Low-temperature denitrification strain and application thereof
By using the low-temperature denitrification strain Acinetobacter braglia FX1, the problem of inhibited microbial metabolic activity under low-temperature conditions was solved, achieving efficient wastewater treatment under low-temperature conditions, reducing energy consumption and improving denitrification efficiency.
Patent Information
- Application Number
- CN202610061172.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-16
- Publication Date
- 2026-03-31
AI Technical Summary
In low-temperature environments, the metabolic activity of microorganisms in traditional mesophilic microbial wastewater treatment systems is inhibited, resulting in low denitrification efficiency, unstable operation, and high energy consumption of physical insulation or heating measures, making it difficult to meet the complex needs of wastewater treatment in winter.
The low-temperature denitrification strain Acinetobacter pragensis FX1 can efficiently remove ammonia nitrogen, nitrate nitrogen and nitrite nitrogen from wastewater in the range of 5℃ to 30℃. It can be prepared into freeze-dried powder or liquid bacterial agent for use in wastewater treatment.
It maintains high metabolic activity under low temperature conditions, reduces dependence on external heating or insulation measures, improves denitrification efficiency, adapts to a variety of nitrogen pollutants, reduces energy consumption, adapts to complex water quality, and provides flexible and efficient wastewater treatment solutions.
Smart Images

Figure CN121759367A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, and in particular relates to a low-temperature denitrifying strain and its application. Background Technology
[0002] With rapid economic development and the continuous improvement of people's living standards, the discharge of industrial production, agricultural activities, and urban and rural domestic sewage has continued to increase, leading to a large amount of nitrogen-containing pollutants entering the surface water environment and causing increasingly serious nitrogen pollution problems in water bodies. Excessive nitrogen input is one of the key factors leading to eutrophication, causing excessive algal growth, decreased dissolved oxygen, water quality deterioration, and ultimately disrupting the balance of the aquatic ecosystem. According to the 2024 "China Ecological Environment Status Bulletin," among the 207 important lakes (reservoirs) monitored for trophic status that year, the proportion of lakes (reservoirs) showing eutrophication reached 30.0%, an increase of 2.7 percentage points compared to 2023. This indicates that the problem of eutrophication in my country's water bodies remains severe and is showing an aggravating trend. Therefore, developing efficient and stable technologies for the treatment of nitrogen pollution in water bodies has become an urgent task in the field of environmental protection.
[0003] Among numerous wastewater treatment technologies, biological treatment is widely adopted by most wastewater treatment plants both domestically and internationally due to its high treatment efficiency, relatively low operating costs, and environmental friendliness. This method primarily relies on the metabolic activities of microorganisms to convert nitrogenous pollutants in wastewater into harmless substances such as nitrogen gas. However, temperature is one of the key environmental factors affecting microbial metabolic activity. Especially under low-temperature conditions in winter, microbial enzyme activity significantly decreases, cell membrane fluidity declines, leading to a substantial slowdown in their growth and metabolic rates. In northern my country, winter temperatures often fall below 10℃, and sometimes even remain below 5℃ for extended periods. Under these conditions, the metabolic activity of traditional mesophilic microorganisms is severely inhibited, often resulting in unstable operation of wastewater treatment systems, significantly reduced denitrification efficiency, and difficulty in meeting effluent quality standards. To cope with low-temperature environments, wastewater treatment plants currently employ enhanced measures such as physical insulation, water heating, or optimization of process operating parameters. However, these methods often have limitations such as high energy consumption, poor adaptability, and significantly increased operating costs. Especially for large-scale, widely distributed urban and industrial wastewater treatment facilities, their long-term economic viability and sustainability face challenges.
[0004] To address the aforementioned issues, developing and utilizing efficient biological treatment technologies suitable for low-temperature environments has become a research hotspot in the field of water pollution control. Low-temperature microorganisms (or psychrophiles, cold-resistant bacteria) can grow and metabolize at temperatures ranging from 0°C to 20°C or even lower. These microbial resources are widely distributed in the natural environment and possess the potential to maintain high enzyme activity and metabolic rates under low-temperature conditions, thus holding significant application potential. However, the currently known culturable low-temperature denitrification microorganisms remain relatively limited, and most strains suffer from low denitrification efficiency, narrow nitrogen source adaptability, and poor environmental tolerance, making it difficult to meet the complex needs of actual wastewater treatment. Therefore, screening and identifying novel low-temperature denitrification strains from the natural environment that combine high-efficiency denitrification performance, broad temperature adaptability, and good environmental adaptability is of significant scientific research and engineering application value for promoting the stable operation of wastewater treatment plants in low-temperature regions of my country during winter, improving denitrification efficiency, and reducing energy consumption and operating costs. Summary of the Invention
[0005] In response to the problems of inhibited microbial metabolic activity, low denitrification efficiency, unstable operation, and high energy consumption of physical insulation or heating measures in existing sewage treatment systems under low temperature conditions, this invention proposes a low-temperature denitrification strain and its application. This strain can efficiently remove ammonia nitrogen, nitrate nitrogen, and nitrite nitrogen under low temperature conditions.
