 90% using the Quant-iT™ RiboGreen™ RNA Assay Kit (Invitrogen, catalog number R11490). The physical parameters of each sample met the requirements (see Table 3).

[0063] Its morphology was observed using transmission electron microscopy, and the morphological results of LNP-ELANE-A2b are shown below. Figure 2 Under an electron microscope, the particles are uniform in morphology, have a consistent distribution, and exhibit distinct structural features. Their size and morphology meet the requirements.

[0064] Table 3 Characterization of LNP-mRNA samples

[0065] No. Particle size (nm) PDI Surface potential (mV) Encapsulation efficiency (%) LNP-ELANE-wt 104 0.13 -3.7 91 LNP-ELANE-A1 97 0.09 -2.8 95 LNP-ELANE-A2 113 0.05 -2.1 94 LNP-ELANE-A2a 101 0.11 -3.5 92 LNP-ELANE-A2b 117 0.16 -2.7 94

[0066] Example 6: LNP Sample Expression Analysis

[0067] Further investigation was conducted to determine the expression of five LNP samples (LNP-ELANE-wt, LNP-ELANE-A1, LNP-ELANE-A2, LNP-ELANE-A2a, and LNP-ELANE-A2b) in mammalian cells. HEK-293 cells were cultured at 5 × 10⁻⁶ cells / year. 4 Cells were seeded per well in cell culture plates. When the cell confluence reached 30-50%, the cell culture medium was aspirated, and 0.1 μg of LNP sample was added to each well for transfection. Untransfected cells served as a blank control. Twenty-four hours after transfection, ELANE protein expression in each group was analyzed by Western blot (denaturing non-reducing electrophoresis). The monoclonal antibody used for detection was HRP-mouse anti-neutrophil elastase monoclonal antibody (Santa Cruz Animal Health, catalog number SC-55549 HRP).

[0068] The results are as follows Figure 3 As shown, no signal was detected at the target protein location in the blank control group, while signals were detected at the target protein location in all five LNP groups: LNP-ELANE-wt, LNP-ELANE-A1, LNP-ELANE-A2, LNP-ELANE-A2a, and LNP-ELANE-A2b. This indicates that the five LNP samples were successfully prepared. Furthermore, the target protein expression level in the LNP-ELANE-A2b group was significantly higher than that in the LNP-ELANE-A2 and LNP-ELANE-A2a groups.

[0069] Example 7: Tumor elimination effect in mice

[0070] Mouse melanoma cell line B16F10 was cultured to the logarithmic growth phase, harvested by trypsin digestion, resuspended in PBS, and counted. Six- to eight-week-old female C57BL / 6 mice were randomly divided into three groups of four each, and each group received a subcutaneous injection of 1×10⁻⁶ cells on the right side of the back. 6 Cells / mouse, wait until the tumor grows to 50-100mm 3 Each LNP sample (numbered LNP-ELANE-wt, LNP-ELANE-A1, and LNP-ELANE-A2b) was administered via intramuscular injection into the hind limb, with an injection volume of 50 μL (10 μg / animal). The medication was administered twice daily, on days 0 and 3. Tumor length and width were measured daily using calipers, and tumor volume (0.5 × length × width) was calculated. 2 When the tumor volume in the LNP-ELANE-wt group mice reached 1000 mm², 3 The test will be terminated when the above conditions are met.

[0071] Tumor growth curve results are shown in Figure 4LNP-ELANE-A2b, administered intramuscularly, exhibited a significant tumor-eliminating effect. At the end of the observation period (day 5 after the first dose), the average tumor volume in the LNP-ELANE-A2b group decreased to 92 mm. 3 It was significantly smaller than that of the ELANE-wt group (1108 mm). 3 ) and LNP-ELANE-A1 group (894mm) 3 ), the results are shown Figure 5 .

[0072] Example 8: Effects on normal physiology in mice

[0073] Female C57BL / 6 mice aged 6-8 weeks were randomly divided into 4 groups of 3 mice each. Each group received an intramuscular injection of 50 μL PBS or 50 μL LNP-ELANE-A2b (10 μg / mouse) in their hind limbs daily, once on day 0 and once on day 3. Blood samples were collected 1 day and 14 days after the last injection to measure AST (aspartate aminotransferase) and ALT (alanine aminotransferase) levels, as well as PT (prothrombin time) and APTT (activated partial thromboplastin time). The method was as follows: Mice were anesthetized with isoflurane at a rate of 0.41 ml / min, and blood was collected via cardiac puncture, with 3.2% sodium citrate added for anticoagulation. PT and APTT were measured using the Sysmex CA-7000 fully automated blood coagulation analysis system; AST and ALT were measured using the Amplex Red Alanine Transaminase Activity Assay Kit (Beyotime, catalog number P2711S) and the Amplex Red Aspartate Transaminase Activity Assay Kit (Beyotime, catalog number P2715S), respectively.

