Hybridoma cell strain secreting monoclonal antibody with bovine coronavirus neutralizing activity and application of hybridoma cell strain
By providing hybridoma cell lines that secrete neutralizing monoclonal antibodies against bovine coronavirus, the problem of lacking highly specific and cross-active monoclonal antibodies in existing technologies has been solved, achieving efficient neutralization and cross-neutralization of BCoV, and promoting the development of diagnostic and therapeutic agents.
Patent Information
- Application Number
- CN202610183270.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-09
- Publication Date
- 2026-03-31
AI Technical Summary
The lack of monoclonal antibodies with high specificity and clear cross-activity against bovine coronavirus (BCoV) in existing technologies makes it difficult to effectively respond to viral mutations and improve prevention and control capabilities.
A hybridoma cell line (CCTCC NO: C2025147) was provided. The monoclonal antibody secreted by this cell line has high neutralizing activity against BCoV (titer 1:64) and can cross-neutralize closely related sheep coronavirus (cpCoV, titer 1:8). The monoclonal antibody was prepared by nucleotide sequence analysis of the heavy chain variable region and the light chain variable region.
This antibody is not only used to develop highly sensitive specific diagnostic reagents, but also provides biological materials for the development of broad-spectrum protective and therapeutic agents, thereby enhancing the overall prevention and control capabilities of ruminant coronaviruses.
Smart Images

Figure CN121759413A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of antibody drug technology, and in particular to a hybridoma cell line that secretes a neutralizing monoclonal antibody against bovine coronavirus and its applications. Background Technology
[0002] Bovine Coronavirus (BCoV) belongs to the genus Betacoronavirus and is an enveloped, single-stranded, positive-sense RNA virus. The S1 subunit of its spike protein (S protein) is crucial for mediating host cell receptor recognition and membrane fusion, and is also a primary target for neutralizing antibodies. This virus primarily infects ruminants. Newborn calves infected with BCoV often develop acute diarrhea and have a high mortality rate; adult cattle are prone to winter dysentery, characterized by bloody diarrhea and a sharp drop in milk production, causing significant economic losses. BCoV can also infect wild animals such as deer and antelope, posing a risk of cross-species transmission. Transmission primarily occurs via the fecal-oral route and aerosols. Due to the high viral load in feces and its ability to remain active for extended periods in low-temperature environments, it spreads easily through contaminated feed, water sources, and facilities. Aerosol transmission is particularly prominent in enclosed cattle sheds. Furthermore, infected cows can transmit the virus vertically or horizontally in their milk, and stress factors and mixed infections with other pathogens can significantly exacerbate symptoms.
[0003] In the prevention and control strategy of BCoV, vaccines can effectively reduce clinical morbidity and viral shedding, but they still have limitations. Their cross-protective ability against strains from different genetic branches is insufficient, making it difficult to fully address the challenges posed by continuous viral mutations. Currently, various technologies are used for BCoV diagnosis, including multiple nucleic acid and immunological detection methods. Among them, rapid antigen detection technology for fecal samples, due to its ease of operation and rapid response, can meet the basic needs of on-site screening. However, in terms of therapeutic antibodies, existing measures mainly rely on non-standardized egg yolk antibodies and symptomatic supportive therapy, lacking highly specific and potent biological agents. Monoclonal antibody technology, with its high specificity, high affinity, and potential neutralizing activity, shows unique advantages in developing novel diagnostic reagents and therapeutic biological products. However, currently, there is a scarcity of monoclonal antibodies targeting neutralizing epitopes of BCoV globally, especially lacking systematically evaluated monoclonal antibodies with broad-spectrum cross-neutralizing activity against currently circulating strains, which restricts the development of monoclonal antibody-based BCoV diagnostic technologies, therapeutic agents, and related industrialization processes.