[0006] To achieve the above objectives, the present invention provides a low-temperature denitrification strain, wherein the strain is Acinetobacter blakeana (Acinetobacter blakeana). Acinetobacter pragensis FX1 is deposited at the China General Microbiological Culture Collection Center (CGMCC) under the name FX1 and the accession number CGMCC NO.36583.
[0007] Furthermore, after being cultured on BTB solid basal medium at 10°C for 7 days, the strain FX1 formed round, milky-white colonies with a diameter of 2–3 mm, smooth, raised, and moist surfaces. Scanning electron microscopy revealed that the strain was short rod-shaped.
[0008] Furthermore, the 16S rRNA gene sequence of the strain FX1 is shown in SEQ ID NO.1.
[0009] The present invention also provides a microbial agent comprising live cells of the above-mentioned low-temperature denitrifying strain FX1, its dormant cells or metabolites, and an acceptable carrier.
[0010] Furthermore, the bacterial agent is a lyophilized powder, a liquid bacterial agent, or a solid granule preparation.
[0011] The present invention also provides the application of the above-mentioned low-temperature denitrification strain FX1 or the above-mentioned bacterial agent in the preparation of products for treating nitrogen-containing wastewater.
[0012] Furthermore, the nitrogen-containing wastewater is low-temperature wastewater, with a treatment temperature of 5°C to 30°C.
[0013] Furthermore, the nitrogen pollutants in the nitrogen-containing wastewater include one or more of ammonia nitrogen, nitrate nitrogen, and nitrite nitrogen.
[0014] Furthermore, in the application, strain FX1 removes the nitrogen pollutants under conditions of pH 7.0 to 9.0, sodium acetate as the carbon source, a carbon-to-nitrogen mass ratio of 5 to 20, and the provision of dissolved oxygen.
[0015] The present invention also provides a method for treating low-temperature wastewater, comprising the step of adding an effective amount of the aforementioned low-temperature denitrifying strain FX1 or the aforementioned bacterial agent to the low-temperature wastewater to be treated.
[0016] Compared with the prior art, the present invention has the following advantages and technical effects: This invention provides a strain of Acinetobacter blakeana FX1 with excellent low-temperature adaptability and highly efficient broad-spectrum denitrification capabilities. This strain can maintain vigorous metabolic activity over a wide temperature range of 5°C to 30°C, especially under typical low-temperature conditions around 10°C, achieving efficient and stable simultaneous removal of ammonia nitrogen, nitrate nitrogen, and nitrite nitrogen from wastewater, with near-complete conversion. This characteristic fundamentally solves the industry problem of inhibited metabolism, unstable system operation, and a sharp drop in denitrification efficiency of conventional mesophilic denitrifying microorganisms under low-temperature conditions.
[0017] This strain offers significant advantages: First, its strong low-temperature tolerance reduces or even eliminates the reliance on external heating or enhanced insulation in wastewater treatment processes, allowing direct application in wastewater treatment facilities in northern my country during winter or in areas with consistently low temperatures, demonstrating significant energy-saving and consumption-reducing potential. Second, the strain exhibits excellent removal capacity and tolerance for various forms of nitrogen (including inhibitory high-concentration nitrite nitrogen), adapting to the fluctuations and complexities of actual wastewater quality and demonstrating good environmental adaptability. Third, by preparing it into a stable bacterial agent product, it facilitates large-scale production, long-term storage, and on-site application, providing a flexible, efficient, and environmentally friendly solution for the bioaugmentation and process upgrading of existing wastewater treatment plants. Therefore, this invention not only provides valuable microbial resources for biological denitrification of low-temperature wastewater but also has significant practical value and broad application prospects for improving the operational efficiency of wastewater treatment plants in low-temperature areas, ensuring effluent quality, and reducing operating costs. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 The image shows the colony morphology of strain FX1 after 7 days of incubation at 10°C on BTB solid basal medium (left) and the scanning electron microscope image during the logarithmic phase (right).