[0074] The results of PT and APTT measurements are shown in Table 4. Compared with the control group, intramuscular injection of LNP-ELANE-A2b at double the dose did not alter PT and APTT in mice, indicating that it did not affect the normal function of fibrinogen in mice. The results of AST and ALT measurements are shown in Table 5. Compared with the control group, intramuscular injection of ELANE-A2b at double the dose did not alter the levels of AST and ALT in the blood of mice, indicating that there was no liver toxicity. Throughout the observation period, the mice maintained normal food and water intake, weight gain, daily activities, and mental state, indicating that LNP-ELANT-A2b did not affect the normal physiological functions of mice and that its administration was safe.

[0075] Table 4. PT and APTT values ​​(mean ± SD, n=3) in C57BL / 6 mice after intramuscular injection.

[0076]

[0077] Table 5. ALT and AST levels in the blood of C57BL / 6 mice after intramuscular injection (mean ± SD, n=3)

[0078]

[0079] Example 9: In vitro tumor killing effect

[0080] Materials: Mouse melanoma cells B16F10 were purchased from Wuhan Pronosei Life Science Technology Co., Ltd.

[0081] Methods: Tumor cells were added to 96-well plates at a density of 10,000 cells / well. Once the cell density reached 70-90% confluence, different concentrations of LNP-ELANE-A2b (0.05 μg / ml, 0.5 μg / ml, and 1 μg / ml) were added, with the untreated group serving as a control. The plates were incubated at 37°C with 5% CO2 for 72 hours. The cell supernatant was removed, and cell morphology was observed and recorded under a microscope. Cell culture and observation were performed in the cell culture room of the School of Pharmacy, Shanghai Jiao Tong University.

[0082] Result: See Figure 6 The untreated group showed normal cell morphology, while LNP-ELANE-A2b significantly killed mouse melanoma cells B16F10, exhibiting a clear dose-dependent effect. The selective killing effect of LNP-ELANE-A2b on tumor cells is an important mechanism for tumor elimination.

[0083] Example 10: Preparation, activity analysis, and A1AT tolerance analysis of the fusion protein.

[0084] The ELANE-A2 protein was further expressed in CHO cells to characterize it. To facilitate the purification of the target protein, a linker arm (amino acid sequence GGGSGGGS, nucleotide sequence GGCGGCGGCAGCGGCGGCGGCAGC) and a purification tag (amino acid sequence DYKDDDDK, nucleotide sequence GACTACAAGGACGACGATGACAAG) and a purification tag (amino acid sequence DYKDDDDK, nucleotide sequence GACTACAAGGACGACGATGACAAG) were sequentially added to the C-terminus of the above ELANE-A2 protein (amino acid sequence GGGSGGGS, nucleotide sequence GGCGGCGGCAGCGGCAGC) to obtain the recombinant protein ELANE-A2c, whose amino acid and nucleotide sequences are shown in SEQ ID NO.13 and SEQ ID NO.14, respectively. The ELANE-A2c protein was prepared by Shanghai Angmei Biotechnology Co., Ltd., with CHO cells as the expression host and pcDNA2B.1 as the expression vector (sequence inserted into the NheI and XhoI restriction sites). After protein expression, the supernatant was collected and purified using a FLAG-tagged (DYKDDDDK) fusion protein purification kit (Wuhan Daian Biotechnology Co., Ltd., catalog number KAP0064). The directly expressed recombinant protein was an inactive protease, which was further activated using activated Catepsin C protease (R&D systems, catalog number 2336-CY, enzyme activity > 60,000 pmol / min / µg). Specific procedures were followed according to the instructions for human neutrophil elastase (R&D systems, catalog number 9167-SE). Each recombinant protein was then purified again using a FLAG-tagged (DYKDDDDK) fusion protein purification kit to remove residual Catepsin C protease. Finally, the protein buffer system was replaced with PBS solution using a 7Kd molecular weight cutoff dialysis bag (Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number 20531ES03). Protein quantification was performed using the Pierce™ BCA protein assay kit. SDS-PAGE (non-reducing electrophoresis, separating gel concentration 12%, sample loading 3 μg / well) showed that the molecular weight of the recombinant protein was consistent with expectations, and the purity of all proteins was above 95% as determined by grayscale analysis, indicating that the samples met the requirements.