[0004] Within the β-coronavirus genus, BCoV is closely related to other ruminant coronaviruses (such as sheep coronavirus cpCoV), and there is antigenic cross-reactivity. Developing broad-spectrum monoclonal antibodies that can recognize these conserved epitopes and possess neutralizing activity against multiple related viruses is of greater value than single-virus monoclonal antibodies in addressing viral mutations, developing diagnostic tools, and creating broad-spectrum immunotherapies. Summary of the Invention
[0005] The purpose of this invention is to provide a hybridoma cell line that secretes a neutralizing monoclonal antibody against bovine coronavirus and its applications, thereby addressing the problems existing in the prior art. The monoclonal antibody prepared from the hybridoma cell line secreting the neutralizing monoclonal antibody against bovine coronavirus provided by this invention achieves a neutralizing titer of 1:64 against bovine coronavirus and can cross-neutralize closely related sheep coronaviruses (titer 1:8). This antibody exhibits good specificity, providing fundamental materials and technical support for the development of specific diagnostic products and therapeutic agents.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] This invention provides a hybridoma cell line, which was deposited at the China Center for Type Culture Collection on November 6, 2025, with accession number CCTCC NO: C2025147.
[0008] The present invention also provides a monoclonal antibody secreted by the hybridoma cell line.
[0009] Optionally, the heavy chain variable region nucleotide sequence of the monoclonal antibody is shown in SEQ ID NO.1, and the light chain variable region nucleotide sequence is shown in SEQ ID NO.2.
[0010] Optionally, the heavy chain of the monoclonal antibody is of the IgG type and the light chain is of the κ type.
[0011] The present invention also provides a polynucleotide encoding the monoclonal antibody or a functional fragment thereof.
[0012] The present invention also provides a nucleic acid vector comprising the aforementioned polynucleotide.
[0013] The present invention also provides a recombinant host cell containing the aforementioned nucleic acid vector.
[0014] The present invention also provides a method for preparing the monoclonal antibody, comprising:
[0015] Hybridoma cell line with accession number CCTCC NO: C2025147 was cultured to obtain the monoclonal antibody;
[0016] Alternatively, the recombinant host cells can be cultured to induce the expression of the monoclonal antibody.
[0017] The present invention also provides the application of the monoclonal antibody in the preparation of products for detecting bovine coronavirus and closely related viruses, wherein the closely related viruses are those closely related to it in the β-coronavirus genus.
[0018] Optionally, the closely related viruses include sheep coronaviruses.
[0019] The present invention discloses the following technical effects:
[0020] This invention provides a novel hybridoma cell line that secretes monoclonal antibodies against bovine coronavirus (BCoV) and successfully produces monoclonal antibodies with highly efficient neutralizing activity. This effectively solves the problem in existing technologies of lacking highly specific monoclonal antibodies against currently prevalent strains with clear cross-activity. This hybridoma cell line (CCTCC NO: C2025147) can stably secrete monoclonal antibodies, and its production method is well-defined and reproducible, laying a solid foundation for the large-scale production of standardized antibody products.
[0021] More notably, the monoclonal antibody secreted by this cell line exhibited excellent neutralizing titer (1:64) against bovine coronavirus NXWZ2310 and was able to cross-neutralize with the closely related sheep coronavirus (cpCoV) (titer 1:8), indicating that the antibody can recognize and target relatively conserved antigenic epitopes in viral evolution. Therefore, the monoclonal antibody obtained in this invention can not only be used to develop highly sensitive and specific diagnostic reagents against BCoV, but also provides new biomaterials for developing therapeutic agents with potential broad-spectrum protective effects, and has important application value in responding to viral mutations and improving the overall prevention and control capabilities of coronaviruses in ruminants. Attached Figure Description
[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0023] Figure 1 This is a diagram showing the results of antigenic epitope identification for monoclonal antibodies.
[0024] Figure 2 The image shows the results of an indirect immunofluorescence assay for monoclonal antibodies.
[0025] Figure 3The images show the results of the specific identification of monoclonal antibodies; where A is the immunofluorescence detection image of the reaction of monoclonal antibodies with bovine coronavirus (BCoV) and sheep coronavirus (cpCoV); B is the immunofluorescence detection image of the reaction of monoclonal antibodies with porcine epidemic diarrhea virus (PEDV); and C is the immunofluorescence detection image of the reaction of monoclonal antibodies with porcine deltacoronavirus (PDCoV).
[0026] Figure 4 The figures show the results of the neutralizing activity identification of monoclonal antibodies; where A is the identification result of monoclonal antibodies neutralizing bovine coronavirus (BCoV); and B is the identification result of monoclonal antibodies neutralizing sheep coronavirus (cpCoV). Detailed Implementation
[0027] In this invention, "antibody" refers to a protein composed of one or more polypeptides that specifically bind to antigens. One form of antibody constitutes the basic structural unit of an antibody. This form is a tetramer, which consists of two pairs of identical antibody chains, each pair having a light chain and a heavy chain. In each pair of antibody chains, the variable regions of the light and heavy chains work together to bind the antigen, while the constant regions are responsible for the antibody's effector function.