[0020] Figure 2 This is a phylogenetic tree diagram of strain FX1 constructed based on the 16S rRNA gene sequence.
[0021] Figure 3 The effects of different carbon sources on the growth (OD) of strain FX1 at 10℃. 600 A schematic diagram illustrating the effect of nitrate nitrogen removal rate on nitrogen removal rate.
[0022] Figure 4 The effects of different carbon-to-nitrogen ratios (C / N) on the growth (OD) of strain FX1 at 10℃. 600 A schematic diagram illustrating the effect of nitrate nitrogen removal rate on nitrogen removal rate.
[0023] Figure 5 The effect of different initial pH values on the growth (OD) of strain FX1 at 10℃. 600 A schematic diagram illustrating the effect of nitrate nitrogen removal rate on nitrogen removal rate.
[0024] Figure 6 The effect of different shaking speeds on the growth (OD) of strain FX1 at 10℃. 600 A schematic diagram illustrating the effect of nitrate nitrogen removal rate on nitrogen removal rate.
[0025] Figure 7 The growth curves (OD) of strain FX1 at different culture temperatures. 600 (Scattered data) and (bar graph) diagram showing the change of nitrate concentration over time.
[0026] Figure 8 At 10℃, when ammonia nitrogen is the sole nitrogen source, the growth (OD) of strain FX1 is... 600 ( ) and a schematic diagram showing the change of ammonia nitrogen concentration over time.
[0027] Figure 9 At 10℃, when nitrate nitrogen is the sole nitrogen source, the growth (OD) of strain FX1 is... 600 (and a schematic diagram of the change of nitrate nitrogen concentration over time.)
[0028] Figure 10At 10℃, when nitrite nitrogen is the sole nitrogen source, the growth (OD) of strain FX1 is... 600 (and a schematic diagram of the change of nitrite nitrogen concentration over time.)
[0029] Figure 11 This is a schematic diagram showing the changes in ammonia nitrogen and nitrate nitrogen concentrations over time when strain FX1 uses ammonia nitrogen and nitrate nitrogen as a mixed nitrogen source at 10℃.
[0030] Figure 12 The denitrification performance of strain FX1 in actual domestic sewage treatment at 10℃: without dosing (left) and with dosing (right).
[0031] Figure 13 This is the complete genome map of strain FX1. Detailed Implementation
[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0033] All raw materials used in this invention are not particularly restricted in their source; they can be purchased from the market or prepared using conventional methods known to those skilled in the art.
[0034] There are no particular restrictions on the purity of any of the raw materials used in this invention. However, this invention preferably uses raw materials of analytical grade or purity commonly used in the field of chemical synthesis.
[0035] The culture media involved in this invention are as follows: LB medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride; Basic culture medium: 1 g / L sodium acetate, 0.3035 g / L sodium nitrate, 0.04 g / L potassium dihydrogen phosphate, 0.1 g / L magnesium sulfate heptahydrate, 1 mL trace element solution / L culture medium; BTB basal medium: 1 g / L sodium acetate, 0.3035 g / L sodium nitrate, 0.04 g / L potassium dihydrogen phosphate, 0.1 g / L magnesium sulfate heptahydrate, 1 mL 1% BTB solution, 1 mL trace element solution / L medium (1% BTB preparation: dissolve 1 g bromothymol blue in 100 mL 95% ethanol solution); Culture medium with ammonia nitrogen as the sole nitrogen source: 1.709 g / L sodium acetate, 0.1911 g / L ammonium chloride, 0.0454 g / L potassium dihydrogen phosphate, 0.1 g / L magnesium sulfate heptahydrate, 1 mL trace element solution / L culture medium; Medium with nitrate nitrogen as the sole nitrogen source: 1.709 g / L sodium acetate, 0.3035 g / L sodium nitrate, 0.0454 g / L potassium dihydrogen phosphate, 0.1 g / L magnesium sulfate heptahydrate, 1 mL trace element solution / L medium; Culture medium with nitrite as the sole nitrogen source: 1.709 g / L sodium acetate, 0.2464 g / L sodium nitrite, 0.0454 g / L potassium dihydrogen phosphate, 0.1 g / L magnesium sulfate heptahydrate, 1 mL trace element solution / L culture medium; Mixed nitrogen source medium: 3.418 g / L sodium acetate, 0.1911 g / L ammonium chloride, 0.3035 g / L sodium nitrate, 0.0454 g / L potassium dihydrogen phosphate, 0.1 g / L magnesium sulfate heptahydrate, 1 mL trace element solution / L medium; Trace element solution: 5.0 g / L disodium ethylenediaminetetraacetate, 5.0 g / L ferrous sulfate heptahydrate, 0.05 g / L boric acid, 0.03 g / L copper chloride, 0.05 g / L zinc chloride, 0.05 g / L ammonium molybdate tetrahydrate, 0.05 g / L cobalt chloride hexahydrate, 0.05 g / L aluminum chloride, 0.05 g / L nickel chloride.
