Application of ZmXTH27 gene in improving cold resistance of plants

Overexpression of the ZmXTH27 gene in Arabidopsis thaliana solved the problem of maize's sensitivity to low-temperature stress, significantly improved the plant's cold tolerance, reduced low-temperature damage, and enhanced photochemical efficiency and membrane lipid stability.

CN121759489AActive Publication Date: 2026-03-31SANYA INST OF HENAN UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610254848.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-04
Publication Date
2026-03-31
Estimated Expiration
2046-03-04

AI Technical Summary

Technical Problem

Maize is sensitive to low temperature stress, which leads to stunted growth and reduced yield. Current research has not yet clarified the role of the ZmXTH27 gene in regulating low temperature tolerance.

Method used

By constructing an overexpression vector for the ZmXTH27 gene, the gene was overexpressed in Arabidopsis thaliana using Agrobacterium-mediated transformation. This simulated low-temperature stress experiments, revealing its biological function in improving plant cold tolerance.

Benefits of technology

Overexpression of the ZmXTH27 gene significantly improved the cold tolerance of plants, reduced leaf damage caused by low temperature, maintained high photochemical efficiency, and reduced membrane lipid peroxidation levels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759489A_ABST
    Figure CN121759489A_ABST
Patent Text Reader

Abstract

The invention relates to an application of a corn ZmXTH27 gene in improving the cold resistance of plants. The ZmXTH27 gene encodes a protein of a xyloglucan endotransglycosidase / hydrolase (XTH) family, the gene expression level of the ZmXTH27 gene is remarkably increased under low-temperature stress, and a mutant zmxth27 of the gene shows a low-temperature sensitive phenotype. The ZmXTH27 gene is transformed into arabidopsis thaliana and is subjected to functional verification, and compared with wild type arabidopsis thaliana, the tolerance of an arabidopsis thaliana plant over-expressed with the ZmXTH27 gene to cold stress is remarkably enhanced. According to the invention, more theoretical bases are provided for corn cold resistance research, and gene resources and biotechnological means are provided for subsequent cultivation and germplasm resource innovation of new cold-resistant corn strains.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically involving ZmXTH27 Its application in plant cold tolerance involves more specifically improving... ZmXTH27 Application of gene expression in improving plant cold tolerance. Background Technology

[0002] corn( Zea mays L. As an important food crop originating in tropical regions, maize is highly sensitive to low-temperature stress. Low-temperature injury is one of the major abiotic stresses restricting maize production, severely inhibiting its growth, development, and yield. Under low-temperature stress, maize exhibits a series of physiological disorders, including decreased seed germination rate, stunted growth, inhibited differentiation of male and female ears, reduced pollen viability, and weakened photosynthetic rate, ultimately leading to a significant decline in both yield and quality. Therefore, systematically analyzing the molecular mechanisms of maize's response to low-temperature stress and deeply exploring cold-resistance-related gene resources not only provides a theoretical basis and technical support for the molecular design breeding of new cold-resistant maize varieties but also has significant scientific value and practical significance in addressing the risk of reduced grain yields caused by extreme climates.

[0003] Xylglucan endoglucosidases / hydrolases (XTHs) are widely distributed in various plant tissues and cells. They modify the cellulose-xylglucan complex structure of plant cell walls by catalyzing the breakage and reconnection of xylglucan molecules, participating in cell wall remodeling processes and acting as one of the key enzymes regulating the dynamic changes of plant cell walls. Existing research has shown that XTHs are involved in plant growth, development, and abiotic stress responses, but the mechanism by which the maize-specific member ZmXTH27 regulates low-temperature tolerance remains unclear. Summary of the Invention

[0004] The purpose of this invention is to provide corn ZmXTH27 The application of genes in improving plant cold tolerance.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: Based on the maize whole genome sequence published on the MaizeGDB website (http: / / www.maizegdb.org / ), maize... ZmXTH27 Nucleotide sequence information of the gene (sequence number: GRMZM2G392125). ZmXTH27 The gene coding frame has a nucleotide sequence length of 834 bp, as shown in SEQ ID NO.1, and consists of 277 amino acids, as shown in SEQ ID NO.2. The sequence can be obtained by searching the MaizeGDB official website.