[0028] The "variable region" of an antibody heavy or light chain is the N-terminal maturation region of that chain. The amino acid composition and arrangement of the variable region vary depending on the antibody specificity. Certain specific regions within the variable region exhibit greater variability in amino acid residues, and are called hypervariable regions. These hypervariable regions are where Ig specifically binds to antigenic determinants, and are therefore also known as complementarity-determining regions (CDRs). Other parts of the variable region are called backbone regions, and their structure is relatively stable.
[0029] Currently known antibody types include κ and λ light chains, as well as α, γ (IgG1, IgG2, IgG3, IgG4), δ, ε, and μ heavy chains, or their other equivalent types.
[0030] "Antibody" includes any isotype of antibody or immunoglobulin, or antibody fragment that maintains specific binding to an antigen, including but not limited to Fab, Fv, scFv, and Fd fragments, chimeric antibodies, single-chain antibodies, and fusion proteins containing the antigen-binding portion of an antibody and non-antibody proteins. Antibodies can be labeled and detected, for example, by means of radioactive isotopes, enzymes that produce detectable substances, fluorescent proteins, biotin, etc. Antibodies can also be bound to solid-phase carriers, including but not limited to polystyrene plates or beads.
[0031] In this invention, "polynucleotide" refers to a biological macromolecular compound formed by the polymerization of multiple nucleotides. The nucleotides can be ribonucleic acid or deoxyribonucleic acid and their modifications, including double-stranded or single-stranded DNA, cDNA, RNA, mRNA, etc., which can be circular or linear, or a part of a circular vector or a fragment of a genome.
[0032] In this invention, the term "nucleic acid vector" refers to a recombinant DNA molecule containing the desired coding sequence and suitable nucleic acid sequences essential for the expression of an operatively linked coding gene in a specific host organism. Nucleic acid sequences essential for expression in prokaryotic cells include promoters, optionally including operator gene sequences, ribosome binding sites, and possibly other sequences. Prokaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or, in some cases, the plasmid integrates into the genome. In this specification, "plasmid" and "vector" are sometimes used interchangeably because plasmids are currently the most commonly used form of vector. However, this invention intends to include other forms of expression vectors that perform equivalent functions, which are known in the art or will become known, including but not limited to: plasmids, phage particles, viral vectors, and / or simply potential genomic inserts.
[0033] In this invention, the "host cell" is generally a prokaryotic or eukaryotic host containing a nucleic acid vector and / or a gene of interest.
[0034] Transform or transfect host cells using vectors constructed using recombinant DNA technology. Such transformed host cells are able to replicate the vector encoding the protein or express the desired protein.
[0035] The term "monoclonal antibody" refers to a preparation of an antibody molecule having a single molecular composition. Monoclonal antibody compositions exhibit single binding specificity and affinity for a specific epitope.
[0036] In this invention, the detection of bovine coronavirus and closely related viruses is achieved through immunological detection methods. These immunological detection methods utilize the fundamental principles of immunology—antigen-antibody reactions, specifically the principle of the specific binding of antigens and antibodies. A chemical reaction is used to develop the color of a chromogenic agent (fluorescein, enzyme, metal ions, isotopes) labeled with antibodies, thereby enabling qualitative, quantitative, or localization studies of intracellular antigens (peptides and proteins) or antibodies. Such techniques include, but are not limited to, enzyme-linked immunosorbent assay (ELISA) (indirect, direct, or double-antibody sandwich method), immunofluorescence, radioimmunoassay, Western blotting, immunohistochemistry, immunoprecipitation, and chromatin coprecipitation.
[0037] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0038] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0039] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0040] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0041] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0042] Example 1: Preparation and purification of bovine coronavirus (BCoV) viral antigen
[0043] 1. Culture and amplification of BCoV virus
[0044] 1.1 Cell Preparation
[0045] HRT-18G cells were passaged routinely in RPMI 1640 complete medium containing 10% FBS at 37°C and 5% CO2. Once the cells had grown to approximately 90% confluence and formed a dense monolayer in T75 cell culture flasks, they were used for virus inoculation.