[0036] Example 1: Isolation, screening and identification of novel low-temperature denitrification strain FX1 This embodiment describes in detail the isolation and screening process and identification results of strain FX1.
[0037] (1) Enrichment and isolation of bacterial strains: Activated sludge samples collected from the aerobic tank of a wastewater treatment plant in Shaanxi Province were used as the bacterial source. 50 mL of sludge sample was centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the precipitate was resuspended in sterile deionized water and thoroughly washed. This process was repeated three times to remove impurities. 5 mL of the washed sludge sample was inoculated into a conical flask containing 100 mL of LB liquid medium and cultured with shaking at 10℃ and 150 rpm for 24 h for initial enrichment. After the culture was completed, 5 mL of the enriched bacterial solution was transferred to 100 mL of basal medium and cultured at 10℃ and 150 rpm for 3 days for targeted enrichment. Subsequently, the enriched bacterial solution was rinsed with sterile deionized water for 10 minutes. -1 Up to 10 -8 Gradient dilution, take 10 -4 10 -5 10 -6 100 μL of each diluted bacterial suspension was spread onto BTB solid basal medium plates and incubated at 10°C for 5–7 days. Once a single colony appeared on the plate that turned the surrounding medium from green to blue (indicating alkalization), several single colonies with different morphologies were picked for further purification.
[0038] (2) Strain purification: The single colonies picked above were repeatedly purified and cultured on fresh BTB solid basal medium 5 to 6 times using the streak plate method until they were observed to be pure cultures with consistent morphology under a microscope.
[0039] (3) Initial screening of low-temperature denitrification performance: The candidate strains purified in step (2) were inoculated into a basic culture medium with sodium nitrate as the sole nitrogen source at an inoculation amount of 5% (v / v) and cultured at 10℃ and 150 rpm for 72 hours with shaking. Samples were taken periodically to measure the absorbance (OD) of the culture medium at a wavelength of 600 nm. 600 The bacterial growth was monitored, and the concentration of nitrate nitrogen in the culture medium was determined by ultraviolet spectrophotometry to calculate the removal rate. A strain that exhibited rapid growth at 10℃ and the highest nitrate nitrogen removal efficiency was selected and named FX1, which will serve as the target low-temperature denitrification strain for further research.
[0040] (4) Strain identification: Morphological observation: Strain FX1 was inoculated onto BTB solid basal medium and incubated at 10℃ for 7 days. Colony morphology was then observed. Figure 1 As shown, the colonies are round, 2-3 mm in diameter, with a smooth, raised, and moist surface, and are milky white in color. Scanning electron microscopy reveals that the strains appear as short rods.
[0041] Molecular biological identification: Genomic DNA was extracted from strain FX1 using a bacterial genomic DNA extraction kit (Vazyme, #DC103). Using this DNA as a template, PCR amplification was performed using universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3') for the bacterial 16S rRNA gene. The PCR product was purified and sequenced to obtain its 16S rRNA gene sequence, as shown in SEQ ID NO.1. The obtained sequence was subjected to BLAST homology comparison in the NCBI database, and a phylogenetic tree was constructed using MEGA 7.0 software with the neighbor-joining method, as shown below. Figure 2 As shown. Comparison and phylogenetic analysis results indicate that the 16S rRNA gene sequence of strain FX1 is similar to... Acinetobacter pragensis The strain ANC 4149 showed 100% homology, therefore it was identified as Acinetobacter blakeana. Acinetobacter pragensis ), and named Acinetobacter pragensis FX1.