[0006] The present invention also constructs a series of plant expression vectors, and the functions of overexpression vectors, recombinant vectors or transgenic plant lines containing the above-mentioned genes, as well as host cells containing the vectors, in improving plant cold tolerance also fall within the protection scope of the present invention.

[0007] The gene functions protected by this invention include not only those described above. ZmXTH27 Genes, including those related to ZmXTH27 The function of homologous genes with high homology (such as above 80%; more preferably above 90%; more preferably above 95%; more preferably above 98%) in low temperature tolerance.

[0008] This invention is based on ZmXTH27 Primers were designed based on the CDS sequence of the gene, and a recombinant vector driven by the 35S promoter was constructed. The vector was then obtained via Agrobacterium infection. ZmXTH27 Gene overexpression lines were analyzed. ZmXTH27 The biological functions of overexpressed gene lines in response to low-temperature stress can provide genetic resources for molecular breeding of cold-resistant crops.

[0009] This invention discloses ZmXTH27 The biological function of genes in improving cold tolerance in maize is specifically manifested in: under low-temperature stress, ZmXTH27 Compared to the wild type, the loss-of-function mutant exhibited more severe leaf curling and wilting, as well as greater leaf damage. Specifically, its maximum photochemical efficiency (Fv / Fm) was significantly lower than that of the wild type, while its leaf damage area, ion leakage rate, and malondialdehyde content were all higher. Overexpression... ZmXTH27 The Arabidopsis thaliana plants with the gene showed significantly reduced leaf damage, significantly higher Fv / Fm values ​​than the wild type, significantly lower ion leakage rate and malondialdehyde content, and significantly improved cold tolerance.

[0010] The above application draws conclusions by simulating low-temperature stress experiments in a temperature-controlled incubator.

[0011] Specifically, it will be driven by the 35S starter. ZmXTH27 The recombinant gene vector p35S-ZmXTH27-GFP was introduced into Arabidopsis thaliana using Agrobacterium-mediated transformation.

[0012] Based on their function, cold-resistant plants can be obtained through genetic modification; specifically, this can be achieved by improving... ZmXTH27 Gene expression in the target plant yields a transgenic plant, which is more cold-resistant than the target plant.

[0013] In one embodiment of the present invention, polynucleotides are cloned into the pCAMBIA-1300-GFP vector using conventional methods, and the recombinant vector carrying the exogenous gene is introduced into Arabidopsis thaliana to enhance the efficacy of the plant. ZmXTH27 Gene expression levels.

[0014] The term "plant" in this invention includes the whole Arabidopsis thaliana plant, its parent and progeny plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots, flowers, and other tissues and organs, to improve the quality of these different parts. ZmXTH27 Gene expression levels.

[0015] This invention also extends to the harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, and other tissues and organs. It further relates to other derivatives of the plant after harvest, such as dried granules or powders, oils, fats and fatty acids, starches, or proteins. This invention also relates to foods or food additives obtained from the relevant plants.

[0016] Advantages of this invention: This invention has identified a maize species using molecular biology techniques. ZmXTH27 Genes, experiments have shown that low-temperature treatment significantly induced ZmXTH27 Gene expression was analyzed, and then mutant materials of that gene were compared with wild-type materials. The cold-treated mutant materials showed a significant decrease in tolerance to low-temperature stress. Then, maize was constructed... ZmXTH27 Gene overexpression vectors were used to transform wild-type Arabidopsis thaliana using an Agrobacterium-mediated transformation method. The effects of overexpression were revealed through simulated low-temperature stress experiments in an incubator. ZmXTH27 Genes can enhance the cold tolerance of plants, providing genetic resources for molecular breeding of cold-tolerant maize. Attached Figure Description

[0017] Figure 1 Wild-type maize after low-temperature treatment ZmXTH27 Gene expression levels.