[0046] 1.2 Virus inoculation and proliferation
[0047] 1 mL of BCoV NXWZ2310 strain virus solution was inoculated into a cell monolayer. Immediately, 9 mL of serum-free DMEM maintenance medium was added, and the mixture was incubated at 37°C for 1 h to allow virus adsorption. Then, 9 mL of serum-free DMEM maintenance medium was added again.
[0048] Cell culture flasks were placed in a 37°C, 5% CO2 incubator and cultured for another 3 days, with daily observation of cytopathic effect (CPE). When approximately 80% of cells showed CPE, the culture was collected, and after three freeze-thaw cycles, it was centrifuged at 4°C, 3000 rpm for 10 min, and the viral supernatant was collected.
[0049] 2. Ultracentrifugation concentration and purification of BCoV virus
[0050] Centrifuge approximately 40 mL of viral supernatant at 120,000 g for 30 min at 4 °C, discard the precipitate, and collect the supernatant to remove cell debris. Centrifuge the clarified supernatant at 120,000 g for 2 h at 4 °C, discard the supernatant, and retain the viral precipitate. Repeat this step once. Add sterile PBS buffer (pH 7.4) to the precipitate, and gently resuspend overnight at 4 °C with gentle shaking to obtain concentrated BCoV virus solution.
[0051] Example 2: Construction and screening of hybridoma cell lines containing anti-BCoV monoclonal antibodies
[0052] 1. Animal immunization
[0053] The concentrated BCoV virus solution prepared in Example 1 was used to immunize 6-8 week old female BALB / c mice (purchased from the Comparative Medicine Center of Yangzhou University) via subcutaneous multi-site injection. A total of three immunizations were administered, with each immunization spaced two weeks apart. The first immunization used 100 μL of the concentrated BCoV virus solution prepared in Example 1 mixed with an equal volume of complete Freund's adjuvant (purchased from Sigma). The subsequent two immunizations used a mixture of 100 μL of the concentrated BCoV virus solution prepared in Example 1 and an equal volume of incomplete Freund's adjuvant (purchased from Sigma). Two weeks after the third immunization, blood was collected to detect the serum titer of the mice. ELISA antibody titers >10 were selected. 6 Mice were given a booster immunization 4 days before cell fusion, using 100 μL of concentrated BCoV virus solution prepared in Example 1 via intraperitoneal injection.
[0054] 2. Cell fusion
[0055] Cell fusion was performed using the PEG cell fusion method. Mouse myeloma cells (SP2 / 0) and spleen cells from immunized Balb / c mice were mixed thoroughly at a ratio of 1:5, centrifuged at 2000 rpm at 25°C for 5 min, the supernatant was discarded, and an appropriate amount of serum-free RPMI-1640 medium was added for resuspending. The cells were then centrifuged at 2000 rpm at 25°C for 5 min to wash them, the supernatant was discarded, and the bottom of the tube was gently tapped to loosen and evenly distribute the cells. The tube was then preheated in a 37°C water bath for 1 min, and 0.8 mL of PEG2000 preheated in a 37°C water bath was added while shaking. After adding the culture medium, continue shaking for 1 min. Then, within 5 min, add 12 mL of serum-free RPMI-1640 medium preheated to 37℃ at speeds of 1, 2, 3, 3, and 3 mL respectively. Incubate at 37℃ for 10 min, centrifuge at 2000 rpm at 25℃ for 5 min, discard the supernatant, resuspend the cells in RPMI-1640 medium containing 15% FBS and HAT, aliquot into 96-well plates already coated with feeder cells, and incubate in a 5% CO2 incubator. Observe the cell condition in the wells during this period. After 7 days of confluence, when the cells have grown to 1 / 10 to 1 / 5 of the bottom area of the 96-well plate, collect the supernatant for antibody detection.