[0042] FX1 strain sequence (SEQ ID NO.1): GAATTTGAGGCGGCGGCTTACACATGCAGTCGAGCGGGGAAAGGTAGCTTGCTACTTGACCTAGCGGCGGACGGGTGAGTAATGCTTAGGAATCTGCCTATTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGCCCTACGGGGGAAAGCAGGGGATCTTCGGACCTTGCGCTAATAGATGAGCCTAAGTCGGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCTGTAGCGGGTCTGAGAGGATGATCCGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGGGGAACCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTTTGGTTGTAAAGCACTTTAAGCGAGGAGGAGGCTCCTATAGATAATACCTATAGTGAGTGGACGTTACTCGCAGAATAAGCACCGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGTGGTCTTTTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGGAGACTAGAGTATGGGAGAGGATGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGATGGCGAAGGCAGCCATCTGGCCTAATACTGACACTGAGGCACGAAAGCATGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCATGCCGTAAACGATGTCTACTAGCCGTTGGGGCCTTTGAGGCTTTAGTGGCGCAGCTAACGCGATAAGTAGACCGCCTGGGGAGTACGGTCGCAAGACTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTT This strain has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCCNO.36583, deposit date November 12, 2025, and address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, China.
[0043] Example 2: Effects of environmental factors on and optimization of low-temperature denitrification efficiency of strain FX1 This embodiment investigated the effects of different carbon sources, carbon-nitrogen ratios (C / N), pH, and shaking speed on the growth and denitrification (with nitrate nitrogen as the target pollutant) performance of strain FX1 at 10°C, in order to determine its optimal culture conditions.
[0044] Seed culture preparation: A single colony of FX1 was picked from a BTB plate and inoculated into LB liquid medium and cultured at 10°C and 150 rpm for 48 hours to obtain the seed culture.
[0045] (1) Effects of different carbon sources on the denitrification efficiency of strain FX1 Using sodium nitrate as the sole nitrogen source, basal culture media were prepared with 1.709 g / L sodium acetate, 1.688 g / L sodium succinate, 2.79 g / L sodium oxalate, and 1.79 g / L sodium citrate as carbon sources. A 5% (v / v) seed culture was inoculated and cultured at 10℃ with shaking at 150 rpm for 72 hours. Initial and endpoint OD values were measured. 600 and nitrate nitrogen concentration. Results are as follows: Figure 3 As shown, when sodium acetate is used as the carbon source, strain FX1 exhibits significantly higher growth and denitrification efficiency compared to other carbon sources, with higher OD. 600 The value was 0.838, and the nitrate removal rate was 80.94%. Therefore, sodium acetate is the optimal carbon source for strain FX1.
[0046] (2) Effect of different carbon-nitrogen ratios (C / N) on the denitrification efficiency of strain FX1 Sodium acetate was used as the carbon source and sodium nitrate as the nitrogen source. The C / N ratio (mass ratio) was adjusted to 5, 10, 15, and 20 by varying the amount of sodium acetate added. The inoculation and culture conditions were the same as in (1). The results are as follows: Figure 4 As shown, when the C / N ratio is 5, the nitrate nitrogen removal rate is only 52.32%; when the C / N ratio is increased to 10, 15, and 20, the nitrate nitrogen removal rate is significantly improved, all exceeding 80%, with the highest removal rates of approximately 99% at C / N ratios of 15 and 20. Considering both economic cost and removal efficiency, C / N=10 is selected as the optimal carbon-nitrogen ratio.
[0047] (3) Effect of different initial pH on the denitrification efficiency of strain FX1 Under optimal carbon source and C / N=10 conditions, the initial pH of the culture medium was adjusted to 6.0, 7.0, 8.0, and 9.0 using HCl or NaOH solution, respectively. Inoculation and culture conditions were the same as in (1). Results are as follows... Figure 5 As shown, the strain grows best at pH 7.0, with an OD of 600 The value was 0.838, and the nitrate nitrogen removal rate was 80.94%; at pH 8.0, the OD... 600 The pH value increased slightly to 0.853, and the removal rate rose to 86.82%. This indicates that strain FX1 exhibits good growth and nitrogen removal efficiency within a near-neutral to slightly alkaline range (pH 7–8). Considering the pH range of most actual wastewater, the optimal initial pH was determined to be 7.0.