[0018] Figure 2 Maize mutant zmxth27-1 , zmxth27-2 and allelic verification lines zmxth27-1 / zmxth27-2 middle ZmXTH27 Image of sequencing results of gene amplification products. In the image, A represents... zmxth27-1 The sequencing results are shown in Figure B; B represents... zmxth27-2 The sequencing results are shown in the figure; C represents... zmxth27-1 / zmxth27-2 The sequencing results are shown in the figure.

[0019] Figure 3 Wild-type maize after low-temperature treatment and zmxth27-1 , zmxth27-2 and allelic verification lines zmxth27-1 / zmxth27-2 The growth phenotype.

[0020] Figure 4 Wild-type maize after low-temperature treatment and zmxth27-1 , zmxth27-2 and allelic verification lines zmxth27-1 / zmxth27-2 Statistical results of maximum photochemical efficiency (Fv / Fm), leaf damage area, ion leakage rate, and malondialdehyde (MDA) content. In the figure, A is the statistical graph of maximum photochemical efficiency (Fv / Fm); B is the statistical graph of leaf damage area; C is the statistical result of MDA content; and D is the statistical result of ion permeability.

[0021] Figure 5 For Arabidopsis wild type (Col-0) and ZmXTH27 Gene overexpression lines ZmXTH27 OE-1 and ZmXTH27 OE-2 middle ZmXTH27 Gene expression level detection.

[0022] Figure 6 For low-temperature treatment of Arabidopsis wild-type Col-0 and ZmXTH27 Gene overexpression lines ZmXTH27 OE-1 and ZmXTH27 OE-2 The growth phenotype.

[0023] Figure 7 For low-temperature treatment of Arabidopsis wild-type Col-0 and ZmXTH27 Gene overexpression lines ZmXTH27 OE-1 and ZmXTH27 OE-2 Statistical results of maximum photochemical efficiency (Fv / Fm), ion leakage rate, and malondialdehyde content. In the figure, A represents the statistical graph of maximum photochemical efficiency (Fv / Fm); B represents the statistical results of ion permeability; and C represents the statistical results of malondialdehyde content. Detailed Implementation

[0024] The principles and features of the present invention will now be described in detail with reference to the accompanying drawings. These embodiments are provided to provide a more thorough explanation of the invention and to fully convey the scope of the invention to those skilled in the art.

[0025] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used are commercially available.

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0027] Unless otherwise stated, the present invention will be implemented using conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are obvious to those skilled in the art. These techniques have been fully explained in the published literature. Furthermore, the methods used in the present invention for constructing overexpression vectors and obtaining transgenic plants, except for the methods used in the examples below, can all be implemented using methods already disclosed in the existing literature.

[0028] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.

[0029] In addition, to provide a more intuitive understanding of the technical solution of this invention, some technical terms involved in this invention are explained as follows: A "mutant" is an individual that has undergone a mutation and has phenotypic characteristics that differ from the wild type.

[0030] "Overexpression vector" refers to a DNA vector that uses a cloning vector as its basic framework and integrates highly efficient expression elements such as strong promoters, ribosome binding sites (RBS), and terminators to achieve overexpression of target genes in host cells.