[0085] The tolerance of the protein ELANE-A2c obtained above to α-1-antitrypsin (A1AT) was analyzed using chromogenic substrates and compared with commercially available human neutrophil elastase (Elastin Products Company, catalog number SE563). The specific operation is as follows: (1) Add 150 μL of the test protein (final concentration 200 nM) to a 0.5 ml centrifuge tube. For the experimental group, add 150 μL of A1AT (sigma, catalog number A9024) of different concentrations (300 nM, 600 nM, 1200 nM, 2400 nM, 4800 nM, 9600 nM, 19200 nM) in sequence. For the control group, add 150 μL of PBS (20 mM, pH 7.5). After mixing the samples, incubate at room temperature for 2 hours to allow A1AT to fully bind with the test protein. (2) Take the above reaction solution and measure the enzyme activity of each protein after being treated with different concentrations of A1AT according to the protein activity assay method. Repeat the experiment three times and take the average value.

[0086] Protein activity was determined using chromogenic substrates, as follows: (1) Each protein was diluted to 1 ng / µL with analytical buffer (50 mM Tris, 1 M NaCl, 0.05% (w / v) Brij35, pH 7.5); the chromogenic substrate MEOSUC-Ala-Ala-Pro-Val-AMC (Bachem, catalog number I-1270) was diluted to 200 μM with analytical buffer; (2) Samples were added and reacted in groups as follows: Experimental group: 50 µL of diluted protein and 50 µL of diluted chromogenic substrate were added to 96-well plates in sequence; Substrate blank group: 50 µL of analytical buffer and 50 µL of diluted chromogenic substrate were added to 96-well plates in sequence; (3) Measurement was started after the substrate was added: PerkinElmer EnSpire multi-functional microplate reader, using kinetic mode, excitation wavelength is 380nm, emission wavelength is 460nm, continuous monitoring for 5 minutes; (4) after subtracting the background of the substrate blank group, fit the fluorescence value growth curve and obtain V max Enzyme activity is calculated using the following formula: Enzyme activity (pmol / min / μg) = (V max × conversion constant) / enzyme amount (μg), where V max The unit is RFU / min, and the conversion constant is pmmol / RFU, which is the fluorescence value corresponding to each pmmol of the standard 7-amino-4-methylcoumarin (Sigma, catalog number A9891).

[0087] The results are shown in Table 6. Without A1AT treatment, ELANE-A2c exhibited higher enzyme activity than commercially available human neutrophil elastase, with a protease activity value of 5542.1 pmol / min / μg, which is 1.7 times that of commercially available human neutrophil elastase (3218.7 pmol / min / μg). Furthermore, ELANE-A2c showed significant tolerance to A1AT; after treatment with 19200 nM A1AT, its enzyme activity value still reached 4576.4 pmol / min / μg, representing 82.6% of the untreated enzyme activity (i.e., the remaining 82.6% of the enzyme activity value); while under the same conditions, the enzyme activity value of commercially available human neutrophil elastase decreased to below 50 pmol / min / μg. This protein's higher enzyme activity and high tolerance to widely present serine protease inhibitors (such as A1AT) may be an important mechanism by which the LNP-ELANE-A2b sample achieved better tumor elimination after intramuscular injection.

[0088] Table 6. Results of protease activity assays after treatment with different concentrations of A1AT (pmol / min / μg)

[0089]

[0090] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. An mRNA molecule encoding a fusion protein of neutrophil elastase, characterized in that, The nucleotide sequence of the mRNA molecule is shown in SEQ ID NO.12; The fusion protein comprises, from N-terminus to C-terminus, a signal peptide, an optimized neutrophil elastase fragment, a linker arm, and an optimized α2-macroglobulin fragment. The optimized neutrophil elastase fragment contains amino acids 28 to 252 of human neutrophil elastase and includes a glutamine mutation at position 137 to proline. The optimized α2-macroglobulin fragment contains amino acids 575 to 1339 of human α2-macroglobulin and includes a cysteine ​​mutation at position 972 to serine. The amino acid sequence of the signal peptide is shown in SEQ ID NO.9; The amino acid sequence of the linker arm is shown in SEQ ID NO.10; The amino acid sequence of the fusion protein is shown in SEQ ID NO.3; The nucleotide sequence of the fusion protein is shown in SEQ ID NO.

8.

2. The mRNA molecule according to claim 1, characterized in that, The nucleotide sequence that forms the transcription template for the mRNA is shown in SEQ ID NO.

11.

3. The method for preparing mRNA molecules according to claim 1, characterized in that, The method includes the following steps: S1, gene synthesis and gene cloning; S2, bacterial culture and plasmid DNA extraction, purification and linearization; S3, linearized plasmids are transcribed into mRNA in vitro.

4. A formulation of mRNA encoding a fusion protein of neutrophil elastase encapsulated in nanolipid particles, characterized in that, Includes the mRNA molecules and lipid nanoparticles as described in claim 1.

5. The use of the mRNA formulation according to claim 4 in the preparation of a medicament for treating tumors, characterized in that, The route of administration for tumor treatment is intramuscular injection.

Images