[0048] (4) Effect of different shaking speeds on the denitrification efficiency of strain FX1 Under the established optimal carbon source, C / N = 10, and pH = 7.0 conditions, the shaking speeds were set to 50, 100, 150, and 200 rpm. The inoculation and culture conditions were the same as in (1). The results are as follows: Figure 6 As shown, the highest nitrate nitrogen removal rate (80.94%) was achieved at a rotation speed of 150 rpm. Too low a rotation speed (50 rpm) may affect dissolved oxygen and mass transfer, reducing the removal rate to 49.32%; too high a rotation speed (200 rpm) may cause shear stress on the bacterial cells, slightly reducing the removal rate to 80%. Therefore, the optimal oscillation speed was determined to be 150 rpm.
[0049] In summary, strain Acinetobacter pragensis The optimal denitrification efficiency (based on nitrate nitrogen) of FX1 at 10℃ was achieved under the following conditions: sodium acetate as the carbon source, C / N = 10, initial pH = 7.0, and shaking speed of 150 rpm.
[0050] Comparative Example 1: Long-term denitrification effect under suboptimal carbon source To illustrate the importance of carbon source selection, under the optimal conditions determined in Example 2 (C / N=10, pH=7, 150 rpm), only sodium citrate was replaced with carbon source, and an extended culture period of 120 hours was conducted. The results showed that nitrate nitrogen removal was slow from 0 to 72 hours, with only about 3.70% removed; even after extending to 120 hours, the removal rate only reached 31%, and the bacterial biomass OD... 600 The concentration remained consistently below 0.4. This contrasts sharply with the fact that sodium acetate alone achieved a removal rate of over 80% after 72 hours, demonstrating the crucial role of sodium acetate in activating and maintaining the high-efficiency denitrification activity of FX1 at low temperatures.
[0051] Example 3: Temperature adaptability and denitrification performance of strain FX1 This embodiment tested the growth and denitrification ability of strain FX1 under different low temperature conditions to determine its temperature adaptation range.
[0052] Under the optimal culture conditions determined in Example 2, culture temperature gradients of 5°C, 10°C, 20°C, and 30°C were set, with nitrate nitrogen remaining the sole nitrogen source. A 5% seed culture was inoculated and cultured for 72 hours at different temperatures in shakers (150 rpm). Odion oxidative stress (OD) was measured periodically. 600 And nitrate nitrogen concentration. Results are as follows: Figure 7 As shown, strain FX1 can grow and denitrify over a wide temperature range from 5°C to 30°C. At 5°C, the strain exhibits a relatively long lag phase, but the OD at 72 hours is [not specified]. 600 The nitrate nitrogen removal rate was still 40.65%, reaching 0.572. The strain exhibited optimal growth, metabolism, and denitrification performance at 10℃ and 20℃, with nitrate nitrogen removal rates exceeding 80%. At 30℃, performance slightly decreased, with a nitrate nitrogen removal rate of 73.99%. These results demonstrate that strain FX1 possesses strong tolerance and adaptability to low temperatures (5–20℃), making it particularly suitable for application in typical low-temperature wastewater treatment environments of 10–20℃.
[0053] Comparative Example 2: Performance stability under temperature fluctuations The study simulated diurnal or seasonal temperature fluctuations in northern regions. Culture flasks inoculated with FX1 strains were cultured at alternating temperatures every 12 hours between 10°C (simulating daytime or warm days) and 5°C (simulating nighttime or cold days), for a total culture time of 72 hours. Control groups were also established at constant 10°C and constant 5°C. Results showed that under alternating temperature conditions, the final nitrate nitrogen removal rate of strain FX1 reached 68.5%, significantly higher than the 40.65% at constant 5°C, but slightly lower than the 80.94% at constant 10°C. This indicates that strain FX1 not only adapts to constant low temperatures but also exhibits good adaptability and performance stability to common temperature fluctuations, superior to many temperature-sensitive mesophilic bacteria.
[0054] Example 4: Low-temperature removal characteristics of ammonia nitrogen by strain FX1 This embodiment verifies the ability of strain FX1 to directly remove ammonia nitrogen at low temperatures.
[0055] A culture medium with ammonium chloride as the sole nitrogen source was used, with an initial ammonia nitrogen concentration of approximately 50 mg / L. The culture was inoculated with 5% FX1 seed culture and cultured at 10°C and 150 rpm with shaking for 48 hours. Samples were taken every 12 hours to measure OD. 600 Concentrations of ammonia nitrogen, nitrite nitrogen, and nitrate nitrogen. Results are as follows: Figure 8As shown, strain FX1 utilizes ammonia nitrogen extremely efficiently, with almost no obvious adaptation period. After 24 hours of cultivation, the ammonia nitrogen removal rate reached 98.57%; after 72 hours of cultivation, the ammonia nitrogen removal rate was as high as 99.39%, almost completely removed. No significant accumulation of nitrite nitrogen or hydroxylamine was detected throughout the process, indicating that strain FX1 can rapidly and relatively completely convert ammonia nitrogen at low temperatures, avoiding the accumulation of toxic intermediate products.