[0031] Example 1: Low Temperature Stress ZmXTH27 Gene expression status Wild-type maize B73, grown at 25℃, was subjected to a 4℃ low-temperature treatment when it reached the two-leaf-one-heart stage. Samples were taken at 0, 6, 12, and 24 hours later, with the middle segment of the second leaf being harvested each time. Three biological replicates were set up for each time point. The collected leaf tissues were rapidly cryopreserved in liquid nitrogen for subsequent RNA extraction. After reverse transcription to obtain cDNA, real-time quantitative PCR (qPCR) analysis was performed. The results showed that low-temperature treatment significantly induced... ZmXTH27 Gene expression ( Figure 1 ).according to ZmXTH27 Specific real-time quantitative PCR primers qPCR-F and qPCR-R were designed based on the cDNA sequence of the gene, and the internal reference gene was maize. ubiquitin Gene (primers used: Ubiq-F and Ubiq-R). Detected by qPCR. ZmXTH27 The expression levels of the gene in maize inbred line B73, and the primer sequences are as follows: qPCR-F: 5'-ACGCCGATCCGGGAGTTCA-3'; qPCR-R: 5'-TCCCACAGCGAGCCGTAGAG-3'; Ubiq-F: 5'-TGGTTGTGGCTTCGTTGGTT-3'; Ubiq-R: 5'-GCTGCAGAAGAGTTTTGGGTACA-3'; Example 2 Wild-type maize and zmxth27 Comparison of cold tolerance of mutant strains 2.1 zmxth27 Identification and Acquisition of Mutants In order to investigate ZmXTH27 The function of genes in maize's response to low temperature stress ZmXTH27 Two EMS mutant materials of the gene were obtained from Qilu Normal University. Plant DNA was extracted, and PCR amplification was performed using specific primers (F1: ATGGCGAGCGCGTTTAG; R1: GAACCAGAGGTGGAACTGTTG). The products were then sequenced and identified. Homozygous mutant lines with two mutation sites were obtained through screening. zmxth27-1 A mutation at the start codon (ATG) 191 bp from G to A results in a mutation from arginine to isoleucine. Figure 2 (A) Another mutant zmxth27-2 A mutation from G to A at a base 194 bp from ATG results in a serine mutation to phenylalanine. Figure 2 (B in the text). Then, zmxth27-1 and zmxth27-2 The hybridization yielded F1 generation materials that showed heterozygous sites at both mutation sites, indicating that this material was heterozygous. ZmXTH27 Allelic verification lines of the gene ( Figure 2 (C in the middle).

[0032] 2.2 Low-temperature treatment method After seed germination, under normal growth conditions (25℃, 16h light / 8h darkness, light intensity 250 μmol / m²), -2 s -1The seedlings were cultured at a relative humidity of 70% until they reached the two-leaf-one-heart stage. Subsequently, the seedlings were placed under low-temperature stress conditions (4℃, with other photoperiod and humidity conditions as above) for 5 days, and then returned to a 25℃ greenhouse for recovery cultivation for 2 days. After recovery, phenotypic photographs were taken, and the leaf damage area, maximum photochemical efficiency of photosystem II (Fv / Fm), ion leakage rate, and malondialdehyde content were measured.

[0033] 2.3 Phenotype after low-temperature treatment like Figure 3 As shown, after cold treatment, the leaves of wild-type B73 maintained relatively good spread and condition, with only slight curling and damage at the leaf tips; while the mutant lines... zmxth27-1 , zmxth27-2 and mutant allelic verification lines zmxth27-1 / zmxth27-2 Compared to the wild type, the leaves of the cultivar exhibited more severe curling, wilting, and greater leaf damage, all showing a clear low-temperature sensitivity phenotype.

[0034] Key physiological indicators were also measured before and after cold stress treatment. Before treatment at 4℃, the mutant materials... zmxth27-1 , zmxth27-2 and its allelic verification lines zmxth27-1 / zmxth27-2 There was no significant difference in Fv / Fm values ​​compared to the wild type; after treatment at 4℃, ZmXTH27 The Fv / Fm values ​​of all mutant materials were significantly lower than those of the wild type ( Figure 4 (A) Meanwhile, the mutant materials after cold treatment zmxth27-1 z mxth27-2 and zmxth27-1 / zmxth27-2 The leaf damage area was larger in the wild type than in the wild type. Figure 4 (B in the text). Furthermore, compared to the wild type, the cold-treated mutant materials exhibited a higher degree of cell membrane damage, specifically manifested in significantly increased ion leakage rate and malondialdehyde content. Figure 4 (C, D in the above results) ZmXTH27 The loss of gene function leads to a significant decrease in the plant's tolerance to low temperature stress, further confirming the key role of this gene in the plant's low temperature response.