[0056] 3. Screening of hybridoma cells
[0057] Using 0.05 mol / L pH 9.6 carbonate buffer as the coating medium, concentrated BCoV virus solution prepared in Example 1 at a 1 μg / μL dilution was used to coat the ELISA plate with antigen, 100 μL / well, and incubated overnight at 4°C. The plates were washed three times with PBST and blotted dry. Fusion cell supernatant, 1:1000 (v / v) diluted Balb / c immunized mouse positive serum, and 1:1000 (v / v) diluted mouse negative serum were added to the corresponding wells, 100 μL / well, and incubated at 37°C for 1 h. The plates were washed three times with PBST and blotted dry. Horseradish peroxidase (HRP)-labeled goat anti-mouse IgG (purchased from Beijing TransGen Biotech Co., Ltd.) diluted 1:4000 (v / v) was added, 100 μL / well, and incubated at 37°C for 1 h. The plates were washed three times with PBST and blotted dry. Add 100 μL of TMB substrate to each well and incubate at room temperature in the dark for 10 min. Stop the reaction by adding 50 μL of 2 mol / L sulfuric acid to each well. Measure the OD of the microplate using a microplate reader. 450nm Value, P is the OD of each detection well. 450nm Value, N is the OD of negative serum 450nm Value, when negative serum OD 450nm Value ≤0.1 and positive serum OD 450nm Values and negative serum OD 450nmThe positive / negative test result of a well was determined by a P / N ratio ≥ 2.1, assuming both negative and positive controls were valid. A second test was performed after 2 days, and hybridoma cell lines with positive results in both tests were selected for subcloning. From 792 single-clone wells, 125 positive single-clone wells secreting BCoV antibodies were selected, and the antibodies secreted by these 125 positive wells were further validated using a neutralization experiment.
[0058] 4. Virus neutralization experiment
[0059] The BCoV virus stock solution was diluted to contain 200 TCID per 100 μL. 50 Mix thoroughly with 100 μL of monoclonal antibody supernatant and incubate at 37°C for 1 hour. Distribute the 125 virus-antibody complexes into pre-coated 96-well plates of HRT-18G cells and incubate at 37°C, observing for characteristic cytopathic effects. The presence of cytopathic effects indicates that the monoclonal antibody supernatant has no virus-neutralizing ability; the absence of cytopathic effects indicates that the monoclonal antibody supernatant in that well secretes BCoV neutralizing antibodies. Six monoclonal antibodies with neutralizing activity were screened from the 125 BCoV antibody-positive monoclonal wells.
[0060] 5. Cloning of hybridoma cells
[0061] The selected positive cell lines were stained with trypan blue, counted, and diluted to 100 cells / 10 mL of RPMI-1640 medium containing 15% FBS. The diluted cell suspension was added to 100 μL per well of a 96-well plate pre-coated with feeder cells and incubated at 37°C in a 5% CO2 incubator. Cell lines were observed during incubation. When the cell lines grew to 1 / 10–1 / 5 of the bottom area of each well, ELISA was performed using the previously established indirect ELISA method. Positive wells with single-cloned cells were recorded, and the same subcloning process was repeated at least three times until all cloned cell lines showed positive results in supernatant detection and the OD values of each well were recorded. 450nm The values were relatively close. The cloned BCoV-specific monoclonal antibody hybridoma cell line was expanded and cryopreserved. Finally, a hybridoma cell line #1-2D4-E3-D3 that continuously secretes neutralizing antibodies was obtained.
[0062] Hybridoma cell line #1-2D4-E3-D3 was deposited on November 6, 2025, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: C2025147.
[0063] 6. Monoclonal antibody variable region sequencing
[0064] Total RNA was extracted from hybridoma cells #1-2D4-E3-D3 and reverse transcribed to obtain cDNA. Using the cDNA as a template, PCR amplification was performed on the antibody heavy chain variable region (VH) and light chain variable region (VL) genes using specific primers. The PCR products were detected by 0.8% agarose gel electrophoresis, recovered from the gel, ligated into the PMD19-T vector, and sequenced. The primer sequences and the monoclonal antibody variable region sequence are as follows:
[0065] Heavy chain variable region amplification primers:
[0066] VH-F: SARGTNMAGCTGSAGSAGTC, SEQ ID NO.3;
[0067] VH-R: ATAGACAGATGGGGGTGTCGTTTTGGC, SEQ ID NO.4.
[0068] Light chain variable region amplification primers:
[0069] VL-F: GAYATTGTGMTSACCMCARWCTMCA, SEQ ID NO.5;
[0070] VL-R: TACGTTTGATCTCCACCTTGGTC, SEQ ID NO.6.
[0071] Heavy chain variable region sequence:
[0072] CAGGTGCAGCTGGAGGAGTCTGGACCTGAGCTGGAGCCTGGGGCTTCAGAGATGTCCTGCAAGGCTTCTGGATACACCTTCACTGACTACAAGTGGGAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAAGAATGGTGATACTTTCTACAACCAGAAGTTCAAGGG CAAGGCCTCATCTGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCCATCTGAGGACTCTGCAGTCTATTACTGTGCAAGAAAGGGGGGCTACTATGAAGATGTTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGCCAAAACGACACCCCCATCTGTCTAT (SEQ IDNO.1).