[0056] Example 5: Low-temperature removal characteristics of nitrate nitrogen by strain FX1 This example details the kinetics of nitrate nitrogen removal by strain FX1 under aerobic conditions.
[0057] A culture medium with sodium nitrate as the sole nitrogen source was used, with an initial nitrate nitrogen concentration of approximately 50 mg / L. The culture was inoculated with 5% FX1 seed culture and cultured at 10°C and 150 rpm with shaking for 48 hours. Odion surcharge (OD) was measured periodically. 600 And the concentrations of each inorganic nitrogen. The results are as follows: Figure 9 As shown, the nitrate removal process of strain FX1 exhibits a typical microbial growth curve correlation. Under aerobic conditions, the 0–18 hour period is the adaptation phase, during which the strain grows and denitrifies slowly; the 18–48 hour period is the logarithmic growth phase, during which the bacterial cells proliferate rapidly, and the OD at 48 hours is [data missing]. 600 The maximum value reached was 0.83, and the nitrate nitrogen concentration rapidly decreased from 45.39 mg / L to 10.38 mg / L; it entered the stationary / decay phase after 48–72 hours. The maximum nitrate nitrogen removal rate was 81.30%.
[0058] Example 6: Low-temperature removal characteristics of nitrite nitrogen by strain FX1 This example demonstrates the ability of strain FX1 to tolerate and efficiently remove high concentrations of nitrite nitrogen.
[0059] A culture medium with sodium nitrite as the sole nitrogen source was used, with an initial nitrite nitrogen concentration of approximately 50 mg / L. The culture was inoculated with 5% FX1 seed culture and cultured at 10°C and 150 rpm with shaking for 48 hours. Odion precipitate (OD) was measured periodically. 600 And the concentrations of each inorganic nitrogen. The results are as follows: Figure 10 As shown, high concentrations of nitrite nitrogen did not significantly inhibit the growth and metabolism of FX1. After 12 hours of cultivation, the strain entered a rapid growth phase and simultaneously and efficiently removed nitrite nitrogen. The final cell biomass OD... 600 The value reached 1.132, with a nitrite removal rate of 99.78%, demonstrating its extremely strong removal capacity and tolerance for nitrite.
[0060] Example 7: Low-temperature simultaneous removal characteristics of mixed nitrogen sources by strain FX1 Real-world wastewater often contains nitrogen in various forms. This example simulates the coexistence of ammonia nitrogen and nitrate nitrogen.
[0061] A mixed nitrogen source medium was used, with initial concentrations of approximately 50 mg / L each of ammonia nitrogen and nitrate nitrogen. 5% FX1 seed culture was inoculated and cultured at 10°C and 150 rpm for 72 hours. Results are as follows: Figure 11 As shown, strain FX1 can simultaneously and efficiently remove mixed nitrogen sources. Ammonia nitrogen was completely removed within 24 hours, with a maximum removal rate of 99.26%, and the adaptation period was significantly shortened. Nitrate nitrogen removal was also promoted, with a final removal rate of 67.21%, lower than its removal rate when used as a single nitrogen source (81.30%). This indicates that strain FX1 has the potential for synergistic removal of multiple nitrogen sources in real-world, complex nitrogen-polluted environments.
[0062] Example 8: Denitrification effect of strain FX1 in actual low-temperature domestic sewage To more closely approximate practical applications, actual influent from a wastewater treatment plant in Xi'an was used. The treated water was sterilized, and the C / N ratio was adjusted to 10, with the temperature kept constant at 10℃. Two parallel reactors were set up: the experimental group was inoculated with 5% (v / v) FX1 bacterial culture in the logarithmic growth phase; the control group was not inoculated with FX1. The reaction was carried out under micro-aeration conditions (dissolved oxygen maintained at 2–4 mg / L) for 48 hours. The results are as follows: Figure 12 As shown, the experimental group achieved an ammonia nitrogen removal rate of 98.10% after 24 hours; while the control group, due to low-temperature inhibition, showed almost no ammonia nitrogen removal after 48 hours. This example demonstrates that the addition of strain FX1 can significantly enhance the biological denitrification process of low-temperature domestic sewage.