[0035] Example 3 Overexpression ZmXTH27 Genes enhance the cold tolerance of Arabidopsis plants. 3.1 ZmXTH27 Cloning of genes Based on the maize whole genome sequence published on the MaizeGDB website (http: / / www.maizegdb.org / ), maize... ZmXTH27Nucleotide sequence information of the gene. Using cDNA from leaves of the maize inbred line B73 at the three-leaf stage as a template, the coding region nucleotide sequence of the gene was amplified using specific primers (F2: cgggggactgagctcggtaccATGGCGAGCGCGTTTAGC; R2: gctcaccatgtcgactctagaCGCCATGGAGCACTCAGG) with KOD1 high-fidelity enzyme. The sequence did not contain a stop codon (to allow ZmXTH27 and GFP to form a fusion protein). The plant binary expression vector pCAMBIA1300-GFP was linearized by restriction endonucleases KpnI and XbaI. PCR products and the linearized vector were separated by agarose gel electrophoresis, and purified using a Kangwei Century agarose gel DNA recovery kit. The purified DNA was then... ZmXTH27 The gene coding region fragment was ligated to the linearized pCAMBIA1300-GFP vector using a one-step cloning method. After transformation, positive clones were screened and sequenced for verification. The correctly constructed recombinant plasmid, confirmed by sequencing, was named p35S-ZmXTH27-GFP. This plasmid can be used as the final vector for subsequent transgenic experiments.

[0036] 3.2 Overexpression ZmXTH27 Obtaining transgenic Arabidopsis thaliana plants (1) Agrobacterium transformation The p35S-ZmXTH27-GFP vector was transformed into Agrobacterium GV3101 competent cells using the heat shock method. The cells were then plated on solid LB medium containing 100 mg / L gentamicin, 50 mg / L rifampin, and 100 mg / L kanamycin. After incubation at 28°C for 2 days, positive clones were screened by PCR amplification using primers F2 and R2. The obtained positive clones were inoculated into liquid LB medium containing 100 mg / L gentamicin, 50 mg / L rifampin, and 100 mg / L kanamycin. After incubation at 28°C with shaking for 24 hours, 1 mL of the bacterial culture was collected and preserved for Arabidopsis transformation.

[0037] (2) Arabidopsis transformation Add 20 μL of the bacterial culture obtained in the above steps to 5 mL of liquid LB medium containing 100 mg / L gentamicin, 50 mg / L rifampin, and 100 mg / L kanamycin, and incubate at 28°C with shaking until the bacterial concentration reaches OD500. 600 =2.0. Then, 2 ml of bacterial culture was transferred to 50 mL of liquid LB medium containing 100 mg / L gentamicin, 50 mg / L rifampin, and 100 mg / L kanamycin, and incubated at 28°C with shaking until the bacterial concentration reached OD200. 600=0.8-1.0. Centrifuge the obtained 50 mL bacterial culture at 4000 rpm / min for 10 min, discard the supernatant, and resuspend the bacterial cells in 50 mL of infection buffer; wherein, the infection buffer formula is as follows: MS powder 2.2 g / L, 5% sucrose, Silwet L-77 200 μL / L.

[0038] Select healthy Arabidopsis plants that have bolted for one to two weeks, cut off the siliques and open flowers, leaving the apical meristem and flower buds, immerse the treated inflorescences in the resuspended bacterial solution for 1 minute, then cover with a black lid and culture in the dark for 24 hours before removing the black lid and culturing under light.

[0039] (3) ZmXTH27 Screening and identification of transgenic Arabidopsis plants After the Arabidopsis plants continued to grow for about a month, mature seeds were collected. Plump seeds were selected and sterilized for 15 min with 1 ml of 2% sodium hypochlorite solution (containing 0.5% Triton X-100). After discarding the sodium hypochlorite solution, the seeds were washed 3-5 times with sterile water and sown on 1 / 2 MS solid medium (containing 100 mg / L termethin and 30 mg / L hygromycin). After vernalization at 4°C in the dark for 3 days, the seeds were transferred to a light incubator for 7 days. The growth conditions were 22°C, 16 h light / 8 h dark, and a light intensity of 100 μmol / m². -2 s -1 Positive seedlings that grow normally on the resistant medium will be transplanted into soil.