[0073] Light chain variable region sequence:
[0074] GACATTGTGATGACCCAGTCTCCGGCTTCCTTAGCTGTATCTCTGGGGCAGAGGGCCACCATCTCATACAGGGCCAGCAAAAGTGTCAGTACATCTGGCTATAGTTATATGCACTGGAACCAACAGAAACCAGGACAGCCACCCAGACTCCTCATCTATCTTGTATCC AACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACCCTCAACATCCATCCTGTGGAGGAGGAGGATGCTGCAACCTATTACTGTCAGCACATTAGGGAGCTTACACGTTCGGAGGGGGGACCAAGGTGGAGATCAAACGTA (SEQ ID NO.2).
[0075] 7. Monoclonal antibody identification
[0076] 7.1 Monoclonal antibody subtype identification
[0077] The detection was performed using an SBA mouse monoclonal antibody typing kit. The specific steps were as follows: The capture antibody was diluted to 5-10 μg / mL with PBS, and 100 μL / well was used to coat the microplate. The plate was incubated overnight at 4°C. The plate was washed three times with PBST for 5 min each time. 100 μL / well of 1% BSA was added, and the plate was incubated at room temperature for 1 h. The plate was washed three times with PBST for 5 min each time. 100 μL / well of monoclonal antibody cell supernatant was added, and the plate was incubated at 37°C for 1 h. The plate was washed three times with PBST for 5 min each time. 100 μL / well of HRP-labeled detection antibody diluted with PBS was added, and the plate was incubated at room temperature for 1 h. The plate was washed three times with PBST for 5 min each time. 100 μL / well of TMB chromogenic buffer was added, and the plate was incubated at 37°C in the dark for 5 min. Finally, 50 μL of stop solution was added to each well, and the OD values were read using a microplate reader. 450nm Numerical value.
[0078] The test results showed that the heavy chain of the monoclonal antibody was of the IgG type, and the light chain was of the κ type.
[0079] 7.2 Identification of antigenic epitopes for monoclonal antibodies
[0080] To further identify the antigenic epitope site of the monoclonal antibody, 293T cells were transfected with the HE protein, and the antibody's binding ability to the HE protein was detected by in vitro immunoassay (IFA). The results (Figure 1) show that the monoclonal antibody reacted with the HE protein but not with other structural proteins. This indicates that the antigenic epitope of the monoclonal antibody is located on the BCoV HE protein.
[0081] Example 3: Characterization and Functional Analysis of Monoclonal Antibodies
[0082] 1. Indirect immunofluorescence assay (IFA)
[0083] HRT-18G cells infected with bovine coronavirus NXWZ2310 and normal HRT-18G cells were cultured for 5 days. The supernatant was discarded, and the cells were washed 3 times with PBS. They were then fixed overnight at 4°C with 100 μL / well fixative (Beyotime Biotechnology Co., Ltd.), and washed 3 times with PBS. They were then blocked at 37°C for 2 h with 100 μL / well blocking buffer (Beyotime Biotechnology Co., Ltd.), and the blocking buffer was discarded. The cells were then washed 3 times with PBS.
[0084] Add 100 μL of hybridoma cell supernatant to each well, and use SP2 / 0 cell supernatant and pre-immunization mouse serum and post-immunization mouse serum as negative and positive controls, respectively. React at 37℃ for 1 h. After washing 3 times with PBS, react with FITC-labeled goat anti-mouse IgG (1:800, Beyotime Biotechnology Co., Ltd.) at 37℃ for 1 h. After washing 3 times with PBS, pat dry and observe under a fluorescence microscope.
[0085] The results of the indirect immunofluorescence experiment are shown in Figure 2. No specific fluorescence was observed in the SP2 / 0 cell supernatant or in the pre-immunization mouse serum when reacting with HRT-18G cells infected with the NXWZ2310 virus strain and normal cells. Specific fluorescence was observed in the mouse serum immunized with the concentrated BCoV virus solution prepared in Example 1 when reacting with HRT-18G cells infected with the NXWZ2310 virus strain, indicating that both the negative and positive controls were effective. A significant specific fluorescent reaction was observed when the monoclonal antibody reacted with HRT-18G cells infected with the NXWZ2310 virus strain, but no such reaction was observed with normal HRT-18G cells.