[0063] Example 9: Experiment on preparation and preservation of microbial agents The strain FX1, identified in Example 1, was cultured on a large scale. It was cultured in an optimized liquid medium (sodium acetate 10 g / L, yeast extract 1 g / L, pH 7.0) at 15°C and 150 rpm until the late logarithmic growth phase (OD2). 600 ≈ 2.0). Bacterial cells were collected by centrifugation (8000 rpm, 10 min) and washed once with sterile physiological saline (0.85% NaCl). The wet bacterial sludge was mixed thoroughly with a sterile preservative (e.g., 10% skim milk, 5% trehalose) at a 1:1 (w / v) ratio and aliquoted into sterile cryovials. One portion of the sample was stored at 4°C, while the other portion was freeze-dried. The results showed that the viable bacterial count of the prepared freeze-dried powder remained at 10⁻⁶ after 6 months of sealed storage at 4°C. 9 When FX1 was rehydrated and applied under the conditions of Example 8, its denitrification efficiency was not significantly different from that of freshly cultured bacterial solution. This demonstrates the feasibility of preparing FX1 into a stable bacterial agent that is easy to store and transport.
[0064] Comparative Example 3: Effect of different cryoprotectants on freeze-dried survival rate Based on Example 9, the effects of different protectants (A: 10% skim milk; B: 5% trehalose; C: 10% skim milk + 5% trehalose; D: no protectant) on the survival rate of FX1 after lyophilization were compared. The survival rate after lyophilization was calculated based on the number of viable bacteria before lyophilization. Results: The survival rate of group D (no protectant) was extremely low (<1%); the survival rate of group A was approximately 65%; the survival rate of group B was approximately 55%; and the survival rate of group C (combined protectant) was the highest, reaching 82%. This indicates that using a suitable combined protectant can effectively improve the preservation stability of FX1 bacterial culture.
[0065] The above embodiments fully demonstrate that the Acinetobacter baumannii FX1 provided by the present invention is an excellent strain with strong low-temperature adaptability, efficient and broad-spectrum denitrification ability, and good environmental tolerance. Its screening method is reliable and has a clear and broad application prospect in low-temperature wastewater treatment.
[0066] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A low-temperature denitrifying strain, characterized in that, The strain was Acinetobacter baumannii ( ) Acinetobacter pragensis FX1 is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC NO.36583.
2. The low-temperature denitrifying strain according to claim 1, characterized in that, After being cultured on BTB solid basal medium at 10°C for 7 days, strain FX1 formed round, milky-white colonies with a diameter of 2–3 mm, smooth, raised, and moist surfaces; scanning electron microscopy revealed that the strain was short rod-shaped.
3. The low-temperature denitrifying strain according to claim 1, characterized in that, The 16S rRNA gene sequence of strain FX1 is shown in SEQ ID NO.
1.
4. A microbial agent, characterized in that, The present invention comprises the live cells, dormant cells or metabolites of the low-temperature denitrifying strain FX1 as described in any one of claims 1 to 3, and an acceptable vector.
5. The microbial agent according to claim 4, characterized in that, The bacterial agent is a freeze-dried powder, liquid bacterial agent, or solid granule preparation.
6. The use of the low-temperature denitrifying strain FX1 according to any one of claims 1 to 3 or the bacterial agent according to any one of claims 4 to 5 in the preparation of products for treating nitrogen-containing wastewater.
7. The application according to claim 6, characterized in that, The nitrogen-containing wastewater is low-temperature wastewater, and the treatment temperature is 5℃ to 30℃.
8. The application according to claim 6 or 7, characterized in that, The nitrogen pollutants in the nitrogen-containing wastewater include one or more of ammonia nitrogen, nitrate nitrogen, and nitrite nitrogen.
9. The application according to claim 8, characterized in that, In the application, strain FX1 removes the nitrogen pollutants under conditions of pH 7.0 to 9.0, sodium acetate as the carbon source, a carbon-to-nitrogen mass ratio of 5 to 20, and the provision of dissolved oxygen.
10. A low-temperature wastewater treatment method, characterized in that, The method includes the step of adding an effective amount of the low-temperature denitrifying strain FX1 according to any one of claims 1 to 3 or the bacterial agent according to any one of claims 4 to 5 to the low-temperature wastewater to be treated.