[0040] Genetic segregation ratio method for identifying insertion copy number: Based on genetic principles, self-crossing after a single copy insertion will produce a 3:1 segregation ratio in the offspring. Combined with statistical methods, the number of resistant and non-resistant seedlings on antibiotic culture media was counted. The segregation ratio method was used to identify transgenic plants that were lines with a single copy insertion (single copy). ZmXTH27 Transgenic Arabidopsis thaliana can be used for screening homozygotes.

[0041] Transgenic Arabidopsis ZmXTH27 OE-1 and ZmXTH27 OE-2 Screening of homozygous lines: After the above identification and analysis, two single-copy lines were randomly selected. ZmXTH27 Transgenic Arabidopsis thaliana lines are respectively denoted as ZmXTH27 OE-1 and ZmXTH27 OE-2 (T1 generation). Plants were sown on 1 / 2 MS medium containing 30 mg / L hygromycin. After two generations of selection, the parental plants in which all self-pollinated progeny grew normally (i.e., all progeny exhibited hygromycin resistance) were designated as homozygous lines, ultimately yielding the T3 generation of transgenic Arabidopsis thaliana. ZmXTH27 OE-1 and ZmXTH27 OE-2 The homozygous single-copy plants were used as experimental materials for subsequent experimental analysis.

[0042] 3.3 Transgenic Arabidopsis plants ZmXTH27 Detection of gene expression levels For testing ZmXTH27 To determine the expression level of the gene in transgenic Arabidopsis thaliana, total RNA was extracted from leaves of positive transgenic Arabidopsis thaliana plants and reverse transcribed into cDNA. Based on... ZmXTH27 Design specific RT-PCR primers (RT-PCR-F and RT-PCR-R) based on the cDNA sequence of the gene, Arabidopsis thaliana eIF4A The gene was used as an internal control (primers were eIF4A-F and eIF4A-R). Detection was performed by RT-PCR. ZmXTH27 The expression levels of the gene in transgenic Arabidopsis thaliana, and the primer sequences are as follows: RT-PCR-F: 5'-ATGGCGAGCGCGTTTAGC-3'; RT-PCR-R: 5'-CGCCATGGAGCACTCAGG-3'; eIF4A-F: 5'-TGACCACACAGTCTCTGCAA-3'; eIF4A-R: 5'-ACCAGGGAGACTTGTTGGAC-3'; RT-PCR results showed that ZmXTH27 The gene was not detected in wild-type Arabidopsis thaliana (Col-0), but was expressed in two overexpressing transgenic lines. ZmXTH27 OE-1 and ZmXTH27 OE-2 Significant expression in both groups ( Figure 5 The above results indicate that among the obtained transgenic lines... ZmXTH27 The gene was successfully expressed and can be used for subsequent cold-resistant phenotype analysis.

[0043] 3.4 Overexpression ZmXTH27 Analysis of cold tolerance phenotypes in Arabidopsis thaliana plants To clarify the overexpression ZmXTH27 The effect of genes on cold tolerance in Arabidopsis thaliana: We investigated the effects of genes on cold tolerance in wild-type Arabidopsis thaliana (Col-0) and two independent overexpression genes. ZmXTH27 homozygous transgenic lines ( ZmXTH27 OE-1 and ZmXTH27 OE-2 A systematic analysis of low-temperature stress phenotypes was conducted.