[0086] 2. Specificity test
[0087] The reactivity of monoclonal antibodies was detected using an indirect immunofluorescence assay with cell slices infected with bovine coronavirus (BCoV), sheep coronavirus (cpCoV), porcine epidemic diarrhea virus (PEDV), and porcine deltacoronavirus (PDCoV) as antigens.
[0088] The results are shown in Figure 3 and Table 1. The monoclonal antibody reacted positively with cells infected with BCoV and cpCoV, but did not react with cells infected with PEDV and PDCoV, indicating that it has some cross-reactivity with members of the coronavirus β genus, but no cross-reactivity with other coronavirus genera.
[0089] Table 1 Results of monoclonal antibody specificity assay
[0090]
[0091] Note: "+" indicates a positive reaction; "-" indicates no reaction.
[0092] 3. Neutralization activity identification and potency determination
[0093] 3.1 Identification of neutralizing activity
[0094] Add 100 μL of cell culture supernatant containing monoclonal antibody to an 8-tube array, then inactivate the cells in a 56°C water bath for 30 minutes. Add 100 μL of virus diluent to the monoclonal antibody supernatant and incubate at 37°C in a CO2 incubator for 1 hour for neutralization. Inoculate 100-150 μL of the neutralized virus-antibody mixture into HRT-18G monolayer cells, gently agitating to ensure adequate contact between the virus and cells. Label the cells and incubate at 37°C (no additional medium is needed). Include one negative control well and one positive control well on each culture plate. After 1-3 days of culture, observe the cytopathic effect (CPE) and compare the cells with the negative and positive controls. Record the wells showing neutralization activity and observe for the presence of CPE.
[0095] The results are shown in Figure 4 and Table 2. The monoclonal antibody showed neutralizing activity against both BCoV and cpCoV.
[0096] Table 2 Results of monoclonal antibody neutralization activity assay
[0097]
[0098] Note: "+" indicates neutralizing activity.
[0099] 3.2 Determination of neutralizing potency
[0100] Cell culture supernatant containing monoclonal antibodies was filtered through a 0.22 μm filter, serially diluted twofold, and then the neutralizing activity was determined according to the steps described above. The neutralizing titer (i.e., the reciprocal of the highest antibody dilution that protects 50% of cell wells from CPE) was calculated using the Reed-Muench method.
[0101] The results are shown in Table 3. The neutralizing titer of the monoclonal antibody against BCoV was 1:2. 6 (i.e., 1:64), with a neutralizing titer of 1:2 against cpCoV. 3 (i.e., 1:8).
[0102] Table 3 Results of Monoclonal Antibody Neutralization Titer Detection
[0103]
[0104] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A hybridoma cell line, characterized in that, The hybridoma cell line was deposited at the China Center for Type Culture Collection on November 6, 2025, with accession number CCTCC NO: C2025147.
2. A monoclonal antibody, characterized in that, Secreted by the hybridoma cell line of claim 1.
3. The monoclonal antibody according to claim 2, characterized in that, The heavy chain variable region nucleotide sequence of the monoclonal antibody is shown in SEQ ID NO.1, and the light chain variable region nucleotide sequence is shown in SEQ ID NO.
2.
4. The monoclonal antibody according to claim 3, characterized in that, The heavy chain of the monoclonal antibody is of the IgG type, and the light chain is of the κ type.
5. A polynucleotide encoding a monoclonal antibody or a functional fragment thereof as described in any one of claims 2-4.
6. A nucleic acid vector, characterized in that, Includes the polynucleotide described in claim 5.
7. A recombinant host cell containing the nucleic acid vector of claim 6.
8. A method for preparing the monoclonal antibody according to any one of claims 2-4, characterized in that, include: Hybridoma cell line with accession number CCTCC NO: C2025147 was cultured to obtain the monoclonal antibody; Alternatively, the recombinant host cells of claim 7 can be cultured to induce the expression of the monoclonal antibody.
9. The use of the monoclonal antibody according to any one of claims 2-4 in the preparation of products for detecting bovine coronavirus and closely related viruses, characterized in that, The closely related viruses are those closely related to it within the β-coronavirus genus.
10. The application according to claim 9, characterized in that, The viruses closely related to it include sheep coronaviruses.