[0044] Arabidopsis seeds were inoculated onto 1 / 2 MS solid medium and vernalized at 4°C in the dark for 3 days, then transferred to a light incubator (conditions: 22°C, 16h light / 8h dark, light intensity 100 μmol / m²). -2 s -1The seedlings were cultured for 7 days. Then, they were transplanted into nutrient soil and cultured for another 3 weeks under the same conditions. They were divided into two groups: one group continued to grow under normal conditions as a control; the other group was subjected to low temperature stress treatment, which was 4℃ for 24 hours, then -8℃ for 2 hours, and then restored to 22℃ for 2 days.

[0045] like Figure 6 As shown, under normal conditions, wild type and ZmXTH27 OE-1 , ZmXTH27 OE-2 No significant difference in growth was observed between the overexpression lines. After low-temperature treatment, wild-type plants exhibited severe curling, wilting, and extensive damage, displaying a typical low-temperature sensitive phenotype. In contrast, ZmXTH27 The leaf damage in the gene-overexpressing lines was significantly reduced, and their overall phenotype was significantly better than that of the wild type, showing stronger cold tolerance. Before low-temperature treatment, there was no significant difference in Fv / Fm values ​​among the lines; after low-temperature treatment, the Fv / Fm values ​​of all lines decreased, but the Fv / Fm values ​​of the overexpressing lines were significantly higher than those of the wild type. Figure 7 In addition, compared with the wild type, the ion leakage rate and malondialdehyde content of the overexpression lines after low-temperature treatment were significantly lower than those of the wild type (A). Figure 7 The results (B and C in the original text) indicate that their cell membranes suffered less damage from low temperatures. These results combined suggest that overexpression of [the substance] in Arabidopsis thaliana [is beneficial]. ZmXTH27 The gene can effectively reduce leaf damage caused by low temperature, maintain high photochemical efficiency, and reduce membrane lipid peroxidation levels, thereby significantly improving the plant's cold resistance.

[0046] The above description is only a preferred embodiment of the present invention and is used only to explain the present invention. It is not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. All changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. ZmXTH27 The application of genes in improving plant cold tolerance is characterized by, The ZmXTH27 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the plant is maize or Arabidopsis thaliana.

2. The application according to claim 1, characterized in that, By constructing the p35S-ZmXTH27-GFP expression vector and using the 35S promoter to drive... ZmXTH27 Overexpression of genes leads to the production of transgenic plants with improved cold tolerance.

3. The application according to claim 1, characterized in that, The application specifically includes: [the following is a description of the application]. ZmXTH27 Genes are introduced into plant cells, tissues, or organs, and the transformed plant material is then cultivated into complete plants, and plant varieties with improved cold tolerance are selected.

4. The application according to claim 1, characterized in that, The improved cold resistance is manifested in the following way: under low-temperature stress, overexpression of... ZmXTH27 The genetically modified plants showed significantly reduced leaf damage, significantly higher maximum photochemical efficiency than the wild type, and significantly lower ion leakage rate and malondialdehyde content than the wild type.

5. A method for improving the cold tolerance of plants, characterized in that, Increase the concentration of plants ZmXTH27 The expression of genes and / or the activity of the proteins they encode, said ZmXTH27 The nucleotide sequence of the gene is shown in SEQ ID NO.1, the amino acid sequence of the protein is shown in SEQ ID NO.2, and the plant is maize or Arabidopsis thaliana.

6. A plant breeding method, characterized in that, The method is as follows (1) or (2): (1) By enhancing the activity of ZmXTH27 protein in the target plant, plants with stronger cold resistance than the target plant were obtained; (2) By increasing the content of the target plant ZmXTH27 Gene expression was used to obtain plants that were more cold-resistant than the target plant. The ZmXTH27 The nucleotide sequence of the gene is shown in SEQ ID NO.1, the amino acid sequence of the ZmXTH27 protein is shown in SEQ ID NO.2, and the plant is maize or Arabidopsis thaliana.

Citation Information

Patent Citations

  • Method for improving cold resistance of chilies by utilizing ramie BnXTH2 genes

    CN112481296A

  • Application of GhXTH22 gene in cold stress resistance of cotton and obtaining method of GhXTH22 gene

    CN118272388A